ID: 973639773

View in Genome Browser
Species Human (GRCh38)
Location 4:52891352-52891374
Sequence CAGTGGGTAAGTAAGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 347}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973639773 Original CRISPR CAGTGGGTAAGTAAGGAAGG TGG Intronic
901947471 1:12715455-12715477 CAGTGGGGGGGTGAGGAAGGTGG + Intergenic
902446757 1:16471287-16471309 CAGGGGTTAAGGAGGGAAGGAGG - Intergenic
903171821 1:21559020-21559042 CAGTGCGTGTGTGAGGAAGGAGG + Intronic
904826641 1:33277565-33277587 CAGGGGGTAAGCATGGAAGCAGG + Intronic
904853023 1:33473245-33473267 CAGTGGGTAAGTAGGTAGGTAGG - Intronic
904937886 1:34144719-34144741 GAGAGGGGAAGTAAGGGAGGGGG + Intronic
904944494 1:34189474-34189496 CAGTGTGGAAGCAAGGGAGGTGG - Intronic
904980281 1:34495173-34495195 TAGTGGGTAAGAAATGGAGGAGG - Intergenic
905122949 1:35695727-35695749 CAGTGGGGAGGGAAGAAAGGAGG + Intergenic
905323138 1:37131797-37131819 AAGTGGGGAAGGAAGGAAGGGGG - Intergenic
905876379 1:41434390-41434412 CAGTGGGCAGTCAAGGAAGGAGG - Intergenic
906046700 1:42836520-42836542 CAGTGGTAAAGCAAGGAATGGGG + Intronic
906348690 1:45038463-45038485 CAAAGGGTAGGAAAGGAAGGTGG + Intronic
906861470 1:49364854-49364876 CAGATGGTGAGTAATGAAGGAGG + Intronic
906927043 1:50128830-50128852 TAGTGGGTAAAGAAGGAAGATGG + Intronic
910957507 1:92722892-92722914 CAGTGGGTAAGGTAGAAAGCTGG - Intronic
911304260 1:96213987-96214009 GAGTGTGTAAAGAAGGAAGGTGG + Intergenic
913488560 1:119356803-119356825 CAGAGGATAACAAAGGAAGGAGG + Intergenic
914438055 1:147678073-147678095 CAGTGGAGAACAAAGGAAGGAGG + Intergenic
914937418 1:151993409-151993431 GAGTGGGAAAGTAGGAAAGGTGG + Intronic
915044878 1:153003889-153003911 CAATGGGGAAACAAGGAAGGAGG - Intergenic
915046839 1:153024622-153024644 CAATGGGGAAACAAGGAAGGAGG - Intergenic
916186898 1:162142237-162142259 CAGTGGCTCTGTAAGGAAGATGG + Intronic
917598533 1:176553239-176553261 CGGTGGGTAAGGCAGGGAGGGGG + Intronic
918451736 1:184665041-184665063 GAGTGGGTCAATAAGGAACGTGG - Intergenic
919344853 1:196362279-196362301 CAGGAGGAAAGCAAGGAAGGAGG - Intronic
919751034 1:201038381-201038403 CACTGGGTCAGAAGGGAAGGAGG + Intergenic
920891794 1:209993763-209993785 CAGTGGGGAAGTCAGGGATGGGG - Intronic
921707862 1:218345158-218345180 CTGTGGGTAAGGGAGGAAGGAGG - Intergenic
923064701 1:230507185-230507207 AAGTGGGGAAGTAAGGAGGGTGG + Intergenic
923265600 1:232310844-232310866 CAGTGGGTAGATAAGGAGGTGGG + Intergenic
923274217 1:232382926-232382948 CAGTGGGTGTGTGAGGAGGGAGG + Intergenic
923731113 1:236551169-236551191 CTGTGGGCAAGGAATGAAGGCGG - Exonic
924716094 1:246575600-246575622 TAGTGGGTATGTAGGGCAGGGGG + Intronic
1063282899 10:4650260-4650282 AAGTGGATATGTAAGAAAGGAGG + Intergenic
1063517308 10:6709600-6709622 CAGAGGGTGAGGAAGGAAGTGGG + Intergenic
1063697979 10:8356353-8356375 AAGGAGGTAAGGAAGGAAGGAGG - Intergenic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1067245607 10:44539691-44539713 CTGTGGGCAACTAAGGGAGGAGG - Intergenic
1067541059 10:47153489-47153511 GATTGGCTAAGTGAGGAAGGTGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067928134 10:50531715-50531737 CAGTGGGCAGGTAGGGAAGGTGG - Intronic
1068030247 10:51697883-51697905 CAGGGGGCAAGCAAGCAAGGTGG - Exonic
1068434215 10:56970037-56970059 ATGTGGGTAAGTAAAGAAAGAGG - Intergenic
1068847146 10:61690276-61690298 GAGTGGGTAAGTTAGGAATAAGG - Intronic
1068941279 10:62683614-62683636 GACTGGGGAAGGAAGGAAGGTGG - Intergenic
1070734581 10:78854785-78854807 GAATGGGGAAGGAAGGAAGGAGG - Intergenic
1071822102 10:89289389-89289411 TAGTGTGTAAGGAAGGGAGGGGG - Intronic
1072019629 10:91385296-91385318 GAGTGGGTGAGTAAGGAAGAGGG - Intergenic
1074325938 10:112450833-112450855 CTGTGGGAAAGTAAGGAAAAGGG + Intronic
1074814118 10:117132024-117132046 CAGTGGGAAATTAAGGAGGAGGG + Intronic
1074928118 10:118094269-118094291 CACTAGGTAGCTAAGGAAGGGGG - Intergenic
1076915906 10:133423132-133423154 CCGTGGGCAAGGGAGGAAGGGGG + Exonic
1076936048 10:133567999-133568021 CTGTGGGCAAGGGAGGAAGGGGG + Intronic
1077056510 11:596639-596661 CCGTCTGTAAGTCAGGAAGGGGG - Intronic
1077948184 11:6925853-6925875 CATTGGTTGAGTCAGGAAGGCGG - Intergenic
1078612873 11:12837197-12837219 AAGTGGGCAAGAAAGGAAGAGGG - Intronic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1080849098 11:36052473-36052495 CAGTGGGTATCTCTGGAAGGTGG + Intronic
1083327323 11:61879417-61879439 CAGTAGGAAAGCAAAGAAGGTGG + Exonic
1083757343 11:64798777-64798799 GAGTGGGTAAGTGAGGTATGGGG - Exonic
1083927347 11:65816140-65816162 CAGTGGGTCAGTAAGAGATGAGG - Intergenic
1084204046 11:67580992-67581014 GAGAGGCTAAGTAAGGCAGGAGG + Intergenic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085175781 11:74487081-74487103 CAGTGGGTAGGCAAAGCAGGAGG - Intergenic
1085583823 11:77681414-77681436 AAAGGGGAAAGTAAGGAAGGAGG - Intronic
1085596466 11:77814910-77814932 CAGTGTGTTAGGAAGAAAGGAGG - Intronic
1085778094 11:79383998-79384020 CCATGGGGAAGAAAGGAAGGGGG - Intronic
1086130044 11:83392033-83392055 CATTGGGTTAGTAAGGCAGTGGG - Intergenic
1086595810 11:88569300-88569322 CACTGAGTAAGTAGGAAAGGAGG + Intronic
1087264165 11:96042660-96042682 CATTAGGTAAATAAGGAAGATGG - Intronic
1088129620 11:106471903-106471925 CAGTTTGCAAGTAAGGGAGGGGG - Intergenic
1089498173 11:118918222-118918244 TTGTTGCTAAGTAAGGAAGGGGG + Intronic
1090175442 11:124644919-124644941 CAGTTGGTCTGTAAGGAAAGAGG - Intronic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1092037766 12:5353799-5353821 CAGAGAGGAAGGAAGGAAGGAGG + Intergenic
1092188181 12:6497112-6497134 CATTTGGTAAGCAAGGAAGAAGG + Intronic
1092960563 12:13593032-13593054 TAGTGGTTCAGTAAAGAAGGAGG - Intronic
1093945229 12:25100201-25100223 AAGTTGGAAAGGAAGGAAGGAGG + Intronic
1094183882 12:27620328-27620350 CAGAGGGTTAGTAGGGAATGTGG - Intronic
1095522948 12:43089073-43089095 CTTTGAGTAAGTAGGGAAGGTGG + Intergenic
1096071886 12:48780066-48780088 CAGTGGGGGAGAAGGGAAGGGGG + Intronic
1096297678 12:50397641-50397663 CAGTGGGGAAGGAAGGAACCAGG - Intronic
1097612435 12:61840781-61840803 CAGTGGGAAAGTGAGGATGGTGG + Intronic
1101279440 12:103237396-103237418 CAGTGGGTAAGTGACAAAGCTGG - Intergenic
1101351282 12:103931412-103931434 CAGTTGGTAACTAAGGGAGGTGG - Intronic
1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG + Intergenic
1103227597 12:119301592-119301614 CAGCGGGTAAGTGATGAAGCCGG - Intergenic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1104903722 12:132202723-132202745 CAGTGGCCAGGGAAGGAAGGGGG + Intronic
1105959035 13:25312077-25312099 CATTGGGGAAGTAAGGAGGTAGG + Intronic
1107829748 13:44363989-44364011 GTGTGTGTATGTAAGGAAGGGGG - Intergenic
1109214606 13:59574315-59574337 AAGAGAGTAAGAAAGGAAGGAGG + Intergenic
1109282494 13:60372870-60372892 CAGTGGCTTAGGAAGGAAAGAGG + Intergenic
1109423337 13:62142296-62142318 TACTGGGTAAGTCAGGATGGTGG - Intergenic
1110943049 13:81375893-81375915 CACTGAGTAAGCAAGCAAGGTGG + Intergenic
1111855730 13:93634700-93634722 CAGTAGGAAAGGAAGGAAGAAGG + Intronic
1113081184 13:106522160-106522182 CAGTGGGCAAGTGAGAAGGGGGG + Intronic
1113445907 13:110366640-110366662 CAGTGGGTACCCCAGGAAGGAGG + Intronic
1114490697 14:23099960-23099982 CAGTGCTTAAGAAAGGAAGGGGG + Exonic
1117545444 14:56791212-56791234 CAGTGGAGAATTAAGGAAAGGGG - Intergenic
1118046272 14:61974777-61974799 CACTGAGTAAGTAAGGAAACAGG + Intergenic
1119193130 14:72697820-72697842 GAGTGAGTAAGAAAGCAAGGAGG + Intronic
1119406879 14:74404595-74404617 CAGTTGGGGAGTAGGGAAGGAGG + Intergenic
1120033449 14:79668689-79668711 CTGTTGGTGTGTAAGGAAGGGGG + Intronic
1120204074 14:81568753-81568775 GAGTGGGAAAGAAAGGAAGGAGG + Intergenic
1120347791 14:83312432-83312454 CAGTGGTTCAGTAAAGAAGATGG + Intergenic
1121643479 14:95501788-95501810 CAGCGGGGAAGAAATGAAGGTGG + Intergenic
1122838838 14:104444705-104444727 GAGTGGGTAAGTAAGCGAGTGGG - Intergenic
1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG + Intergenic
1123757257 15:23406644-23406666 CAGCAGGCAAGGAAGGAAGGAGG - Intergenic
1124018357 15:25897767-25897789 CAGTAAGTAAGTAATGGAGGTGG + Intergenic
1126378294 15:48018898-48018920 CAGGCAGTAAGGAAGGAAGGTGG - Intergenic
1127809384 15:62550129-62550151 GAGTGGTTAAGGAAGGATGGAGG + Intronic
1127921305 15:63496441-63496463 CGGTGAGAAAGTAAGGAAAGGGG - Intergenic
1128389571 15:67173991-67174013 CAGTTGGAAAGTCAGGAAAGCGG + Intronic
1129566036 15:76624848-76624870 CAATGGGCTAGTGAGGAAGGTGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130661974 15:85837916-85837938 CAGTGGGGAGGTGGGGAAGGTGG - Intergenic
1130899715 15:88198244-88198266 CAGTGGGTAAGGATGGGAAGGGG - Intronic
1130975745 15:88772820-88772842 CAGGGAATGAGTAAGGAAGGGGG + Intergenic
1131032722 15:89199943-89199965 CAGAGGGGAAGGAAGGAAGCAGG - Exonic
1131171155 15:90179206-90179228 AAGTGGGTAAGAAGGGAATGGGG + Intronic
1131336431 15:91553617-91553639 CAGTGGGTGATTAGGAAAGGTGG + Intergenic
1131499686 15:92950007-92950029 CAGTGGAAAACAAAGGAAGGGGG + Intronic
1132136388 15:99344308-99344330 CAGTTAGTAAGTGAGGAAGCAGG + Intronic
1132306506 15:100818510-100818532 CAGGGGTTAAGTGTGGAAGGAGG + Intergenic
1132933993 16:2471934-2471956 CCCTGGGGAAGTAAGGAGGGCGG - Exonic
1133663059 16:7937530-7937552 CAGTAAGTAAGGAAGGAAGTGGG - Intergenic
1133691274 16:8217839-8217861 CTTTAGGTAAGTAGGGAAGGTGG + Intergenic
1134344710 16:13379095-13379117 AAGTGGGAGAGTAAGGATGGAGG - Intergenic
1134634467 16:15781706-15781728 CAGAGAGTAAGTGAGGCAGGGGG - Intronic
1135293580 16:21260764-21260786 AAGTGGGAGAGTAGGGAAGGAGG + Intronic
1135701594 16:24637541-24637563 TGGAGGGAAAGTAAGGAAGGAGG + Intergenic
1136008557 16:27347669-27347691 CAATGGGAATGTGAGGAAGGTGG - Intronic
1136232401 16:28894394-28894416 CAGAGGGTAAGGAAGGACAGTGG - Intronic
1136568560 16:31083810-31083832 CTGTGGGGAAGGAAGGAGGGTGG + Exonic
1137062614 16:35805371-35805393 AGCTGGGTAAGTAAGGAAGAAGG - Intergenic
1137782634 16:51110647-51110669 CAAGGGGTCAGAAAGGAAGGAGG - Intergenic
1138415935 16:56871294-56871316 CAGAGGGAAAGCAAAGAAGGGGG + Intronic
1139472676 16:67186694-67186716 CAGTGGGGAGGAGAGGAAGGAGG - Intronic
1139910213 16:70393046-70393068 CAGGGGCCAGGTAAGGAAGGGGG - Intronic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1141632892 16:85298347-85298369 CAGCGGGTGACTCAGGAAGGTGG - Intergenic
1142419023 16:89958988-89959010 CAGAGGGTGAGTCAGGGAGGGGG - Intronic
1142740200 17:1927410-1927432 GAGTGAGTGAGGAAGGAAGGAGG + Intergenic
1142880423 17:2879060-2879082 CAGTGGGTAGGGCAGGAAGGAGG - Intronic
1143624944 17:8104296-8104318 CAGGGGGAAAGTGAGGAAGTAGG + Intronic
1144063642 17:11605063-11605085 CAGTGTGGAAGCAAGGAAAGCGG - Intronic
1144486397 17:15668565-15668587 CAGAGGCTAAGGAAGGAACGAGG - Intronic
1144914623 17:18713727-18713749 CAGAGGCTAAGGAAGGAACGAGG + Intronic
1147170232 17:38614214-38614236 ATGTGTGTAAGGAAGGAAGGGGG - Intergenic
1148756705 17:49976763-49976785 AATTGGGTCAGTAAGGGAGGGGG + Intergenic
1149264425 17:54912035-54912057 AAATGGGTAAGTTATGAAGGGGG - Intronic
1150033544 17:61767903-61767925 CAGTGGGTATTAAAGAAAGGTGG - Intronic
1150714181 17:67557393-67557415 CAGTGGGCAAGTGATGGAGGTGG + Intronic
1151153617 17:72109055-72109077 GAGTGGGTTAGAAAGGAAGAGGG - Intergenic
1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG + Intergenic
1152803769 17:82344856-82344878 CAATGGGGAAGTGGGGAAGGGGG + Intergenic
1153090998 18:1342674-1342696 AAGAGGGAAAATAAGGAAGGAGG - Intergenic
1153778877 18:8477097-8477119 CAGTGGGTAAGTGTGGGAGAAGG - Intergenic
1153945357 18:10012861-10012883 CAATGGGCAAGAAAGAAAGGAGG - Intergenic
1153951807 18:10064148-10064170 CAGTGGGTAGGTGAGGAGGAAGG - Intergenic
1156948522 18:42864930-42864952 CATTTAGTAAGTAAGGCAGGTGG - Intronic
1157558915 18:48632541-48632563 CAGGGGGGAAGTGGGGAAGGAGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159972297 18:74669370-74669392 CACTGAGGAAGAAAGGAAGGAGG - Intronic
1160433950 18:78831967-78831989 CAGTGGCTGAGAAGGGAAGGAGG - Intergenic
1162265975 19:9574659-9574681 CAGAGGAGAAGAAAGGAAGGAGG + Intronic
1163093267 19:15036063-15036085 CAGGAGGGAAGAAAGGAAGGAGG + Intergenic
1165389185 19:35528561-35528583 CAGTGGGTGAGGAATGAAAGAGG - Intergenic
1166920710 19:46227210-46227232 GAGTGGGCATGTTAGGAAGGGGG + Intergenic
925222879 2:2156670-2156692 CAGAGGTGAAGGAAGGAAGGAGG + Intronic
925686528 2:6479237-6479259 CAGTGGAAAAGAAAGCAAGGGGG + Intergenic
927240240 2:20914638-20914660 CAGTGGGTGACAAAGGAATGTGG - Intergenic
927896160 2:26783808-26783830 CAGTGAGTAAGGGAGGAATGGGG - Intronic
927937589 2:27084346-27084368 CAATGGGTAAGGAAGGTGGGTGG - Intronic
930064025 2:47313879-47313901 CAGTGGGAGAGTAAGAAGGGTGG - Intergenic
930806073 2:55492058-55492080 CTGTGAGGAAGTAAGGAAGGTGG + Intergenic
931596769 2:63954548-63954570 CAGTGAATAAGTAAAGAAAGTGG + Intronic
933715399 2:85355991-85356013 CTTTGGGTGACTAAGGAAGGAGG - Intronic
933876851 2:86628483-86628505 CAGTGGCTTAGTAAGAAAGTGGG + Intronic
934609337 2:95722994-95723016 CAGTAGGTTAGTGAGGATGGTGG + Intergenic
935571178 2:104661253-104661275 TGGTGGGTAGGTAGGGAAGGGGG + Intergenic
936314934 2:111416238-111416260 CAGGGGGAAAAAAAGGAAGGAGG + Intergenic
936534096 2:113298090-113298112 CTGTGGGAAAGGAAGGAATGGGG - Intergenic
936937357 2:117851207-117851229 CAGTGGGTGAGGAAGAAAGATGG + Intergenic
937724288 2:125143126-125143148 CAGTGGGGTAGAAAGGATGGAGG + Intergenic
937821599 2:126316681-126316703 TTGTGGGGAAGGAAGGAAGGAGG - Intergenic
937891272 2:126940717-126940739 CAGTGGGAAAGTAATGAAGGCGG - Intergenic
937899754 2:127010908-127010930 CAGTGGGCAAGTGAGGGAGTTGG + Intergenic
937971178 2:127550605-127550627 CAGAGGGAAAGTCAGGAAAGTGG + Intronic
938174034 2:129107899-129107921 AAGGGGCTAAGTAAGGGAGGTGG - Intergenic
938657095 2:133445711-133445733 CACAGGGAGAGTAAGGAAGGGGG + Intronic
938707029 2:133940742-133940764 CTGAGGGTAAGTGAAGAAGGTGG + Intergenic
939200268 2:139024961-139024983 CACAGAGTAAGTAATGAAGGTGG - Intergenic
939354314 2:141081447-141081469 AAGTGCGTAAGAGAGGAAGGAGG - Intronic
939505152 2:143036425-143036447 TAGAGGGTAACAAAGGAAGGAGG + Intronic
940990512 2:160091887-160091909 CAGTGGGAAAATAAGGAGGAAGG - Intergenic
941800483 2:169653769-169653791 GAGTAGGTAAGAAATGAAGGTGG - Intronic
942386585 2:175449725-175449747 CAGTAGGAAAGTAAGGAAACAGG + Intergenic
943548083 2:189306235-189306257 CAGTGGGTGATTAAGGACGATGG - Intergenic
943683424 2:190791812-190791834 CAGTGGGAAAGGAAGGACGGGGG - Intergenic
944541945 2:200762521-200762543 GTTTGCGTAAGTAAGGAAGGAGG - Intergenic
945507164 2:210656154-210656176 CACTGGGAAAGAAAAGAAGGTGG - Intronic
945752402 2:213804358-213804380 CAAGGGGTAAGTAAGGAAGGAGG + Intronic
947029912 2:225782506-225782528 CAGAGGGAAAAAAAGGAAGGAGG - Intergenic
947030189 2:225783446-225783468 GAGTGAGAAAGGAAGGAAGGGGG - Intergenic
947502842 2:230683808-230683830 GAGTGGGTAAGAAAGGAGGAGGG + Intergenic
947898278 2:233695567-233695589 GAAAGGGTAAGTAGGGAAGGGGG - Intronic
948831488 2:240600533-240600555 CTGTGGGTGAGTCAGGAGGGTGG - Intronic
1168807273 20:679344-679366 CTGTGGGTAAATAAGGCAAGTGG + Intergenic
1168831185 20:846059-846081 CAGAGGCCAAGGAAGGAAGGAGG - Exonic
1168949368 20:1786158-1786180 AGGTGGGTAAGGAAGGAAGCAGG + Intergenic
1170807687 20:19647252-19647274 GAGTGGGGAAGTGAGGCAGGCGG - Intronic
1173603072 20:44309935-44309957 GGGTGGGTGAGGAAGGAAGGTGG + Intronic
1173644624 20:44625787-44625809 CAGTGGGTCAGTGGGGGAGGAGG - Intronic
1174123498 20:48285631-48285653 CAGTGGGAGAGGAAGCAAGGCGG + Intergenic
1174389632 20:50210195-50210217 CTGTGGGAGAGTAAGGCAGGAGG - Intergenic
1174391794 20:50222296-50222318 GAGTGAGCAAGTAAGAAAGGAGG - Intergenic
1175379506 20:58553097-58553119 GAGTGTGGAAGTAAGGAAGAAGG - Intergenic
1176003138 20:62843143-62843165 CGGTGAGGAAGAAAGGAAGGGGG + Intronic
1176954921 21:15091193-15091215 CAGGGGGGAAGGTAGGAAGGTGG + Intergenic
1177277131 21:18926892-18926914 CACTGAGAAAGCAAGGAAGGAGG - Intergenic
1177501646 21:21964408-21964430 AAGAGGGTATGTAAGGAAAGGGG + Intergenic
1177864206 21:26493418-26493440 CAGTGGGACAGGAAAGAAGGTGG + Intronic
1178914818 21:36700238-36700260 CACTGGCGAAGGAAGGAAGGAGG - Intronic
1179175716 21:39006445-39006467 CAGTGGGTCAGAAAGGCAAGTGG + Intergenic
1181736085 22:24882664-24882686 CAGAGGGTAGGAAGGGAAGGAGG - Intronic
1181977570 22:26741836-26741858 CAGAGGCTAAGTCAGGAAAGAGG - Intergenic
1182110453 22:27719411-27719433 CAGTGGGAGAGAAAGGAGGGAGG - Intergenic
1182819874 22:33206440-33206462 CTGTAGGTAAGTAAGGCAGGAGG - Intronic
1183569188 22:38639489-38639511 CATTGGGCAAGGAAGGAGGGAGG - Intronic
1183773285 22:39945448-39945470 ATTTGGGTAAATAAGGAAGGTGG - Intronic
1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG + Intergenic
1185285363 22:49997529-49997551 CACTGGGGAAGGAAGGGAGGCGG - Intronic
951709318 3:25573175-25573197 GAGTGGGCAGGGAAGGAAGGCGG - Intronic
953070667 3:39516296-39516318 CAGTGGGTGTGTGAAGAAGGAGG + Intronic
953796663 3:45991456-45991478 CAGAGGGGAAGAAGGGAAGGAGG - Intronic
954643842 3:52118610-52118632 TAGTGGGTAAGTAAAGTAAGGGG + Intronic
958513929 3:95088135-95088157 CTGAGGGTGAGAAAGGAAGGAGG - Intergenic
959820162 3:110724607-110724629 CAGCGAGCAAGTAAGGAAGAGGG - Intergenic
960028503 3:113034653-113034675 CAGTGGTTAAGTATGTATGGGGG + Intergenic
960897788 3:122523555-122523577 GAGTGAGAAAGGAAGGAAGGAGG - Intergenic
961309645 3:125987804-125987826 GAGTTGGAAAGTAAGGCAGGGGG - Intergenic
961851609 3:129825164-129825186 CAGTGGGGAAGAAATGAAGCGGG - Intronic
962847585 3:139285627-139285649 CAACGGGTAAGTGAGGAAGCTGG - Intronic
963087408 3:141451017-141451039 CAGTGGGCAAGCAAAGAAGGGGG + Intergenic
963667156 3:148202611-148202633 CAGAGGGCAAATGAGGAAGGGGG - Intergenic
965852647 3:173048648-173048670 GAATAGGTAAGTAAGGGAGGTGG - Intronic
966071171 3:175880315-175880337 AAGAGGGTAAGTGAAGAAGGGGG + Intergenic
966902029 3:184493491-184493513 CACAGGGTAGGAAAGGAAGGAGG + Intronic
967449096 3:189602441-189602463 CAGAGGCTAAGAAAGGAGGGAGG + Intergenic
968485878 4:861345-861367 CAGTGGGCAGCTGAGGAAGGAGG + Intronic
968858286 4:3145878-3145900 CAGTCTGTATGTGAGGAAGGTGG - Intronic
969346444 4:6573602-6573624 CAGTGGGTGAGTAAGAGAGCAGG + Intergenic
969480832 4:7446057-7446079 CAGGGAGGAAGGAAGGAAGGGGG - Intronic
970050780 4:11912627-11912649 CAGAGGGTCAGTAGGGAAAGTGG + Intergenic
973639773 4:52891352-52891374 CAGTGGGTAAGTAAGGAAGGTGG + Intronic
975988554 4:80231530-80231552 CAGTGGGAAAATAAGGCAGAGGG - Intergenic
976660151 4:87532467-87532489 CATTGGGTAATCAAGGAAGAGGG - Intergenic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
978855903 4:113394430-113394452 AAGGGGGGAAGGAAGGAAGGAGG - Intergenic
979305244 4:119134956-119134978 TAGAGGGAAAGTATGGAAGGGGG + Intergenic
979435272 4:120680794-120680816 CAGTGGGGAAGGCTGGAAGGAGG + Intergenic
979772513 4:124546152-124546174 CAGTGGGTAAAGAAGCAAGAGGG + Intergenic
980105397 4:128583417-128583439 CAGTGGGGTAGTGAGGAATGAGG + Intergenic
980384131 4:132063759-132063781 CAGTGAGGAGGTAAGGAGGGAGG - Intergenic
980521559 4:133942917-133942939 GAGGGGGAAAGGAAGGAAGGAGG - Intergenic
980807145 4:137828324-137828346 AAGTGGGGAAGGAGGGAAGGAGG + Intergenic
982778513 4:159466291-159466313 AAGGGGGAAAGGAAGGAAGGTGG - Intergenic
983539332 4:168891608-168891630 AAGTGGGAAAGAAAGGAAGAAGG + Intronic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
984244861 4:177263107-177263129 GAGTAGGTCAGCAAGGAAGGTGG + Intergenic
985273381 4:188216106-188216128 AAGGGGGGAAGGAAGGAAGGAGG - Intergenic
985273548 4:188216612-188216634 AAGGGGGTAAGGAAGGAAGGAGG - Intergenic
986854040 5:11848549-11848571 CATTGTGTAAATAAGGTAGGGGG - Intronic
987050333 5:14143323-14143345 CAATGGGGAAGGAAGGAGGGGGG - Intergenic
987382996 5:17303279-17303301 CACTGGGTGAGAAAGAAAGGAGG - Intergenic
987566376 5:19593555-19593577 AAGTGGGAAAGAAAGGGAGGAGG - Intronic
987671348 5:21014018-21014040 GAGTTTGTGAGTAAGGAAGGGGG - Intergenic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
988152120 5:27397403-27397425 TAGTTAGTAAGTAAGTAAGGTGG - Intergenic
988729795 5:33960603-33960625 CAGGGGGTAAGTGTGGAAAGGGG + Intronic
989707449 5:44353675-44353697 TAGCTGGTAAGTAAGGAAAGTGG + Intronic
990174439 5:53091524-53091546 GAGTGGTTCAGTAAGGGAGGAGG - Exonic
991254719 5:64601446-64601468 CAGTGGAGAAGAAAGGAAGGTGG + Intronic
993802048 5:92354055-92354077 CAATCTGTAAGTCAGGAAGGAGG + Intergenic
994013878 5:94942189-94942211 CACTGGGTAAGTGAGGAAGATGG + Intronic
994303400 5:98173809-98173831 GAGTGTGTGAGGAAGGAAGGAGG - Intergenic
995750695 5:115450630-115450652 CAGAGGGGAAGAAAGGCAGGAGG - Intergenic
997083346 5:130766598-130766620 CAGTGAGAAAGTAAGGTAAGAGG - Intergenic
997093802 5:130887706-130887728 CTGTGGTTAATTAAGAAAGGCGG - Intergenic
998531628 5:142890426-142890448 CAGTGGGTTAGGATGGGAGGAGG + Intronic
998668408 5:144325473-144325495 GAGAGGGCAAGTGAGGAAGGAGG - Intronic
999285128 5:150390070-150390092 ATGTGGGTAAGTATGGAAGTAGG - Intronic
1000166797 5:158657548-158657570 CAGAGTGTGAGTGAGGAAGGTGG - Intergenic
1000593608 5:163188325-163188347 CAGTTTGTAAGTGAAGAAGGAGG - Intergenic
1002825642 6:771079-771101 CAGAGAGAAAGGAAGGAAGGAGG - Intergenic
1004044930 6:12013480-12013502 CAGTGGGTAGGCAATGAACGGGG + Intronic
1007134460 6:39507901-39507923 AAGAGGGAAAGGAAGGAAGGAGG - Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007986762 6:46215115-46215137 CAGTGGGTAAGAATGGACTGTGG + Intergenic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1010346001 6:74811345-74811367 GAGGGGGGAAGGAAGGAAGGGGG + Intergenic
1010935350 6:81853910-81853932 CAGTGTGTAAATATGGAATGGGG + Intergenic
1011677760 6:89751933-89751955 CAGTGTTGTAGTAAGGAAGGAGG + Intronic
1011855722 6:91688404-91688426 CAGAGAGGAAGGAAGGAAGGAGG - Intergenic
1012140893 6:95625305-95625327 CAGTGGTTAAGAAAGGCAGGAGG - Intergenic
1012966073 6:105674974-105674996 CAGTGGGGAAGTGTAGAAGGGGG + Intergenic
1013542916 6:111129251-111129273 AAGTGGGCAAAGAAGGAAGGGGG + Intronic
1015454859 6:133415140-133415162 GTGTGGGTAAGTGAGAAAGGAGG - Intronic
1016402353 6:143694162-143694184 GAGTGGGGAGGGAAGGAAGGAGG + Intronic
1016944457 6:149515705-149515727 TAGTGGGTAAGTGAGGAAGCAGG - Intronic
1017591644 6:155984571-155984593 AAGTGGGACAGTTAGGAAGGAGG - Intergenic
1018261266 6:161973211-161973233 TATTGGGAAAGTAAGGAGGGGGG + Intronic
1019278314 7:187641-187663 CAATGGGCCAGGAAGGAAGGAGG - Intergenic
1019486739 7:1292894-1292916 CCCAGGGGAAGTAAGGAAGGAGG - Intergenic
1019825623 7:3281934-3281956 CAGTGGGGAAGTGAGGTTGGTGG - Intergenic
1022546043 7:31190133-31190155 CCATGGGTAAGTAAGGAATCAGG - Intergenic
1023808411 7:43891668-43891690 CAGTGGGCAAGTCAGAAAGAAGG - Intronic
1023820463 7:43977714-43977736 GAGAGGGGAAGGAAGGAAGGAGG - Intergenic
1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG + Intronic
1027571512 7:79874009-79874031 CAGTGGGTAAGAAAATAATGTGG - Intergenic
1029257105 7:99277150-99277172 CAGTAGGGAAGGAAGGAGGGAGG + Intergenic
1029748739 7:102531193-102531215 GAGAGGGGAAGGAAGGAAGGAGG - Intergenic
1029766686 7:102630277-102630299 GAGAGGGGAAGGAAGGAAGGAGG - Intronic
1029888927 7:103905910-103905932 GAGGAGGTAAGTATGGAAGGGGG + Intronic
1030634837 7:111937018-111937040 CAGTGGGGAAGAAAGAAAGATGG + Intronic
1031524707 7:122810244-122810266 AAGTGGGAAGGTAAGTAAGGAGG + Intronic
1035084831 7:156249176-156249198 CCATGAGTAAGGAAGGAAGGAGG + Intergenic
1035413836 7:158667516-158667538 CACAGGGTAGGTAAGGAGGGCGG - Intronic
1035413866 7:158667602-158667624 CACAGGGTAGGTAAGGAGGGCGG - Intronic
1035413904 7:158667716-158667738 CACAGGGTAGGTAAGGAGGGCGG - Intronic
1035413977 7:158667921-158667943 CAGAGGGTAGGTAAGGAGGGCGG - Intronic
1035414046 7:158668123-158668145 CAGAGGGTAGGTAAGGAGGGCGG - Intronic
1035823234 8:2617225-2617247 GAGTGTGTAAGTAAGAAAGGAGG - Intergenic
1035893563 8:3372455-3372477 CAGTGGTGAAGGGAGGAAGGTGG + Intronic
1035956487 8:4085907-4085929 CATTGCGTAAGGATGGAAGGGGG + Intronic
1036394937 8:8361450-8361472 CAGTGGGTTATTAAGAAATGGGG + Intronic
1036978991 8:13447483-13447505 CAGCTAGTAAGTAAGGAAGATGG + Intronic
1038519474 8:28217767-28217789 CAGAGGGTAAGTCAGGAAAGAGG - Intergenic
1038522049 8:28242305-28242327 CATTGGGAAACTAAGGCAGGAGG + Intergenic
1039226118 8:35390123-35390145 CAGAGGAGAAGCAAGGAAGGAGG + Intronic
1039485356 8:37905481-37905503 CAGTGGGAAGGGAAGGAAAGGGG - Intergenic
1042529887 8:69803972-69803994 CAGTGGTGAGGTGAGGAAGGGGG - Intronic
1045421475 8:102020932-102020954 GAGTGGGGAAGGAAGAAAGGTGG - Intronic
1047076307 8:121407986-121408008 CAGCAGGTAAGTAATGGAGGTGG - Intergenic
1047981958 8:130192578-130192600 TGGTGGGTAAGTAAGGTTGGGGG + Intronic
1050527668 9:6560139-6560161 CAGTGGGAAAGTAAGTCAGAAGG + Intronic
1051093937 9:13443487-13443509 CAGAGGCAAAGTAAAGAAGGGGG - Intergenic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1055497092 9:76866740-76866762 AAGTGGGTAAGAAAGGAGGAAGG + Intronic
1058155920 9:101514699-101514721 CAGAGTGTAAGAAAAGAAGGAGG + Intronic
1058667028 9:107328669-107328691 CAGTGGGTGAGCAAGGAACTGGG - Intronic
1059362292 9:113754324-113754346 GAGTGGGTAAGCAAGGGTGGGGG - Intergenic
1060990322 9:127845271-127845293 CTGTGGGAAGGTGAGGAAGGAGG - Intronic
1061567070 9:131447949-131447971 CAGGGAGTAAATGAGGAAGGAGG - Intronic
1061789678 9:133052386-133052408 CAGGGGGGAAGGAAGGATGGGGG - Intronic
1186130724 X:6462600-6462622 CAGTTGGGCAGTGAGGAAGGCGG - Intergenic
1186632636 X:11366588-11366610 ACGTGGGTAAGTGAGGGAGGTGG + Intronic
1186672348 X:11780550-11780572 CAGAGGGGAAGGAAGGAAGGAGG - Intergenic
1187250547 X:17594300-17594322 CAGTGTAGAAGTGAGGAAGGGGG + Intronic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1189365574 X:40385367-40385389 CAGTGGGTAAGAGAAGAAGCTGG + Intergenic
1189900363 X:45700173-45700195 CAGTGGATAAGGAAAGAGGGTGG + Intergenic
1190797105 X:53756019-53756041 GAGTGGGAAAATGAGGAAGGAGG + Intergenic
1191088905 X:56599020-56599042 CAGTGGGTACATACGCAAGGGGG - Intergenic
1193456699 X:81740134-81740156 CTGGGGGAAAGGAAGGAAGGAGG - Intergenic
1193533128 X:82680400-82680422 GAATGGGAAAGAAAGGAAGGAGG - Intergenic
1194000068 X:88417262-88417284 CAGAAGGAAAGAAAGGAAGGAGG + Intergenic
1194386516 X:93262285-93262307 CAGTGGCTAAGTAAGAACTGAGG + Intergenic
1195455606 X:105065914-105065936 GAGTTGGGAAGTAAGGAATGGGG - Intronic
1195814789 X:108873108-108873130 CAGGGGGTACTTAAGGAAAGTGG - Intergenic
1196908885 X:120466629-120466651 CAGTGGATAAGAAAGTAAAGGGG - Intronic
1196978951 X:121190653-121190675 CAGTGGGCAAGGAGTGAAGGTGG - Intergenic
1201524699 Y:14919411-14919433 AAGGGGGGAAGGAAGGAAGGAGG + Intergenic
1201550361 Y:15211713-15211735 GAGAGGGGAAGGAAGGAAGGAGG + Intergenic