ID: 973650998

View in Genome Browser
Species Human (GRCh38)
Location 4:52997120-52997142
Sequence TGGAGAGGTACCCTCAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973650998_973651004 2 Left 973650998 4:52997120-52997142 CCCAGACTGAGGGTACCTCTCCA 0: 1
1: 0
2: 1
3: 16
4: 174
Right 973651004 4:52997145-52997167 CCACAGTCCTGGAAATCTTTAGG 0: 1
1: 0
2: 0
3: 17
4: 163
973650998_973651000 -9 Left 973650998 4:52997120-52997142 CCCAGACTGAGGGTACCTCTCCA 0: 1
1: 0
2: 1
3: 16
4: 174
Right 973651000 4:52997134-52997156 ACCTCTCCATGCCACAGTCCTGG 0: 1
1: 0
2: 2
3: 31
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973650998 Original CRISPR TGGAGAGGTACCCTCAGTCT GGG (reversed) Intronic
900205813 1:1431472-1431494 TGTAGAGGCACCCTCAGGGTGGG - Intergenic
900584129 1:3424370-3424392 TGGAGGGTTCCCCTCAGTGTGGG - Intronic
901389413 1:8934075-8934097 TTGAAAGGTACCATGAGTCTTGG + Intergenic
901770026 1:11525291-11525313 TGGAGAGGTGCCCTCCTTCCAGG + Exonic
902251248 1:15155139-15155161 TTGAGAGGTACCCCCAGACTGGG + Intronic
902674539 1:17999572-17999594 AGGATTGGAACCCTCAGTCTGGG - Intergenic
908796685 1:67836958-67836980 GGGAGAAGCACCCACAGTCTTGG + Intergenic
909082464 1:71129658-71129680 AGGAGAGGTACCCTCACCATAGG + Intergenic
914907379 1:151757671-151757693 TTGGTAGGTACACTCAGTCTTGG - Intergenic
916475937 1:165169049-165169071 TGAAGAGGTGCCCTCAGGCAGGG - Intergenic
919092392 1:192991403-192991425 AGGAGAGGAACCCTCAGTTCTGG + Intergenic
919966500 1:202532098-202532120 TGGGGAGGAACCCTCAGTTCTGG - Intronic
920653452 1:207855913-207855935 TGGAGAGGTAGAGGCAGTCTTGG - Intergenic
922028563 1:221776677-221776699 TGGGGAGGAACCCTCAGTTCTGG - Intergenic
922442844 1:225670776-225670798 GGCAGACTTACCCTCAGTCTGGG + Intergenic
923691190 1:236194790-236194812 TTGAGAGGTAAACTCAGTTTGGG + Intronic
924934550 1:248756967-248756989 GGCAGAGCCACCCTCAGTCTGGG - Intergenic
1064968780 10:21041822-21041844 TGGGGAGGAACCCTCAGTTCTGG - Intronic
1066160784 10:32725371-32725393 TTGAAACATACCCTCAGTCTTGG - Intronic
1067655525 10:48188664-48188686 TGGAGAAATCCCCACAGTCTGGG + Intronic
1068767118 10:60776152-60776174 AGGAGAGGTACACACAGCCTTGG - Intergenic
1070830559 10:79415605-79415627 TGAGGGGGTACCCTCAGCCTGGG - Intronic
1071675431 10:87651370-87651392 GGGAGAGGAACCCTCAGTTCCGG + Intergenic
1072181563 10:92986560-92986582 TGGAGGGGGACCTTCAGTCTAGG + Intronic
1073542199 10:104323512-104323534 TGCAGAGGTACCCCCAGGCAGGG - Intronic
1076825632 10:132966242-132966264 TGCAGAGTGCCCCTCAGTCTGGG + Intergenic
1077096005 11:799420-799442 TGAAGAGGTGCGCGCAGTCTTGG - Exonic
1077369451 11:2174636-2174658 TGGAGAGGTACCCTCGGGCTGGG - Intergenic
1077462642 11:2718284-2718306 TGGTGAGGCACCCTAAGTGTGGG - Intronic
1079182632 11:18207337-18207359 TGGAAAGATAAACTCAGTCTGGG + Intronic
1080871369 11:36239900-36239922 TGGAGAGAGGCTCTCAGTCTGGG + Intergenic
1083489366 11:63003821-63003843 TGGAGAGTTGCTGTCAGTCTGGG + Intronic
1084878925 11:72155648-72155670 AGGAGAGGAACCCTCAGTTACGG - Intergenic
1089891836 11:121889324-121889346 TGGAGAAGTTCCCTAAGTGTTGG + Intergenic
1093170442 12:15853770-15853792 AGGAGAGGAACCCTCAGTTGTGG - Intronic
1093222042 12:16433268-16433290 GGGAGACCCACCCTCAGTCTGGG - Intronic
1093401815 12:18754806-18754828 AGGGGAGGAACCCTCAGTTTCGG + Intergenic
1094614134 12:32021151-32021173 AGGAGAGGAACCCTCAGTTCTGG - Intergenic
1096714488 12:53482942-53482964 AGGAGGGGGACCCTCAGCCTGGG - Exonic
1097963760 12:65557625-65557647 AGGGGAGGAACCCTCAGTTTTGG + Intergenic
1097964271 12:65562355-65562377 AGGAGAGGGACCCTCAGTTTCGG + Intergenic
1100309522 12:93381306-93381328 TGGGGAAGCACCCTCAGTTTTGG + Intronic
1101777132 12:107805773-107805795 TGGGGAGGGTCCCTCAATCTCGG + Intergenic
1102412771 12:112734707-112734729 AGGAGAGGAACCCTCAGTTCTGG - Intronic
1102940690 12:116938900-116938922 TGGAGAAGTAGCCCCAGTCTGGG + Intronic
1105289803 13:19045530-19045552 TGCAGACCCACCCTCAGTCTGGG - Intergenic
1106316080 13:28595175-28595197 TGTAGAGTTTCCCACAGTCTGGG - Intergenic
1107396257 13:40021109-40021131 TGGAGAGGAACCCTGAGCTTAGG - Intergenic
1108117620 13:47146722-47146744 GGGAGACCCACCCTCAGTCTGGG - Intergenic
1109827486 13:67741381-67741403 AGGAGAGGAACCCTCAGTTCTGG + Intergenic
1110836898 13:80093716-80093738 GGGAGAGGTAGCCGTAGTCTCGG - Intergenic
1111648744 13:91064015-91064037 TTGAGGGGTACACTCAGTCTTGG - Intergenic
1114120112 14:19661884-19661906 TGCAGACCCACCCTCAGTCTGGG + Intergenic
1114374695 14:22131734-22131756 AGGGGAGGAACCCTCAGTTTAGG + Intergenic
1114562639 14:23604297-23604319 TGGGGAGGAACCCTCAGTTTTGG - Intergenic
1115391618 14:32860785-32860807 GGAAGATCTACCCTCAGTCTGGG + Intergenic
1118175621 14:63437187-63437209 GGGAGAGGAACCCTCAGTTCGGG + Intronic
1118704801 14:68471036-68471058 TGGAAAGGTACCATCAGTCAAGG + Intronic
1119069416 14:71567638-71567660 AGGGGAGGTACCCTCAGTTCTGG - Intronic
1120407671 14:84109299-84109321 GGGAGAGAAACCCTCAGTTTTGG + Intergenic
1122645033 14:103188729-103188751 TGGAGGGGTTACCACAGTCTAGG - Intergenic
1127819083 15:62639722-62639744 TGGAGAGGCTCCCCTAGTCTCGG - Intronic
1127949750 15:63793481-63793503 GGGGGAGGAACCCTCAGTTTCGG + Intronic
1132994145 16:2814257-2814279 TGGAAAGGTGCCCTTAGGCTGGG - Intergenic
1132996821 16:2827800-2827822 TGGAAAGGCGCCCTCAGGCTGGG + Intergenic
1133915046 16:10101804-10101826 TGGAGAGATAGCCCCACTCTAGG + Intronic
1135338232 16:21622515-21622537 TGAATAGATACCCTCATTCTAGG + Intronic
1135809173 16:25571913-25571935 TGGGGAGGAACCCTCAGTCCTGG + Intergenic
1148805292 17:50260861-50260883 TGGAGAGGAAGCCTCAGTTGGGG - Intergenic
1154023056 18:10682275-10682297 TGCAGAGATACCCTCAGCCACGG - Exonic
1157396409 18:47345476-47345498 TGGGCAGGTTCCCTCAGCCTGGG + Intergenic
1158353499 18:56590003-56590025 TGGAGAATTACCCACAGTTTGGG - Intergenic
1158860778 18:61590142-61590164 TGGGGAGGCTCTCTCAGTCTCGG + Intergenic
1159481806 18:68998817-68998839 TGCAGACCCACCCTCAGTCTGGG - Intronic
1159985030 18:74831767-74831789 TGGAGAGGTCCCCACACTCAGGG - Intronic
1161201210 19:3015831-3015853 TGGTGGGGGACCCTCAGTCTCGG - Intronic
1161400377 19:4064581-4064603 TGGGGAGGCACCCCCAGTGTGGG + Intronic
1163674445 19:18648417-18648439 TGGAGAGGCACACGCAGGCTTGG + Intronic
1165781615 19:38437892-38437914 TGGAGAGGATCACTCAGCCTAGG + Intronic
1166060207 19:40321218-40321240 TGGAGAGGTCCCTCCAGCCTGGG + Exonic
1166639921 19:44487546-44487568 AGGAGAGGAACCCTCAGTTCTGG + Intronic
1167941055 19:52946169-52946191 GGGCGAGCTCCCCTCAGTCTGGG - Intronic
925329503 2:3047552-3047574 GGCAGAGCCACCCTCAGTCTGGG + Intergenic
925445840 2:3926117-3926139 TGGAGAGTTAGCCACAGTCAGGG + Intergenic
925840476 2:7987296-7987318 GGCAGACTTACCCTCAGTCTAGG + Intergenic
929880566 2:45833420-45833442 AGGAGAGGTGCTCACAGTCTAGG + Intronic
930706645 2:54511008-54511030 TGGTGAGGTATCCCCAGCCTGGG + Intronic
930771428 2:55134041-55134063 GGGAGAGGAACCCTCAGTTGTGG - Intergenic
933199717 2:79435097-79435119 TGGGGAGGTAGTCTGAGTCTTGG + Intronic
935444073 2:103137875-103137897 TGCAGACCCACCCTCAGTCTGGG + Intergenic
935783812 2:106531281-106531303 TGAAGAGATACTCTCAGTGTTGG + Intergenic
935886146 2:107621606-107621628 TGGGGAGGAACCCTCAGTTCTGG + Intergenic
938272456 2:129985942-129985964 TGCAGACCCACCCTCAGTCTGGG + Intergenic
938443778 2:131360167-131360189 TGCAGACCCACCCTCAGTCTGGG - Intergenic
938799263 2:134745782-134745804 TGGAGAGGTTCCCTCATGCTGGG - Intergenic
940707625 2:157125062-157125084 TGGAGAGCTACATGCAGTCTAGG + Intergenic
943385588 2:187200758-187200780 TGGAGACCCACCCTCAATCTGGG - Intergenic
948818212 2:240524419-240524441 TGGAGTGATAACCTCATTCTAGG + Intronic
1168880249 20:1200337-1200359 AGGGGAGGAACCCCCAGTCTGGG - Intergenic
1170833900 20:19867576-19867598 TGTAGAGTGACCCTCAGTTTAGG + Intergenic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1172973450 20:38889711-38889733 TGGACAGGTACCCTGTTTCTCGG + Intronic
1179522100 21:41952489-41952511 TGGGGAGGCACCCCTAGTCTTGG - Intronic
1180007319 21:45028738-45028760 TGCAGAGGGACCGTCTGTCTGGG + Intergenic
1180462634 22:15580201-15580223 TGCAGACCCACCCTCAGTCTGGG - Intergenic
1181995812 22:26881130-26881152 TGGGCAGTTACCCTCTGTCTGGG + Intergenic
1182865325 22:33599418-33599440 AGCAGAGGTACCTTCAGTCCTGG + Intronic
1183543455 22:38443186-38443208 TGGAGAGGGACCCTCAGGCCTGG - Intronic
1183954406 22:41370748-41370770 GGGAGAGGGACCCCAAGTCTGGG - Intronic
1183996872 22:41640545-41640567 TGGAGTGGTTTCCTCAGTATAGG + Intronic
1184658186 22:45952600-45952622 TGGAGAGTGTCCCTCAGGCTGGG - Intronic
1184939664 22:47753714-47753736 TGGAGAGGAACCTTCAGTATGGG - Intergenic
949364541 3:3266769-3266791 GGGAGAGGAACCCTCAGTTCTGG + Intergenic
949856179 3:8463548-8463570 TGGAGAGGTAGGCTCAGTTCCGG - Intergenic
951125947 3:18983267-18983289 TGGAGGAGTACCCTCTGGCTGGG + Intergenic
951838943 3:27012685-27012707 TGGAAAGGACCCCTCAGGCTTGG + Intergenic
952338722 3:32427438-32427460 GGGAGAGGTGCCCTCGGTATGGG + Intronic
953610136 3:44440850-44440872 AGGAGAGGAACCCTCAGTTCTGG - Exonic
954733670 3:52686446-52686468 AGGAGAGGAACACTGAGTCTGGG - Intronic
957546165 3:81640257-81640279 GGCAGACCTACCCTCAGTCTCGG + Intronic
960986279 3:123283170-123283192 TGGAGATGTTCACTCAGACTGGG - Exonic
961327696 3:126118986-126119008 TGGGGAGCTACGCTGAGTCTGGG - Intronic
964343275 3:155730844-155730866 TGGAGAGATACCCTCTGCTTGGG + Intronic
965258982 3:166455623-166455645 AGGAGAGGAACACTCAGTTTTGG - Intergenic
967636023 3:191804313-191804335 AAGAGAGGTACCCTCTGTATGGG + Intergenic
969877790 4:10148786-10148808 TGGAAATGTTCCCTCAGTCCAGG + Intergenic
970258415 4:14195946-14195968 TGGTGATGTAACTTCAGTCTCGG + Intergenic
971578108 4:28302815-28302837 GGCAGATGTACTCTCAGTCTGGG - Intergenic
971630895 4:28992646-28992668 TGGAGAGTTACCCTCAGCAATGG + Intergenic
971696701 4:29913878-29913900 TGGAGAGCTACACTCACTGTAGG - Intergenic
973541980 4:51944109-51944131 TGGAGAGGAACTCTCAGTTCTGG + Intergenic
973650998 4:52997120-52997142 TGGAGAGGTACCCTCAGTCTGGG - Intronic
973775681 4:54239202-54239224 AGGGGAGGAACCCTCAGTCCTGG + Intronic
977670913 4:99693663-99693685 TGGAGAGGCTCCCTAGGTCTGGG - Intergenic
977686886 4:99856882-99856904 AGGAGAGGAACCCTGAGCCTTGG + Intronic
983894979 4:173071493-173071515 GAGAGAGGTACCCTCTGTGTGGG - Intergenic
985665615 5:1180379-1180401 TGGAGAGGACCCCACAGTCCAGG - Intergenic
985665632 5:1180436-1180458 TGGAGAGGACCCCACAGTCCAGG - Intergenic
985959905 5:3293554-3293576 TGCAGAGGTTCCCCCATTCTTGG + Intergenic
987004199 5:13692592-13692614 TGGGGAGGCACCCTCTGTCCTGG - Intronic
993171608 5:84427115-84427137 AGGAGAGGAACCCTCAGCTTAGG + Intergenic
995010781 5:107255220-107255242 GGTTGAGGTACCCTAAGTCTGGG + Intergenic
998795858 5:145818117-145818139 TCCAGAGTTACTCTCAGTCTTGG + Intronic
998946036 5:147339995-147340017 TGGGGAGGAACCCTCAGTTCTGG - Intronic
998956338 5:147442289-147442311 TGTAGAGGTACACTGTGTCTTGG - Intronic
1001414042 5:171530746-171530768 TGGAGATGTACCCACAGACAAGG - Intergenic
1002045975 5:176542067-176542089 TGGAGAGGTGCTCCCCGTCTGGG + Intergenic
1004409967 6:15372010-15372032 TGGAGAATTACTCTCATTCTAGG + Intronic
1005053841 6:21711207-21711229 TGGGGAGGGACCATCAGTGTGGG + Intergenic
1012351555 6:98257584-98257606 TGCAGACCTACCCTCAGTCTGGG + Intergenic
1013701424 6:112774576-112774598 AGGGGAGGAACCCTCAGTTTTGG + Intergenic
1016551608 6:145286630-145286652 TAGAGAGGTCTCCTCAGGCTGGG - Intergenic
1019625519 7:2013944-2013966 AGGAGAGGTGGCCTCAGCCTTGG - Intronic
1023049435 7:36238054-36238076 AGGAGAGGAACCCTCAGTTCTGG - Intronic
1023599589 7:41868292-41868314 TTGAGAGGTACCTTCTGCCTTGG - Intergenic
1023721071 7:43095455-43095477 AGGAGAGGTCCCTTCAGTGTGGG + Intergenic
1023973040 7:45005871-45005893 TGGAGAGGACCCCCCAGTCCTGG + Intronic
1024237036 7:47406639-47406661 TGGCTTGGTGCCCTCAGTCTGGG - Intronic
1024645320 7:51366203-51366225 TTGAGAAGTGCCCTTAGTCTAGG + Intergenic
1028144192 7:87304038-87304060 TAGAAAGCTACCCTCAGTCTTGG + Intergenic
1030758465 7:113320111-113320133 AGGAGAGGAACCCTGAGTTTTGG - Intergenic
1033734139 7:144205490-144205512 TGGAGAGGAACCCTCAGTTCTGG - Intergenic
1033748912 7:144345483-144345505 TGGAGAGGAACCCTCAGTTCTGG + Intergenic
1040482823 8:47841933-47841955 TGGTGAGGTGCCCACAGCCTGGG - Intronic
1040521615 8:48181148-48181170 TGGAGAGGAGCCTTCAGTCCCGG - Intergenic
1043777089 8:84283496-84283518 TGGAGAGGTAGCATCCATCTGGG + Intronic
1045643931 8:104281877-104281899 TGGGGAGGAACCCTCAGTTATGG - Intergenic
1047569132 8:126078804-126078826 TGGAGAGCTTCCCTCTGTTTAGG + Intergenic
1048045260 8:130766967-130766989 TGAAGAGATACCCTGAGACTGGG + Intergenic
1048083379 8:131152456-131152478 TGGAGTGATACTTTCAGTCTTGG + Intergenic
1048535255 8:135288161-135288183 TGAAGAAGCACCCTCTGTCTTGG + Intergenic
1051770039 9:20567691-20567713 TGGACATGTACCCTGTGTCTTGG - Intronic
1053053693 9:34981086-34981108 TGGAGCAGTCCCCTCACTCTAGG + Exonic
1053117617 9:35519427-35519449 AGGAGAAGCACCATCAGTCTAGG + Intronic
1053562943 9:39214943-39214965 TGGGGAGGAACCCTCAGTTCTGG - Intronic
1053828737 9:42052889-42052911 TGGGGAGGAACCCTCAGTTCTGG - Intronic
1054134204 9:61404112-61404134 TGGGGAGGAACCCTCAGTTCTGG + Intergenic
1054601822 9:67134565-67134587 TGGGGAGGAACCCTCAGTTCTGG + Intergenic
1056185914 9:84134783-84134805 GGCAGACCTACCCTCAGTCTGGG + Intergenic
1060148433 9:121270959-121270981 TGGAAATGGACCCCCAGTCTTGG + Intronic
1062222719 9:135426598-135426620 TGGGGAGGAACCCTCAGTTCTGG + Intergenic
1187339143 X:18405821-18405843 GGCAGACCTACCCTCAGTCTGGG - Intergenic
1188858379 X:35225458-35225480 TAGAGTGGTGACCTCAGTCTAGG - Intergenic
1190310097 X:49111114-49111136 TGAAGAGGTGGCCTCAGTGTGGG + Intergenic
1191693209 X:63961968-63961990 TGAAGAAGTCCTCTCAGTCTTGG + Intergenic
1193606251 X:83570513-83570535 TGAAGACCTACCCTCAGTGTTGG - Intergenic
1196365267 X:114916512-114916534 GGCAGAGTTACCCTCAATCTGGG - Intergenic
1197164872 X:123365988-123366010 TGGGGAGGAACCCTCAGTTCTGG - Intronic
1198965667 X:142227175-142227197 AGGAGAGGAACCCTCAGTTCTGG - Intergenic
1201950031 Y:19553471-19553493 TGGAGAGATAAACGCAGTCTTGG - Intergenic
1202302123 Y:23427896-23427918 TGGGGAGGAACCCTCAGTTCTGG - Intergenic
1202568688 Y:26242702-26242724 TGGGGAGGAACCCTCAGTTCTGG + Intergenic