ID: 973641283

View in Genome Browser
Species Human (GRCh38)
Location 4:52905359-52905381
Sequence GGAGGGTTCAGCCACGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 1, 2: 2, 3: 25, 4: 199}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973641274_973641283 28 Left 973641274 4:52905308-52905330 CCCCAACACATACGCCAGAGGTA 0: 1
1: 0
2: 0
3: 3
4: 81
Right 973641283 4:52905359-52905381 GGAGGGTTCAGCCACGGAGAAGG 0: 1
1: 1
2: 2
3: 25
4: 199
973641275_973641283 27 Left 973641275 4:52905309-52905331 CCCAACACATACGCCAGAGGTAA 0: 1
1: 0
2: 0
3: 3
4: 82
Right 973641283 4:52905359-52905381 GGAGGGTTCAGCCACGGAGAAGG 0: 1
1: 1
2: 2
3: 25
4: 199
973641276_973641283 26 Left 973641276 4:52905310-52905332 CCAACACATACGCCAGAGGTAAC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 973641283 4:52905359-52905381 GGAGGGTTCAGCCACGGAGAAGG 0: 1
1: 1
2: 2
3: 25
4: 199
973641277_973641283 14 Left 973641277 4:52905322-52905344 CCAGAGGTAACTCTTTGCTCTAC 0: 1
1: 0
2: 1
3: 4
4: 101
Right 973641283 4:52905359-52905381 GGAGGGTTCAGCCACGGAGAAGG 0: 1
1: 1
2: 2
3: 25
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973641283 Original CRISPR GGAGGGTTCAGCCACGGAGA AGG Intronic
900421704 1:2558595-2558617 GCAGGGTGCATCCATGGAGATGG - Intronic
900519363 1:3098246-3098268 GCAGGGTGCAGCCCGGGAGAAGG - Intronic
902817675 1:18925533-18925555 GGAGGTCTCAGGCACAGAGATGG + Intronic
903750862 1:25619484-25619506 GGATGGTTCAGACAAGGAGAAGG - Intronic
904296805 1:29524609-29524631 TGAGGGCTCAGGCACGGTGATGG + Intergenic
905933817 1:41807906-41807928 GGAGGCTCCAGCCAAGGAGGAGG + Intronic
914692789 1:150046299-150046321 GGAGGTTTTAGCCAGGGAGATGG - Intergenic
915028891 1:152859127-152859149 GGAGAATTCAGCCAGGGATAAGG + Intergenic
915037837 1:152943564-152943586 GGAGAGGTCAGCCTCTGAGATGG - Intergenic
915506495 1:156360189-156360211 GGAGGGCCCAGCAAAGGAGACGG - Intronic
915590709 1:156868626-156868648 GGAGCAGTCAGCCACGGTGATGG + Exonic
916268667 1:162917917-162917939 GGAATGTTCAGCCAGGGAGTGGG + Intergenic
916769441 1:167893956-167893978 GGAGGGTGCAGGCTCAGAGAGGG + Intronic
917782132 1:178409467-178409489 GGATGATTCAGCCAGGGAGAAGG + Intronic
920043068 1:203116404-203116426 GGTGGGTCCAGCCATGGAGGAGG + Intronic
920814563 1:209319182-209319204 GGAGGGACCAGCCACAGAGGAGG - Intergenic
920915727 1:210256500-210256522 GGGGGGATCAGCCACGGAGAGGG - Intergenic
921397978 1:214689127-214689149 GGAGGGCTCAGCAAGGGAAAGGG - Intergenic
923620572 1:235575909-235575931 GCAGAGTTCAGCCACTGAGAAGG - Intronic
923998186 1:239520496-239520518 GGAGGGTGAAGCCAGAGAGAAGG - Intronic
1065781176 10:29169222-29169244 AGAGGGTTCAGCCACACAAAGGG - Intergenic
1066238020 10:33505923-33505945 GGAGGGTGGAGCCCCAGAGACGG - Intergenic
1066437516 10:35407768-35407790 GAAGGGTAGAGACACGGAGAAGG + Intronic
1067325659 10:45263768-45263790 GTACGGTTCAGCCACAGAGCTGG - Intergenic
1069622510 10:69846492-69846514 GGAAGGTGCATCCAGGGAGAAGG + Intronic
1072104994 10:92265353-92265375 GGAGGCTTCTGCCTGGGAGATGG - Intronic
1073013723 10:100381833-100381855 AGAGGGTAGAGGCACGGAGAAGG - Intergenic
1074350631 10:112733403-112733425 GGTGGGTAAATCCACGGAGACGG - Intronic
1074563769 10:114558037-114558059 GGGTGCTTCAGCCAAGGAGATGG - Intronic
1075664505 10:124221070-124221092 GGAGAGCCCAGCCAAGGAGAGGG + Intergenic
1076898685 10:133326319-133326341 GGAGGGGCCACCCAGGGAGAGGG + Intronic
1077243048 11:1521351-1521373 AGAGGGTACAGCCAAAGAGATGG + Intergenic
1079230367 11:18644213-18644235 GAAGGGTAGAGACACGGAGAGGG - Intergenic
1079929684 11:26542412-26542434 GGAGGATGGAGCCATGGAGAGGG + Intronic
1079950068 11:26790892-26790914 GGAGGGATCAGCAAAGGAGAGGG + Intergenic
1080971117 11:37278548-37278570 GGTGGGCTCAGCCACGGACATGG - Intergenic
1081909987 11:46694513-46694535 GGAGGTGTCACCCACGGAGGTGG + Intronic
1083665485 11:64271856-64271878 GGAGGGTTCAGGCAGGGCCAGGG - Intronic
1084503084 11:69546354-69546376 GGAGGGGTCAGCCAAGGCGGGGG + Intergenic
1084589298 11:70080842-70080864 GGAGGCTGCAGCCATGGAGCAGG + Intronic
1085934108 11:81123022-81123044 GAAGGGTAGAGACACGGAGAAGG - Intergenic
1088172820 11:107017804-107017826 GGAGGGTGCAGCGCCGGAGGCGG - Exonic
1090107750 11:123870112-123870134 GAAGGGTAGAGACACGGAGAAGG + Intergenic
1090241085 11:125182334-125182356 GGGGGATTCAGCCACGTAGAAGG - Intronic
1091947157 12:4557256-4557278 GAAGGGCTCAGGCAAGGAGAGGG - Intronic
1092036345 12:5338495-5338517 GAAGGGTTCAGCCAGGGAAGCGG - Intergenic
1099517479 12:83615325-83615347 GGGTGCTTCAGCCAAGGAGATGG - Intergenic
1104558327 12:129822146-129822168 GGAAGAGTCAGCCATGGAGAGGG + Intronic
1104810358 12:131616837-131616859 GGAGGCTTGAGCCACAGAGGAGG - Intergenic
1106000539 13:25719118-25719140 GGAAGTTTCCGACACGGAGATGG - Intronic
1106459637 13:29957659-29957681 GGAGAGTTCAGCCAGGAAGGGGG + Intergenic
1107312536 13:39094463-39094485 TGAGGGAGCAGCCACAGAGATGG + Intergenic
1113089086 13:106598201-106598223 GCAGGGTTCAGCCAAGGGGAAGG + Intergenic
1113890557 13:113733094-113733116 GGACGCCTCAGCCCCGGAGAGGG + Intronic
1118162961 14:63309446-63309468 GGGGGGTTCAGACAGGGATATGG - Intergenic
1119819461 14:77602079-77602101 GAAGGGTAGAGACACGGAGAAGG - Intronic
1121010466 14:90517335-90517357 GGAGTGTTCAGCCCTGGAGAGGG - Intergenic
1121886318 14:97546297-97546319 GGAGGGGGCAGCCCCGGAAAAGG + Intergenic
1121980732 14:98451660-98451682 GAAGGGTAGAGACACGGAGAAGG + Intergenic
1122044352 14:99012618-99012640 GGAGGGCACAGCCACCGACATGG - Intergenic
1122245584 14:100401209-100401231 AGAGGCTGCAGCCACGGGGAGGG - Intronic
1122862355 14:104588344-104588366 GGTGGGTGCACCCACGGAGGGGG - Intronic
1124399833 15:29338484-29338506 GGAGAGGTCAGCCCCTGAGAGGG + Intronic
1124960026 15:34386985-34387007 GGAGGGCTCAGACACTGAGGGGG - Intronic
1124976655 15:34533206-34533228 GGAGGGCTCAGACACTGAGGGGG - Intronic
1125178064 15:36848282-36848304 GGAGGGTTCAATCAAGGAGAGGG - Intergenic
1125892378 15:43276202-43276224 GGAGGGTTCAGCCACAGAGCTGG + Intergenic
1128243463 15:66117259-66117281 GGAGAGTTCTGGCAGGGAGATGG - Intronic
1129201841 15:74007365-74007387 GGAAGGTTCAGCCAGCAAGAGGG + Intronic
1129266444 15:74395944-74395966 TGAGGGCTCAGCCAAGGAGCAGG - Intergenic
1129391160 15:75221655-75221677 TGAGGGGCCAGCCACGGTGAAGG - Intergenic
1129473151 15:75766224-75766246 TGAGGGGCCAGCCACGGTGAAGG + Intergenic
1130302365 15:82689513-82689535 GGAGGGTCCAGGCACAAAGAAGG + Intronic
1131153788 15:90062638-90062660 GAAGGGTTTAGCCTGGGAGATGG + Intronic
1131908047 15:97165694-97165716 GGAGTTTTCACACACGGAGATGG - Intergenic
1132701634 16:1224656-1224678 GGAGGGGGCTGCCAAGGAGAGGG + Intronic
1133529575 16:6642061-6642083 TGAGGGTGCAGCTACGGAGAGGG + Intronic
1134274343 16:12762255-12762277 AGAGGGTAACGCCACGGAGATGG + Intronic
1135393988 16:22117031-22117053 GGGAGGTTCAGTCAAGGAGAAGG + Intronic
1136913895 16:34163563-34163585 GGAAGGATCCGCCAGGGAGAGGG + Intergenic
1138551819 16:57752673-57752695 GGAGGGCGCAGCAGCGGAGATGG - Intronic
1139056226 16:63188426-63188448 GGAAGTTTCAGGCATGGAGATGG - Intergenic
1141283916 16:82653635-82653657 GGAGGGAGCAGCCAGGGAGGGGG + Intronic
1141898979 16:86977649-86977671 GGAGTGGTCAGCCAGGGATAGGG + Intergenic
1142136456 16:88453880-88453902 GGGGGGTTCAGCCCAGGAGGGGG + Intronic
1142744913 17:1951355-1951377 GGAGGAGTCAGCCAAGGAGAAGG + Intronic
1143551932 17:7635622-7635644 GGAGTCTTCAGCAATGGAGAGGG + Intergenic
1144891061 17:18494618-18494640 GGCGGGCACAGCCAGGGAGAGGG + Exonic
1145141162 17:20449700-20449722 GGCGGGCACAGCCAGGGAGAGGG - Intronic
1145415416 17:22710292-22710314 GGAGGGTGCACCCTGGGAGATGG + Intergenic
1148562405 17:48613555-48613577 GGAGGGGGCAGGGACGGAGAAGG + Intronic
1150457387 17:65317827-65317849 GGCTGGTTGAGCCAGGGAGAAGG - Intergenic
1151357628 17:73569970-73569992 GGAGGCTGCAGCCATGGACACGG + Intronic
1151404564 17:73878122-73878144 GGCGGCTCCAGCCACCGAGATGG - Intergenic
1151782798 17:76258511-76258533 GCAGGGCGCACCCACGGAGATGG + Intergenic
1152453738 17:80400733-80400755 GAAGGGTAGAGACACGGAGAAGG - Intergenic
1156233976 18:35183323-35183345 GGCTGGGTCAGTCACGGAGATGG - Intergenic
1156252086 18:35360828-35360850 GAAGGGTAGAGACACGGAGAAGG + Intergenic
1156471251 18:37378360-37378382 GGAGGGGGCAGGCACAGAGAGGG + Intronic
1157307981 18:46530792-46530814 GGAGTGTCCAGCCACACAGAAGG - Intronic
1157591559 18:48839180-48839202 GGAGGGGTGAGCCAGTGAGAGGG - Intronic
1157597960 18:48875288-48875310 GGAGGGCTCAGGCACCGGGAGGG - Intergenic
1160774539 19:848916-848938 GGAGGCATTAGCCACAGAGAGGG + Intergenic
1161981313 19:7631819-7631841 AGAGGGGTCAGCCAGGGGGAGGG + Exonic
1163124666 19:15238539-15238561 TGAGGGGTCAGCCACGGGGAGGG - Intronic
1163637566 19:18444496-18444518 GGAGGCTGCAGCCAGGGAGGAGG + Exonic
1163737738 19:18991748-18991770 GGAGGGGTCAGGAAAGGAGAAGG + Intronic
1164935087 19:32203621-32203643 GGAAGGATCAGCCCCGTAGAAGG + Intergenic
1165801240 19:38551819-38551841 GGAGGGCTCAGGCACAGTGAAGG - Intronic
1165863483 19:38921682-38921704 GGTGGGCTCAGCCCGGGAGAGGG + Intronic
1167322622 19:48806031-48806053 GGAGGGCACAGCCAGGGGGATGG - Intronic
1168135281 19:54346939-54346961 GGAAGATTCAGACCCGGAGAAGG + Intergenic
925434007 2:3820415-3820437 AGAGGGTAGAGACACGGAGAAGG + Intronic
926345862 2:11944331-11944353 GGGTGTTTCAGCCAAGGAGATGG + Intergenic
926346413 2:11950385-11950407 GGATGCTGCAGCCAAGGAGACGG - Intergenic
926850047 2:17186286-17186308 GGAGGGACTATCCACGGAGAAGG - Intergenic
929684690 2:44023568-44023590 GAAGGGTAGAGACACGGAGAAGG + Intergenic
930487520 2:52026631-52026653 GAAGGGTAGAGACACGGAGAAGG + Intergenic
935124559 2:100212049-100212071 GGAGGCTTGAGCCTGGGAGACGG + Intergenic
939307255 2:140427340-140427362 GAAGGGTAAAGACACGGAGAAGG - Intronic
940446788 2:153786020-153786042 GGAGTGTTCAGCCAGTGAGGTGG - Intergenic
944890332 2:204110606-204110628 GGAGGGCTGAGCAACGGAGAGGG - Intergenic
947689681 2:232123209-232123231 CCAGGGTTCATCCAAGGAGATGG - Intronic
948110148 2:235448465-235448487 AGAGGGTTCAGGCAAAGAGATGG - Intergenic
948757790 2:240169308-240169330 GGAGGGGACAGGCTCGGAGAAGG - Intergenic
1169540648 20:6595893-6595915 CGAGGGTTCAGCCAAGGAACTGG + Intergenic
1171490299 20:25512093-25512115 GCAGGGATCACCCAAGGAGAGGG - Intronic
1172135833 20:32686116-32686138 GTGGGGCTCAGCCACGCAGAGGG + Intergenic
1172765653 20:37349364-37349386 GGAGGGGTCAGCCCGAGAGATGG + Intronic
1175446580 20:59024275-59024297 GGTGAGCTCGGCCACGGAGAGGG - Exonic
1175965087 20:62656408-62656430 CGAGGCTTCAGCCACGCAGTGGG - Exonic
1175982495 20:62746104-62746126 GAAGGGGTCAGCCAGGGGGAAGG + Intronic
1176039276 20:63055905-63055927 GCAGGGCACAGCCATGGAGAGGG - Intergenic
1176075070 20:63244643-63244665 GCAGGGGTCAGGCAGGGAGAGGG + Intronic
1176667382 21:9700020-9700042 GGAGGGTGGGGTCACGGAGATGG - Intergenic
1178001043 21:28162373-28162395 GAAGGGTAGAGACACGGAGAAGG - Intergenic
1178623694 21:34198359-34198381 GGAGGCTCCAGGCACGGGGAGGG + Intergenic
1181960979 22:26621758-26621780 CCAGGGATCAGCCACGAAGAAGG - Intergenic
1183236636 22:36623648-36623670 TGAGGGTTGAGCCACTGAAAGGG + Intronic
1183264886 22:36819031-36819053 GGAGGGCTCAGTCCCGGAGGGGG - Intronic
1184442148 22:44523465-44523487 GGTGGTGCCAGCCACGGAGATGG + Intergenic
950231039 3:11276068-11276090 GGAGGGCTGAGCCACGCTGAGGG - Intronic
951894712 3:27599918-27599940 GAAGGGTAGAGACACGGAGAAGG - Intergenic
952296662 3:32068418-32068440 GAAGGGTAGAGACACGGAGAAGG - Intronic
952343714 3:32465920-32465942 GGAGAGTAGAGACACGGAGAAGG + Intronic
953864929 3:46575926-46575948 GGAGGGCTCCGCAAAGGAGAAGG - Intronic
956599683 3:71007338-71007360 GGAGACTTCAGCCATGTAGAGGG - Intronic
964193251 3:154031108-154031130 GGAGGGCTCATCCATGAAGAGGG - Intergenic
965977281 3:174640976-174640998 GGAGGGTGCAGCCCGGGGGAAGG - Intronic
966398606 3:179525448-179525470 AGAGGGTAGAGACACGGAGAAGG + Intergenic
971482253 4:27125300-27125322 AGAGGGGGCAGCCATGGAGATGG - Intergenic
972059115 4:34846059-34846081 GGAGGTTTCAGCAAGGGAAATGG + Intergenic
973134224 4:46686086-46686108 GGAGTGTTCAGCCACTAAGATGG + Intergenic
973641283 4:52905359-52905381 GGAGGGTTCAGCCACGGAGAAGG + Intronic
977248463 4:94661304-94661326 GGAGGCTTGAGCCAAGGAGGTGG + Intronic
982100745 4:151965324-151965346 GTTGGGTTCAGCCAGTGAGAGGG + Intergenic
985057553 4:186048720-186048742 GAAGGGTAGAGACACGGAGAAGG + Intergenic
985270221 4:188187240-188187262 GGATGCTGCAGCCAAGGAGATGG - Intergenic
985407425 4:189651574-189651596 GGAGGGTGGGGTCACGGAGATGG + Intergenic
985407449 4:189651662-189651684 GGAGGGTGGGGTCACGGAGATGG + Intergenic
985407533 4:189651970-189651992 GGAGGGTGGGGTCACGGAGATGG + Intergenic
985407581 4:189652146-189652168 GGAGGGTGGGGTCACGGAGATGG + Intergenic
985407638 4:189652366-189652388 GGAGGGTGGAGTCATGGAGATGG + Intergenic
985407678 4:189652545-189652567 GGAGGGTGGGGCCATGGAGATGG + Intergenic
985816154 5:2129794-2129816 GGAGGGTGCAGCGAGGGAGAGGG + Intergenic
991715351 5:69446432-69446454 GGATGGTTTAGCCCCGCAGAAGG + Intergenic
993421012 5:87700916-87700938 GGAGGCTTCACCCAGTGAGAAGG + Intergenic
995126802 5:108585246-108585268 AAAGGGTTCAGCCATAGAGAGGG - Intergenic
995270969 5:110219639-110219661 GGAGTGTTCAGCCAAGGTGTGGG + Intergenic
997668400 5:135650477-135650499 GGAGGGTGCTGCCTTGGAGAAGG + Intergenic
999068031 5:148712970-148712992 GGAGAGTTGAGCGACTGAGAAGG + Intergenic
999672400 5:153969179-153969201 GGAGGATGCAACCACGGAGAAGG - Intergenic
1001127167 5:169030078-169030100 GGAGGGTGCAGCCTAGGAGAGGG - Intronic
1003087038 6:3068634-3068656 GGACGGCGCGGCCACGGAGAAGG + Exonic
1003939137 6:11006838-11006860 GTAGGGTTCAGATATGGAGATGG - Intronic
1004358925 6:14953955-14953977 GGAGGGTAGAGCCATGGCGACGG + Intergenic
1005734053 6:28728965-28728987 GGACTGTTCAGTCATGGAGAAGG - Intergenic
1006113808 6:31764516-31764538 GGAGGGTTTAGACACGGGTAGGG - Exonic
1006141860 6:31934059-31934081 GGTGGGCTCAGCCACTGAAAGGG + Intronic
1007502024 6:42305607-42305629 GGGGGGTTCAGCCAGGGGAAGGG + Intronic
1008651170 6:53564362-53564384 GGAGTGTTCTGCCAAGGGGATGG + Intronic
1008952167 6:57172750-57172772 GGAGCGGTCAGCCATGGAGGAGG - Exonic
1008974169 6:57404779-57404801 GGAGAGTTCAACCATGAAGAAGG - Intronic
1009163057 6:60306302-60306324 GGAGAGTTCAACCATGAAGAAGG - Intergenic
1010829840 6:80514837-80514859 GAAGGGTAGAGACACGGAGAAGG + Intergenic
1011005894 6:82645215-82645237 GGCAGATTCAGCCACAGAGATGG - Intergenic
1012755611 6:103226911-103226933 AGAGGGGTAAGCCAAGGAGAGGG - Intergenic
1012953076 6:105539754-105539776 GATAGCTTCAGCCACGGAGATGG - Intergenic
1017055224 6:150430323-150430345 GGAAAGTTTAGCCACAGAGAAGG + Intergenic
1017124373 6:151051867-151051889 GGAGGGCGCAGCCAGGGTGATGG - Intronic
1019753608 7:2750674-2750696 GGAAGGTGAAGCCACGGACACGG + Intronic
1020005190 7:4780068-4780090 GGAGGGCACAGCCACGTAGGGGG + Intronic
1020099996 7:5389196-5389218 GGACGGTCCAGCCAAGGAGCGGG - Exonic
1021660457 7:22914321-22914343 AGAGGGTAGAGACACGGAGAAGG - Intergenic
1022950948 7:35337382-35337404 GGAGATTTGAGGCACGGAGAAGG + Intergenic
1027171489 7:75876027-75876049 AGAGGGTTTAGGCTCGGAGAGGG - Intronic
1027354253 7:77340866-77340888 AGAGGGTAGAGACACGGAGAAGG - Intronic
1027764601 7:82323869-82323891 GGAAGGTTCAGACAAGGAAAGGG - Intronic
1030163774 7:106532939-106532961 GAAGGGTAGAGACACGGAGAAGG + Intergenic
1030348951 7:108461925-108461947 GGTGGGTTGAGCCAAGCAGAAGG - Intergenic
1032750909 7:134840426-134840448 GGAGAGTTCAGCCACGGAGAAGG - Intronic
1034956975 7:155340891-155340913 GGAGTGCTCAGCCACGGGGAGGG - Intergenic
1035079568 7:156204709-156204731 GGAGGGCTCAGGCACTGAGATGG - Intergenic
1035265836 7:157690014-157690036 GGGGGGTGCAGGCACGGAGATGG - Intronic
1035716514 8:1759373-1759395 GGAATGTACAGCCACGGAGAGGG + Intronic
1038611905 8:29066368-29066390 GGAGGGCTCAGCCACTCTGAGGG - Intergenic
1038904275 8:31880578-31880600 TGAAGGTTCAGACATGGAGAGGG - Intronic
1041723917 8:61000781-61000803 GGAGGGTTCAGTCACTGTGAAGG - Intergenic
1042777159 8:72445419-72445441 GGAGGATTGAGCCAAGGAGTTGG + Intergenic
1047612334 8:126533322-126533344 AGAGAGTTTAGCCACTGAGATGG - Intergenic
1049019280 8:139942893-139942915 GGAGAGTTCAGGAAAGGAGAGGG + Intronic
1049159198 8:141086564-141086586 GGGGGAGTCAGCCACGGAGGTGG - Intergenic
1049529532 8:143147451-143147473 GGGGGGTCCAGCCAGGGAGAGGG + Intergenic
1050896346 9:10888931-10888953 GGAAGTTTCAGCCAGGGAGTAGG - Intergenic
1051230082 9:14947070-14947092 AGAGGCTTCATCCACGGAAAAGG + Intergenic
1054995069 9:71377358-71377380 GAAGGGATCAGCCACACAGAGGG + Intronic
1056079308 9:83074162-83074184 TGATGGTGCAGCCACAGAGATGG + Intergenic
1057474084 9:95384205-95384227 GGAGGCTTCAGCCTCCAAGATGG - Intergenic
1057812739 9:98270351-98270373 GAAGGGTAGAGACACGGAGAAGG + Intergenic
1060205250 9:121678940-121678962 CCAGGGCTGAGCCACGGAGATGG - Intronic
1060370602 9:123066655-123066677 GAAGGGATCACCCAGGGAGATGG - Intronic
1062707631 9:137954127-137954149 GGAGGGTTCAGCTGCGCTGATGG - Intronic
1203658433 Un_KI270753v1:20678-20700 GGAGGGTGGGGTCACGGAGATGG + Intergenic
1195203143 X:102568486-102568508 GGAGGGTGCAGGCACTGGGATGG - Intergenic
1196245112 X:113391305-113391327 GGAATGTTCAGCCACGGAGTGGG + Intergenic
1197381439 X:125747203-125747225 GGATGCTTCAGCCTGGGAGAAGG - Intergenic
1198983905 X:142428061-142428083 GAAGGGTAGAGACACGGAGAAGG + Intergenic
1199320062 X:146427405-146427427 GGAGGATCCAGCAAAGGAGATGG - Intergenic