ID: 973649855

View in Genome Browser
Species Human (GRCh38)
Location 4:52987854-52987876
Sequence CTGATCCACTGTAATAGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973649852_973649855 -10 Left 973649852 4:52987841-52987863 CCCTCTCATCAAACTGATCCACT 0: 1
1: 0
2: 0
3: 9
4: 172
Right 973649855 4:52987854-52987876 CTGATCCACTGTAATAGCTAGGG No data
973649851_973649855 3 Left 973649851 4:52987828-52987850 CCGCAATGCAATTCCCTCTCATC 0: 1
1: 0
2: 0
3: 24
4: 514
Right 973649855 4:52987854-52987876 CTGATCCACTGTAATAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973649855 Original CRISPR CTGATCCACTGTAATAGCTA GGG Intronic
No off target data available for this crispr