ID: 973655580

View in Genome Browser
Species Human (GRCh38)
Location 4:53044418-53044440
Sequence CTGTCTCAGCACCTGGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 254}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973655575_973655580 10 Left 973655575 4:53044385-53044407 CCCACCTACCATAAAGCTCTTGC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 973655580 4:53044418-53044440 CTGTCTCAGCACCTGGTTTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254
973655577_973655580 6 Left 973655577 4:53044389-53044411 CCTACCATAAAGCTCTTGCACTT 0: 1
1: 0
2: 0
3: 18
4: 157
Right 973655580 4:53044418-53044440 CTGTCTCAGCACCTGGTTTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254
973655573_973655580 25 Left 973655573 4:53044370-53044392 CCTTTATCTCGTCCTCCCACCTA 0: 1
1: 0
2: 1
3: 17
4: 254
Right 973655580 4:53044418-53044440 CTGTCTCAGCACCTGGTTTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254
973655578_973655580 2 Left 973655578 4:53044393-53044415 CCATAAAGCTCTTGCACTTCGAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 973655580 4:53044418-53044440 CTGTCTCAGCACCTGGTTTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254
973655574_973655580 13 Left 973655574 4:53044382-53044404 CCTCCCACCTACCATAAAGCTCT 0: 1
1: 0
2: 2
3: 12
4: 185
Right 973655580 4:53044418-53044440 CTGTCTCAGCACCTGGTTTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254
973655576_973655580 9 Left 973655576 4:53044386-53044408 CCACCTACCATAAAGCTCTTGCA 0: 1
1: 0
2: 0
3: 4
4: 130
Right 973655580 4:53044418-53044440 CTGTCTCAGCACCTGGTTTCTGG 0: 1
1: 0
2: 1
3: 26
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973655580 Original CRISPR CTGTCTCAGCACCTGGTTTC TGG Intronic
900626173 1:3609713-3609735 CTGCCTCTGCACCTGGGCTCGGG - Intronic
900968552 1:5976391-5976413 CTGTCACAACACCAGGTTTCGGG + Intronic
901064588 1:6488843-6488865 CAGCCTCCGCATCTGGTTTCTGG - Intronic
901474045 1:9476914-9476936 CTGCCTCACCCCCTGCTTTCAGG + Intergenic
901638674 1:10682239-10682261 CTGTCTCACCTCCTGTTTTTGGG - Intronic
902921254 1:19667046-19667068 CTGTCTCAGGATCTGGCCTCAGG + Intronic
903031464 1:20466956-20466978 CTGTCTCTGCACCTGGGGTTAGG - Intergenic
903188396 1:21642344-21642366 CTGTGCCAGGCCCTGGTTTCAGG + Intronic
904983866 1:34528464-34528486 CTGTCCCAGCACCTGGCTGCAGG + Intergenic
905524265 1:38624558-38624580 CTGGCTCAGCTCCGGGCTTCAGG + Intergenic
906548243 1:46638088-46638110 CTCTCTCAGCCCCTGGCTACAGG + Intronic
911563255 1:99432226-99432248 TTGTCTCAGCCTCTGCTTTCAGG - Intergenic
912593521 1:110851256-110851278 CTGCCTCACCACCTGGATGCAGG - Intergenic
912949226 1:114109128-114109150 CTGGCTCAGCTCCAGGTATCTGG - Intronic
915029246 1:152862027-152862049 CTGTCAAAACATCTGGTTTCAGG + Intergenic
915446683 1:155978267-155978289 CTGTCTCCCCGCCTGCTTTCTGG - Intronic
915597898 1:156905750-156905772 GTGTCTCAGGACTTGGTGTCTGG + Intronic
915850020 1:159311571-159311593 CTGTCTCAGTGTCTGTTTTCTGG - Intergenic
919497430 1:198291274-198291296 CAGGCTCTGCTCCTGGTTTCAGG - Intronic
919612658 1:199764745-199764767 CAGTCTCAGCACCTAGTTGGAGG + Intergenic
919826267 1:201505770-201505792 CTGACTCTCCAGCTGGTTTCTGG - Intronic
920398268 1:205661775-205661797 CTAGCTCAGAACCTGGTATCTGG - Intronic
1062818545 10:517382-517404 CTGAGTCAGCAGCTGTTTTCTGG + Intronic
1063495818 10:6506860-6506882 CTGTCTCAGCACATCGTACCGGG + Intronic
1064436179 10:15313113-15313135 GTGTCTCTGGAGCTGGTTTCTGG - Intronic
1064843146 10:19618806-19618828 CTTTCTCATTACCTGATTTCTGG + Intronic
1065154009 10:22851232-22851254 CTGCCTCAGCACCTAGCTCCAGG + Intergenic
1066780473 10:38941186-38941208 CTCTCTAAGCTGCTGGTTTCAGG - Intergenic
1067055408 10:43046922-43046944 GTGTCTCAGCACTTGGCTCCTGG - Intergenic
1067183914 10:44011140-44011162 CTTCCTGTGCACCTGGTTTCAGG - Intergenic
1068051448 10:51954633-51954655 CTTTCTCAGAACTTGATTTCAGG + Intronic
1071929580 10:90453321-90453343 CTGTCTTGGCACCTGCTTCCAGG - Intergenic
1072158391 10:92744308-92744330 CTTTCCCTTCACCTGGTTTCAGG + Intergenic
1072514518 10:96166089-96166111 CTGTCTCAGCTCCTGGGGTATGG + Intronic
1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG + Intergenic
1075940259 10:126385455-126385477 ATGTCTCTGCCCCTGGTTCCTGG - Intronic
1076116775 10:127906821-127906843 CTGTCTACGCACCTGGGTCCCGG + Intergenic
1076124439 10:127962901-127962923 CTCTCCCAGCCCCTGGTTCCTGG - Intronic
1076270192 10:129145647-129145669 ATTACTTAGCACCTGGTTTCTGG - Intergenic
1077928586 11:6707248-6707270 CTGTCTCAGCCTCTGGATACAGG + Intergenic
1078158560 11:8819579-8819601 CCTTCTCAGCACATGGTATCGGG - Intronic
1083207716 11:61162547-61162569 CTGTCACAGCCCCTGGCTTGGGG - Intergenic
1083428037 11:62599346-62599368 TTGCCTCAGCACAGGGTTTCCGG - Intronic
1083916182 11:65745049-65745071 CTGTCACAGCCCCTGGTTTGGGG - Intergenic
1084585966 11:70062637-70062659 CTGTCTCAGCAAGGGGGTTCTGG + Intergenic
1085913878 11:80861746-80861768 CTGTCTCTGCACTTGCTTCCAGG - Intergenic
1087409075 11:97767570-97767592 CCATCTCAGCACCTGCTTTCAGG + Intergenic
1089004129 11:115076661-115076683 CTGTCTCACCCTTTGGTTTCAGG + Intergenic
1089661759 11:119990674-119990696 CTGTCTGAGTCCCTGGTTTAGGG + Intergenic
1090611253 11:128472898-128472920 ATGTCTTGGCACCTGCTTTCCGG + Intronic
1091514938 12:1169567-1169589 CTGTCTCAGGGTCTGCTTTCCGG + Intronic
1092242317 12:6842958-6842980 CTCTCTCTGCAGCTGGTGTCTGG + Exonic
1094025536 12:25957559-25957581 CTGACTCAGGACCTGATTTAAGG - Intergenic
1095571943 12:43693438-43693460 CTGCCTCAGTCCCTGATTTCAGG + Intergenic
1098157875 12:67618892-67618914 TGGTCTCTGCCCCTGGTTTCTGG - Intergenic
1101482044 12:105107710-105107732 CTGTCACAGCACGTGACTTCCGG - Exonic
1101592545 12:106137698-106137720 GTGTTTCAGCTCCTGGTTGCAGG - Intronic
1101988018 12:109462419-109462441 CTGAGTCAACTCCTGGTTTCAGG + Intronic
1103726261 12:122998751-122998773 CTGTGTTGGCACCTGGTTCCTGG - Intronic
1103942428 12:124508351-124508373 CTGTCTGAGCTCCTGGCTGCAGG - Intronic
1104466398 12:128994221-128994243 CTGTCTCAGGACCAGGTTCAGGG - Intergenic
1104543979 12:129694660-129694682 CTGTTTCAGCACCTCACTTCCGG + Intronic
1106908861 13:34440507-34440529 TGGTCTCTGCCCCTGGTTTCTGG - Intergenic
1110588454 13:77223425-77223447 CTGTCTTGGCATCTGCTTTCTGG + Intronic
1113393019 13:109916153-109916175 TTGTCTCAGCATCTGATTCCAGG - Intergenic
1114650895 14:24284083-24284105 CTGTCTCAGCTCCTGCCTGCAGG - Intergenic
1117513469 14:56476196-56476218 CTGTAGCAGAATCTGGTTTCAGG + Intergenic
1118256422 14:64209707-64209729 CTGTCTCAGCAGCTGGGGGCAGG - Intronic
1118816828 14:69319827-69319849 CTGTCTGAGCACTTGAGTTCTGG + Intronic
1121139052 14:91524802-91524824 TTGTCTCAGCCTCTGCTTTCTGG + Intergenic
1121603959 14:95226977-95226999 CTGTCTCTGCTCCTGGGTACAGG + Intronic
1121894647 14:97635574-97635596 CTGTGTTTGCACCCGGTTTCCGG + Intergenic
1122817791 14:104322048-104322070 CTGTCTCTGCTCCTGACTTCTGG + Intergenic
1126026119 15:44447922-44447944 CAGTCTCAGCACCCAGTGTCTGG + Intronic
1126394436 15:48198968-48198990 CTGTCTCAGAGACTGGCTTCTGG - Intronic
1126677245 15:51171202-51171224 CTGTCCCAGCTCCTGCTTCCAGG - Intergenic
1126678995 15:51186264-51186286 CTGTCTCAGCATCTACTTCCGGG - Intergenic
1126799177 15:52284785-52284807 CTGTTTTACCACCTGGATTCTGG - Intronic
1127600050 15:60526372-60526394 CTGACACAGCACCTGGCTTGGGG - Intronic
1128157377 15:65400519-65400541 CTAGCTCAGCACCTGGCCTCAGG + Intronic
1129821109 15:78602605-78602627 CTGCTTCAGCACCTGGCTCCAGG - Intronic
1131792508 15:95980511-95980533 CTGTCTCGGGTCCTGCTTTCTGG - Intergenic
1132375030 15:101323260-101323282 CTCACTCAGCACCTGCTTTATGG - Intronic
1132524157 16:406087-406109 CTGTCTCTGTACCTGGTGTTTGG + Intronic
1133044365 16:3078624-3078646 CTGTCTTTGCAGCTGGTTTCTGG + Intronic
1135197879 16:20409493-20409515 CTGTGTCAGCTGCTGGGTTCTGG + Intergenic
1135938042 16:26797696-26797718 CTGTCTCAGCACCTGCTTCTTGG - Intergenic
1135955278 16:26951771-26951793 CTGTCTCAGGAGCTGTTTTGGGG - Intergenic
1137552150 16:49445012-49445034 CTGCCTCTGCACCTGGCTTTTGG + Intergenic
1141124560 16:81391928-81391950 CTGTCTCAGGCACTGGTTTCTGG - Intergenic
1142649762 17:1340701-1340723 CGGTCTCAGCTCCTGCTTTGGGG - Intergenic
1143179834 17:4977625-4977647 AAGTCTCAGCACCTGGTCTTAGG - Intronic
1146213079 17:30957043-30957065 CTGGCCCAGGACCTGGCTTCTGG + Intronic
1146381767 17:32335391-32335413 CTATCTGAGCAGCTGGTTTGAGG - Exonic
1147360144 17:39925178-39925200 CCCTCTCAGCACCTGTTTCCAGG + Exonic
1147602181 17:41753660-41753682 GTGTCTCATCACCTAGTGTCTGG + Intergenic
1151399116 17:73843978-73844000 TTGTCTCAGCATCTGCTTTTGGG + Intergenic
1151511299 17:74561889-74561911 TTGTCTCAGGACCTGATTTGGGG + Intergenic
1151802650 17:76386888-76386910 CTGTCTCTGCACACGGCTTCGGG + Exonic
1152368735 17:79871863-79871885 CTGGCTTAACACCTGGTGTCTGG + Intergenic
1152880809 17:82813860-82813882 CTGTCTCAGCCCCTCCTCTCTGG + Intronic
1153027321 18:683542-683564 CCGTCTCAGCAGCTGCTCTCTGG - Intronic
1153610198 18:6877249-6877271 CCATCTCAGCATCTGCTTTCTGG - Intronic
1157390090 18:47294484-47294506 CTGTCTCATTACCTTGTCTCTGG - Intergenic
1157519476 18:48335452-48335474 AGGTCTCAGCAACTGGATTCAGG - Intronic
1158305023 18:56095732-56095754 CAGTCTCAGCAGCTGAGTTCTGG - Intergenic
1158350964 18:56563959-56563981 CTGCCTCTGCTCCTTGTTTCAGG + Intergenic
1160157635 18:76445742-76445764 CTGTCTCTGGAGCTGGCTTCTGG - Intronic
1160348811 18:78156387-78156409 ATATCAGAGCACCTGGTTTCTGG + Intergenic
1160395375 18:78566975-78566997 CTGGCTCAGCTCCTGGCTGCAGG - Intergenic
1160828812 19:1093369-1093391 CGGTTTCAGCACCTGCTTTGCGG - Intronic
1161121581 19:2529871-2529893 CTGGCTCTGCTCCTGGTTTTTGG + Intronic
1161457098 19:4374946-4374968 CTGTCCCAGCACATGGTGGCAGG + Intronic
1161481648 19:4513691-4513713 CTTTCTCAGCAGATGGTGTCCGG - Exonic
1161528072 19:4769682-4769704 CTGTTTCAGCACCGGGGCTCAGG + Intergenic
1161699716 19:5787953-5787975 CTGTCTCAGAGCCAGGTTCCAGG - Intronic
1163240570 19:16060717-16060739 CTGTCTGAGCCCCTGATTTTGGG + Intergenic
1164079060 19:21847055-21847077 CTGTCACATCACCTGGATGCTGG + Intronic
1164206272 19:23061382-23061404 CAGTCACATCACCTAGTTTCTGG + Intergenic
1164363961 19:27552626-27552648 CTTTCTCAGAAACTGCTTTCTGG + Intergenic
1164574655 19:29398636-29398658 CTGTCCCAGCACCTGAGCTCTGG + Intergenic
1164708477 19:30337575-30337597 CTGTCTCATCAGCTAGTATCAGG - Intronic
1166304511 19:41929831-41929853 CGGTCTCAGCACCTGGGCGCTGG - Intronic
1166306742 19:41939882-41939904 CTGTCGCAGGACCCGGCTTCCGG + Intergenic
1166825162 19:45604231-45604253 CTGTCTCAGCCTCTGGTAGCTGG + Intergenic
1167352985 19:48987199-48987221 CTTTCTGACCACCTGGTTCCTGG - Exonic
1167999240 19:53431798-53431820 CTCTCCTAGCACCTGTTTTCGGG - Intergenic
1168710425 19:58496983-58497005 CTGTCTCAGCTCCAGGCTGCAGG + Intronic
924982727 2:237970-237992 CCCTCTCAGCAGCTGCTTTCAGG - Intronic
925896414 2:8475557-8475579 TCATCTCAGCACCTGGTTTCAGG - Intergenic
927160142 2:20249284-20249306 CAGTATCAGCCCATGGTTTCAGG - Exonic
927182018 2:20453475-20453497 CCGTATCTGCACCTGGGTTCAGG - Intergenic
927915489 2:26933427-26933449 CTGGCTCAGGTCCTGGTTTCAGG - Intronic
930066601 2:47332521-47332543 CAGTCTCAGCACCTGGCTAGGGG + Intergenic
930102457 2:47613918-47613940 CTGGCTCAGCACAAGGCTTCAGG + Intergenic
930851790 2:55968967-55968989 CTGTCTCAGCATCTCATCTCAGG + Intergenic
930991016 2:57654971-57654993 CTGCCTCAGCCCATGGCTTCAGG + Intergenic
931579119 2:63753903-63753925 CTGTCTCAGATTCTGGTTCCAGG - Intronic
931700211 2:64903243-64903265 CTGTCTCAGAAACTGGTCCCCGG - Intergenic
932071711 2:68627256-68627278 CAGTCTCAGCACATGTGTTCTGG - Intronic
934771159 2:96908324-96908346 TTGGCTCAACACCTGGTTTGTGG - Intronic
934843433 2:97646038-97646060 CTGTCTCTGCAGCTTGTTCCCGG + Exonic
935554430 2:104492938-104492960 CTTTCTCAGCACTAGGATTCTGG + Intergenic
936050271 2:109217435-109217457 TTGTCTCAGCTCCAGGTTTATGG + Intronic
939617526 2:144377799-144377821 CTTTTTCAGCTCCAGGTTTCTGG - Intergenic
943445801 2:187986588-187986610 CTATCTATGCACCTGGTCTCAGG + Intergenic
946162780 2:217846333-217846355 CTGGCTCAGGACCTGGTGTGGGG - Intronic
946412060 2:219520380-219520402 CTGTCCCAGGACCCAGTTTCGGG + Intronic
946676624 2:222167397-222167419 CTGTCTCAGAATCTGTTTTTAGG - Intergenic
947395875 2:229686335-229686357 CTGACTCAGAACCTGGGTGCAGG - Intronic
947953613 2:234169235-234169257 CTGTCTCACCACCATGTTTGTGG - Intergenic
948277359 2:236719380-236719402 CTGTCTCAGGTCTTGGGTTCAGG + Intergenic
948684819 2:239663853-239663875 CTGTCTCAGGACCTACTTTCAGG - Intergenic
948814741 2:240504121-240504143 CTGTGGCAGAACCTTGTTTCAGG - Intronic
1168808585 20:687955-687977 CTATCTCAGCACCATGTTCCAGG - Intergenic
1170963242 20:21044087-21044109 CTGTCTTAGCATCTGTTTTGGGG - Intergenic
1171078129 20:22149731-22149753 CTGTCATAGCATCTGGTGTCTGG - Intergenic
1171460849 20:25297087-25297109 CTGGCTCTGCACCTGGTATATGG + Exonic
1172880322 20:38195566-38195588 CTGTCTCAGAGCCTGCTTTGGGG - Intergenic
1173710407 20:45150806-45150828 GTGTCTCAGCTCTTGCTTTCTGG - Intergenic
1173988364 20:47280290-47280312 CCCTCTCAGCACCTGCTTTAAGG - Intronic
1174175247 20:48640509-48640531 CTGTCTCAGGATCAGCTTTCAGG - Intronic
1176227647 20:64010989-64011011 CTGTGCCAGCCCCTGGTATCAGG + Intronic
1176670404 21:9728739-9728761 CTGGCAAAGCAGCTGGTTTCAGG - Intergenic
1176994716 21:15542194-15542216 CAGGCTCAGCTTCTGGTTTCTGG - Intergenic
1178374296 21:32054348-32054370 CTCTGTCAACACCTGGTTTGGGG - Intergenic
1179643336 21:42761044-42761066 CTGACACAGCTCCTGGCTTCTGG + Intronic
1180700591 22:17779539-17779561 TTGTCTCAGCATCTGCTTGCCGG - Intergenic
1181421072 22:22799512-22799534 ATGTCTCAGAAGCTGTTTTCAGG + Intronic
1183056228 22:35307754-35307776 CTGTCTCAGCCCCTGTGGTCTGG - Intronic
1184533482 22:45071325-45071347 CTGTCACTGCCCCTGGTCTCTGG + Intergenic
950094372 3:10320273-10320295 GTGTCTCAGCAGCAGGTTTGAGG - Intronic
950311931 3:11966479-11966501 TTGTGTGAGCACCTGGATTCAGG - Intergenic
950361234 3:12450772-12450794 CTGTCTCAGGCTCTGCTTTCAGG - Intergenic
951797597 3:26558161-26558183 TTGTCTCAGGCTCTGGTTTCAGG - Intergenic
952542115 3:34377629-34377651 CTGTATCAGCACCTGCTTCCAGG - Intergenic
952723962 3:36562341-36562363 CAGCCTCAGATCCTGGTTTCAGG - Intergenic
953357963 3:42270486-42270508 CTGGGACAGCACCTGGTTACAGG + Intergenic
956881255 3:73513038-73513060 CTATCTCAGCACCTGGGAACTGG - Intronic
959787049 3:110312349-110312371 CTGTCTCAGAAACCGGTTTCAGG - Intergenic
960710064 3:120519032-120519054 GTGTCTCAGCATCTGCTTCCTGG - Intergenic
961150332 3:124632349-124632371 CTGTCTCAGTCCCAGGTTTGCGG + Intronic
961994962 3:131232886-131232908 CTGTCTCATCACCTGCTTCCTGG - Intronic
963811514 3:149781515-149781537 CTCTCTCAGAACCTGGTATCTGG + Intronic
964135293 3:153338791-153338813 TTGTCTGAGCCTCTGGTTTCAGG - Intergenic
965744875 3:171913994-171914016 CTATCTCAGAATCTGCTTTCTGG + Intronic
967279189 3:187805865-187805887 CCCTCTCAGCACCAGGTATCAGG - Intergenic
967762632 3:193242287-193242309 CTGCCTCAGCTACTGGTCTCTGG - Intronic
967850095 3:194075891-194075913 CTGCCTCAGCACATGGGTTCAGG + Intergenic
969338871 4:6528090-6528112 CTGTGTGACCACCTGGTTACGGG + Intronic
969961585 4:10949688-10949710 CTGTCTCAGCATGTGCTTCCTGG + Intergenic
970939210 4:21611609-21611631 CTATCTCTTCACCTGGTTTAAGG + Intronic
971417847 4:26450064-26450086 CTGACTCAGTACCTAGTTTACGG - Intergenic
973655580 4:53044418-53044440 CTGTCTCAGCACCTGGTTTCTGG + Intronic
974160087 4:58127231-58127253 CTGCCTCAAAACCTGGTTTTGGG + Intergenic
975593576 4:76024856-76024878 CTGTCTCAGAACCTGGTATCAGG + Intronic
978248752 4:106605518-106605540 CTTCCTCAGCACCTTGTTTCAGG + Intergenic
982109392 4:152040093-152040115 CCCTTTCAGCACCTGGTTTTGGG - Intergenic
983967437 4:173830094-173830116 CTGTCTCAGAACCTGTTGTCTGG + Intergenic
985175729 4:187197820-187197842 CCTTCTCAGCACCTGATATCAGG - Intergenic
985404371 4:189622801-189622823 CTGGCAGAGCAGCTGGTTTCAGG + Intergenic
985933840 5:3079806-3079828 CAGGCTCAGCACCTATTTTCTGG - Intergenic
987079821 5:14416819-14416841 CTGTCTCATCACCTGCCCTCTGG - Intronic
987582059 5:19806790-19806812 CTCTGTGAGCAACTGGTTTCAGG - Intronic
989343132 5:40399656-40399678 TTGTCTCAGGACCTGCTTTCAGG - Intergenic
990364774 5:55059382-55059404 ATGTCTCAGCACCTGCTTTTTGG - Intergenic
991408693 5:66325984-66326006 CTGTCTCAGGCTCTGCTTTCAGG + Intergenic
994176327 5:96715614-96715636 CTGTCACAGCTCCTGGTATTTGG + Intronic
995181520 5:109234811-109234833 GTGTCCCAGCACCTGTTTCCAGG + Intergenic
996158783 5:120136272-120136294 CTGTCTCAGGATTTGGTTTTGGG + Intergenic
996921438 5:128772164-128772186 CTGTCTCAGGCCCTCGTTTTTGG - Intronic
1000349947 5:160345308-160345330 CTGACTCCTCACCTGGTTTGGGG + Intronic
1001491175 5:172156519-172156541 CTTTCTCAGCATCTGCTTTGAGG - Intronic
1004461927 6:15845012-15845034 CTGTCTCAGTTCCTGGTGGCAGG - Intergenic
1004526570 6:16414265-16414287 CTGTCTCATCACCTCATTTAGGG - Intronic
1005674125 6:28136892-28136914 CTGCCTAAGCACTTGGGTTCCGG + Intergenic
1006034550 6:31201345-31201367 CTGGCTCTGCACCTGGGGTCCGG + Intronic
1006669985 6:35724208-35724230 CAGGCTCAGCCCCTGGTTTTTGG + Intronic
1007112118 6:39318940-39318962 TTGTCTCAGCATCTGCTTTTGGG + Intronic
1007274943 6:40666406-40666428 CAGTCTCAGAACCTGTTTTAGGG - Intergenic
1007391484 6:41551995-41552017 CTGTCTCAGCTGGGGGTTTCAGG - Intronic
1008598566 6:53066156-53066178 CTGTCACAGCGCCTGAATTCGGG + Intronic
1009559177 6:65217535-65217557 CCGTCTCATCATCTGGTTTCAGG - Intronic
1011937718 6:92801686-92801708 TTGTCTTAGAACCTGCTTTCAGG + Intergenic
1012992415 6:105939500-105939522 CTGTTTCAGCATCTGCTTCCTGG - Intergenic
1016407680 6:143747517-143747539 ATGTGTCAGAACCTGGTTTGGGG + Intronic
1016825281 6:148382635-148382657 CTCTCTCAGCACCTGCTTCTAGG - Intronic
1022023455 7:26423555-26423577 CTCTCTCACAACCTGGCTTCTGG + Intergenic
1022466350 7:30655351-30655373 CTGTCCCAGCACCTGTTCTGAGG - Intronic
1022812775 7:33885827-33885849 GTGTCTCCTCACTTGGTTTCAGG + Intergenic
1026004756 7:66591996-66592018 CTGTCTCAGGCGCTGGTTGCCGG - Intergenic
1026491334 7:70866405-70866427 CTGTCTGGGCACCTTGTTTCTGG - Intergenic
1027197870 7:76043519-76043541 CTCCCTCAGCCCCTGGCTTCTGG - Intronic
1028127107 7:87126028-87126050 CCATCTCAGCATCTGCTTTCTGG + Intergenic
1032477390 7:132221524-132221546 CTGTCTCAGGGTGTGGTTTCAGG - Intronic
1034431222 7:151042126-151042148 GTGCCTCACCACCTGGTTCCCGG - Intronic
1035596163 8:859635-859657 CTGTCTCAGCACCAGGCCTCTGG + Intergenic
1036503641 8:9335820-9335842 CTGGCTCAGGTCCTGGCTTCTGG - Intergenic
1039181053 8:34866718-34866740 CTGTTTCAGCATATTGTTTCAGG + Intergenic
1039559102 8:38498327-38498349 CTGTCCCATCACATGGTTGCTGG - Intergenic
1041169883 8:55130611-55130633 ATGTCTGTGCACCTGGTTCCTGG + Intronic
1041989797 8:63973134-63973156 GTCTCTCAGCAATTGGTTTCTGG + Intergenic
1042437985 8:68790115-68790137 ATGTCCCAGCACCTGGTTGATGG - Intronic
1044326062 8:90859556-90859578 CTGTCTCACCATCTGGATGCAGG + Intronic
1044335854 8:90984775-90984797 CTGCCCCAGCACCTGGTGCCAGG - Intronic
1044391836 8:91661184-91661206 CTGTCTCAGCACGTGCTTCTGGG + Intergenic
1044839720 8:96327384-96327406 CTGTCTCAGGGCCTCTTTTCGGG - Intronic
1045271779 8:100668314-100668336 CTGCCTCAGGCCCTGGTTTTTGG + Intergenic
1045727885 8:105196697-105196719 CAGTCTCAGCACATGCATTCTGG + Intronic
1046464071 8:114579961-114579983 CTGTCTCATTTCCTGATTTCTGG + Intergenic
1048095729 8:131291174-131291196 CTCTCTCAGCACCCTGCTTCTGG + Intergenic
1048545356 8:135381807-135381829 TTTTCTCAGGCCCTGGTTTCCGG - Intergenic
1051099332 9:13502968-13502990 CTGTCTCAGAAGCTGATTCCTGG + Intergenic
1052398578 9:27972251-27972273 CTGCATCAGCAGCTGGGTTCCGG + Intronic
1052965208 9:34335330-34335352 CTGCCTCTGCACCTGGTGTTGGG - Intronic
1053056272 9:34994722-34994744 CTGCATCAGAACCTGGTGTCTGG - Intronic
1053469196 9:38333708-38333730 CATTGTCAGCACCTGGTTGCAGG - Intergenic
1057831409 9:98409897-98409919 TTGTCTCAGAGCCTGTTTTCTGG + Intronic
1059986814 9:119828274-119828296 CTGTCTCAGAATCTGCTTCCTGG + Intergenic
1060177819 9:121510416-121510438 CTGTCTCAACACCTCTTTTTAGG - Intergenic
1060216643 9:121742512-121742534 GCGTCTCAGCACCTGGTCTACGG - Intronic
1061519166 9:131107436-131107458 CTGTCCCAGCCCCTGGGGTCTGG - Intronic
1061584952 9:131559559-131559581 CTGTTTCAGCCCCTGGTGCCAGG - Intergenic
1061837653 9:133340214-133340236 CTGGCTCTGGACCTGGCTTCTGG - Exonic
1062281370 9:135753385-135753407 CTGTCGCAGCAGCTGGTTCCAGG + Intronic
1062410621 9:136422369-136422391 GAGTCTCAGCCCCAGGTTTCCGG + Intronic
1186835200 X:13430630-13430652 CTGCTTCAGGTCCTGGTTTCTGG - Intergenic
1186916423 X:14227283-14227305 CTGTTTCACCACTTGGTTTCAGG - Intergenic
1188574602 X:31631692-31631714 CTTTCTCAGAATCTGCTTTCTGG + Intronic
1189149875 X:38695585-38695607 CTGTCTCAGCACCTGGTAGTTGG + Intergenic
1189234956 X:39479625-39479647 TTGTCTCAGCATCTGCTTTTGGG + Intergenic
1189857536 X:45238382-45238404 CTGTCTCAGCATCTGCTTCCTGG - Intergenic
1191690472 X:63933512-63933534 TTGTCTCAGCACCGGTGTTCGGG + Intergenic
1192213647 X:69143128-69143150 CCATCTCAGCACAAGGTTTCAGG + Intergenic
1195585447 X:106560002-106560024 CTGTTTCAGAATCTGCTTTCAGG + Intergenic
1197062968 X:122203566-122203588 CTGTCTCACCACGTGATCTCTGG + Intergenic
1197868774 X:131046052-131046074 CTGGCTCTGCCCCTGGATTCTGG - Intergenic
1198722389 X:139636665-139636687 CTGTCTCTGGACCTGGCTGCTGG - Intronic
1200970446 Y:9147020-9147042 CTGTCTTTGCAGGTGGTTTCTGG + Intergenic
1201254485 Y:12093393-12093415 CTGTATCAGGCCCTGGTTCCTGG - Intergenic
1202140559 Y:21717301-21717323 CTGTCTTTGCAGGTGGTTTCTGG - Intergenic
1202146306 Y:21786496-21786518 CTGTCTTTGCAGGTGGTTTCTGG + Intergenic