ID: 973658835

View in Genome Browser
Species Human (GRCh38)
Location 4:53081080-53081102
Sequence TAATCATGTGTTGCATTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973658835_973658836 14 Left 973658835 4:53081080-53081102 CCTGTAAATGCAACACATGATTA 0: 1
1: 0
2: 2
3: 11
4: 168
Right 973658836 4:53081117-53081139 CACACGTGAAGCAGAATTTCAGG 0: 1
1: 0
2: 1
3: 10
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973658835 Original CRISPR TAATCATGTGTTGCATTTAC AGG (reversed) Intronic
902421380 1:16283172-16283194 TAATCATTTTTTGCATTCTCTGG - Intronic
904270553 1:29347232-29347254 TTATCATGTGTAGCATTTACAGG - Intergenic
908560175 1:65298349-65298371 GAATGATGTGTTGTTTTTACTGG + Intronic
909184934 1:72475295-72475317 TAATTATGTTTTGCTGTTACTGG - Intergenic
911170680 1:94768229-94768251 TAATCATGTGGTGATTTTCCAGG + Intergenic
911281910 1:95940338-95940360 TAATCTATTGTTGAATTTACAGG - Intergenic
916161435 1:161919864-161919886 TAAAAATGTGTTGCATGTGCTGG - Intronic
918263645 1:182819655-182819677 GAAGCATCTGTTGCAGTTACGGG + Intronic
919296823 1:195711825-195711847 TAATCATGTGTAGGATTTGTAGG - Intergenic
919368244 1:196693468-196693490 TAATCATTTCGGGCATTTACTGG - Intronic
921473752 1:215580012-215580034 TAATAATGCTTTGCTTTTACAGG + Intronic
924217234 1:241835489-241835511 TAATCATCTGTGTCCTTTACTGG - Intergenic
924936380 1:248775249-248775271 TAAGCAAGTGTTGCCTTTATTGG + Intergenic
1062959362 10:1561112-1561134 TAATCATGTTTTGGACATACTGG - Intronic
1064891392 10:20178321-20178343 TAATCATTTGTTGGAAATACAGG + Intronic
1065148081 10:22792925-22792947 TGTTCATCTGTTGCATTTATTGG - Intergenic
1066562623 10:36687187-36687209 TAATCAGGTGTTGCAATCAGTGG - Intergenic
1066593419 10:37021306-37021328 TAATGATGTCTCACATTTACTGG - Intergenic
1067724296 10:48756764-48756786 TAAACTTGCCTTGCATTTACGGG + Intronic
1067943847 10:50678383-50678405 TAATCGTGTGTGGCTTTTGCTGG + Intergenic
1068831234 10:61497601-61497623 AAATCATGTGTTGCAGTCAAAGG - Intergenic
1069982558 10:72262397-72262419 AAATCATGTGCTGGAATTACAGG + Intergenic
1070189251 10:74096440-74096462 TAATTATGTGTTTCTTTTAAAGG - Intronic
1070415538 10:76186015-76186037 TAATCAAATGTTGCATTATCTGG - Intronic
1070454543 10:76599468-76599490 TAAGCAAGTGCTGCATTTGCTGG + Intergenic
1070865335 10:79705252-79705274 TAATCGTGTGTGGCTTTTGCTGG + Intronic
1070879128 10:79843383-79843405 TAATCGTGTGTGGCTTTTGCTGG + Intronic
1071632235 10:87227473-87227495 TAATCGTGTGTGGCTTTTGCTGG + Intronic
1071645688 10:87359692-87359714 TAATCGTGTGTGGCTTTTGCTGG + Intronic
1072880819 10:99226829-99226851 TAATCAAGTGTTGGACTTAGCGG - Intronic
1074283900 10:112079931-112079953 AAATCATGTATTGCAGCTACTGG - Intergenic
1074904098 10:117845587-117845609 TAATAATGGGTAGCACTTACCGG + Intergenic
1078770086 11:14341128-14341150 TCATCAAGTGTTGAATTTTCAGG - Intronic
1080639282 11:34149403-34149425 TGAGCATGGGTTGCATCTACAGG - Intergenic
1081440161 11:43071995-43072017 TCATCATTTGTTAAATTTACTGG + Intergenic
1087564576 11:99837663-99837685 TACTCATGTGTGGCAAGTACTGG - Intronic
1087805084 11:102546749-102546771 TAATCATGATTTGCATTGAGAGG - Intergenic
1093703872 12:22253659-22253681 TGAGCAGGTGTTGCATTGACTGG + Intronic
1096900166 12:54869196-54869218 TAATTATGTCTTTCAGTTACTGG - Intergenic
1097295681 12:57959764-57959786 TTTTGATGTGTTGCATTTCCAGG - Intergenic
1106096936 13:26654845-26654867 TAAGCATGTGTTGCTTTTATAGG + Intronic
1107200897 13:37715674-37715696 TAATCATATGTTGCTTTTTCTGG + Intronic
1108486570 13:50932975-50932997 TAATCATGTGTCCCATTATCTGG + Intronic
1109661337 13:65464563-65464585 TAATCATGTGTTTCTTTCATTGG + Intergenic
1109881110 13:68477736-68477758 TAATCATGCTTTGTATTTGCAGG + Intergenic
1110836136 13:80085610-80085632 TAATCATTTGTGGCTTTCACAGG + Intergenic
1111208727 13:85048764-85048786 TAATGATGTGTTATATATACAGG + Intergenic
1111626244 13:90791358-90791380 GAATCATGTCTTGCTGTTACAGG - Intergenic
1112230263 13:97582968-97582990 TTATCATGTGTTGAATATAAGGG - Intergenic
1112450567 13:99504635-99504657 TTATCTTATGTTGAATTTACTGG + Intronic
1112935445 13:104792307-104792329 TAGTAATGTTTTGTATTTACTGG - Intergenic
1113010545 13:105760626-105760648 TAATTATGTGTAGCTTTTTCAGG + Intergenic
1113512287 13:110865818-110865840 TAAACATGTGTTCCAATTTCAGG + Intergenic
1114181497 14:20371890-20371912 TAGGCATGTGTTGCATCCACAGG - Intronic
1115675289 14:35666657-35666679 TAGTCATTTTTTGCATTTTCTGG - Intronic
1115871767 14:37812158-37812180 TAATCATATGTTAGATTTAAAGG - Intronic
1121157829 14:91703512-91703534 TAATCGTGGCTTGCTTTTACTGG - Intronic
1122638397 14:103141541-103141563 GATACATGTATTGCATTTACTGG - Intergenic
1129491480 15:75930373-75930395 TAACCATGTGTTTCCTTTAAAGG - Intronic
1129591732 15:76921080-76921102 GACCCATGTGTTGCATTGACTGG + Intergenic
1132270739 15:100522027-100522049 TAAGCGTGTGTTCCATTTAAGGG - Intronic
1133411979 16:5576580-5576602 TAATGAGGTTTTGCATTAACGGG + Intergenic
1134397654 16:13880037-13880059 TAATAATGTATTACATTTATAGG + Intergenic
1135044937 16:19147448-19147470 TGATAATATGTTGCATATACTGG + Intronic
1139023813 16:62788170-62788192 AAATCATGTCTTGCATATAGAGG - Intergenic
1139289820 16:65847523-65847545 CAATCTTCTGTTGCATTTAGCGG + Intergenic
1146397235 17:32478439-32478461 TATTCATGTGTGTGATTTACTGG - Intronic
1146559291 17:33854339-33854361 TAAACATGTGTGGCATTTGTTGG + Intronic
1146881338 17:36444062-36444084 TAAAAATGTGTTTCTTTTACTGG - Intergenic
1148926902 17:51094941-51094963 TGAGCATGTTTTACATTTACTGG - Intronic
1157409409 18:47451084-47451106 CAAGCATGTGTTGATTTTACGGG - Intergenic
1159492863 18:69161411-69161433 TAAACATGTATTGTAATTACTGG + Intergenic
1159885895 18:73906396-73906418 TATTCATGTGTTACATTTTCAGG + Intergenic
1160060197 18:75522886-75522908 TAAGCATGTGTTACTTTTACAGG + Intergenic
925237048 2:2288651-2288673 TAATTATGTTTAACATTTACTGG + Intronic
925705447 2:6680699-6680721 TTATCATGTTTTGTAATTACAGG - Intergenic
929890486 2:45914736-45914758 TAATCAAGTGTTGCTTTTATTGG + Intronic
930384060 2:50669982-50670004 AAATTATGTGTTGGAATTACTGG - Intronic
932537142 2:72610791-72610813 TAAGCATGGGCTGCATTTAGCGG + Intronic
932817658 2:74874651-74874673 TAATAATGTGTTTCCTTCACAGG + Intronic
934914951 2:98293887-98293909 GAATCATGTATTGCATTTAGTGG + Intronic
936506456 2:113111749-113111771 TTATCATGTGAGGCATTTAATGG - Intronic
936746955 2:115588588-115588610 GAATCATGTGTTGCACACACAGG + Intronic
936863481 2:117050843-117050865 TTATCATGTAATACATTTACAGG + Intergenic
938044283 2:128102713-128102735 TATTCGTGTGTGGCCTTTACTGG + Intronic
938197853 2:129346829-129346851 TAATCATATGTTTCATTTCTAGG - Intergenic
938552097 2:132391834-132391856 TAATAATGGGTTACATTTTCAGG + Intergenic
941305188 2:163856014-163856036 ACATCATGTTTTGCATTTAGGGG - Intergenic
942229880 2:173850731-173850753 TCATTATGTGCTGTATTTACTGG - Intergenic
942513854 2:176730775-176730797 TCATCATTTTTTCCATTTACAGG + Intergenic
944926698 2:204472680-204472702 TAATCATCTGTTGCAGTTGCGGG - Intergenic
945130402 2:206565297-206565319 TAATCATGTGCTTCCTTTAAGGG - Intronic
946259825 2:218478730-218478752 TGAGCAAGTGATGCATTTACAGG - Intronic
946752742 2:222908947-222908969 GAATCAGGTTTTGAATTTACAGG - Exonic
948657241 2:239484133-239484155 TTATCATGTGTTTCATTCACTGG - Intergenic
1170156048 20:13270457-13270479 TAATCATGTGTCTCCTTAACAGG + Intronic
1173874389 20:46360892-46360914 TAATCATATGTTTCATTTTAGGG + Intronic
1179218711 21:39388425-39388447 GAATCATGCATTGCATTTCCCGG + Intronic
1179349497 21:40594769-40594791 CAATCATTTGTTCCATTTGCTGG - Intronic
1180146037 21:45919543-45919565 GATTCATGTGTTGCCTTTAATGG - Intronic
949837251 3:8282352-8282374 TAATCATGAGGTGCATTTTAAGG + Intergenic
949940850 3:9153020-9153042 TGAGCATGTGGGGCATTTACTGG - Intronic
950218405 3:11176213-11176235 TAATGAGTTTTTGCATTTACAGG + Intronic
956585218 3:70856908-70856930 GAATCATGTGTTACATATAGAGG - Intergenic
958049658 3:88329359-88329381 TAAAAATGTGCTGCATGTACAGG + Intergenic
960794989 3:121475962-121475984 TATTCATGTGTTGAATTCAGTGG - Intronic
961974720 3:131011298-131011320 TAATCATGTTCTGTATTTAGTGG - Intronic
963284817 3:143424058-143424080 AAATCATGTGTTACATTTACTGG - Intronic
963489779 3:145985175-145985197 TAACCATCTGTTGTATTCACGGG + Intergenic
964353422 3:155825721-155825743 TAAACATATGATGCATTAACTGG + Exonic
965473394 3:169123416-169123438 TAATCATGTTTTTCTTTTAGGGG - Intronic
965889505 3:173493705-173493727 TAATCCAGTTTTCCATTTACTGG - Intronic
966224763 3:177586113-177586135 TAAACATGTGTTGAATTAAGTGG - Intergenic
966801172 3:183765558-183765580 TAATCATGGATTCCATTTCCTGG - Intronic
971254657 4:25003274-25003296 TAATCAGGGATTGCATTTATTGG - Exonic
972218592 4:36926018-36926040 TAATCAGCTGTTCCATTTGCTGG + Intergenic
973151702 4:46896400-46896422 TAATTATTTATTGCATTTATTGG - Intronic
973658835 4:53081080-53081102 TAATCATGTGTTGCATTTACAGG - Intronic
975264767 4:72350438-72350460 TCATTATGGGTTGCATTTTCTGG + Intronic
975800337 4:78054932-78054954 TAATCATATGCTGTATTTATTGG - Intergenic
976012985 4:80514819-80514841 TAATTATGTGTTGAAATTTCTGG + Intronic
978320826 4:107493616-107493638 TGATCATGTTTTGAATTTATTGG - Intergenic
980107232 4:128599594-128599616 TAACCATGTGTTACATTGGCTGG + Intergenic
981566870 4:146111108-146111130 TAATGATTTGTTGAATTTAGAGG + Intergenic
981866091 4:149420766-149420788 TAATTATGTTTTGAATTTAATGG + Intergenic
982540064 4:156657650-156657672 TAACCATGTCTAGCATTTAATGG + Intergenic
983049693 4:163031570-163031592 TAATAATATGTTGTATTTAAAGG + Intergenic
983697986 4:170555834-170555856 AGATCATATGTTGCATTTAGTGG + Intergenic
984299882 4:177901466-177901488 TTATCATATGTAGCTTTTACGGG + Intronic
987022112 5:13885312-13885334 GAATCATCTGTTGCAATTAAAGG + Intronic
988149213 5:27354147-27354169 TGATCACGTGTGGCATTTAAAGG + Intergenic
988937020 5:36094436-36094458 TTATCTTATGTTGAATTTACAGG - Intergenic
988966697 5:36425780-36425802 TAATCATGTGTTGGTCTTTCTGG + Intergenic
988975937 5:36515803-36515825 TAAACATGTGTGGATTTTACTGG - Intergenic
991325337 5:65425451-65425473 GAATGATTTCTTGCATTTACAGG - Intronic
992552235 5:77869689-77869711 TTATCCTGTTTTGCATTGACTGG - Intergenic
992672392 5:79073361-79073383 TATTCCTGTGTAGCATTTATTGG + Intronic
993069275 5:83138647-83138669 TAATCCTTTGTTGAATTTTCTGG - Intronic
995984882 5:118158886-118158908 TGAACATGTGTTGCATTGAAAGG + Intergenic
999299955 5:150485316-150485338 TGATTATGTGGTTCATTTACTGG - Intergenic
1000954554 5:167527446-167527468 TCCTCATGTGTTGCATTCTCTGG + Intronic
1005347871 6:24908315-24908337 TAATCATTTATTGCATTCAATGG - Intronic
1008928544 6:56912804-56912826 AAATGATGTGTGCCATTTACAGG - Intronic
1009309404 6:62131718-62131740 TATACATGTGTTGCATCAACAGG - Intronic
1009358666 6:62787135-62787157 TATTCATGTGTTGGATATACTGG - Intergenic
1010626298 6:78139478-78139500 CAATCATGTGTTAAATTGACTGG - Intergenic
1013917860 6:115363773-115363795 GAAACATGTTTTTCATTTACTGG - Intergenic
1015185533 6:130411561-130411583 AAATCATGTGTTGAATTTAGTGG + Intronic
1018657939 6:166057883-166057905 TAATCACCTGCTGTATTTACAGG - Intergenic
1020492982 7:8811879-8811901 TACACATGTCTTCCATTTACAGG - Intergenic
1023458868 7:40371468-40371490 AAAGCATGTGTTGCCTTAACCGG - Intronic
1023738741 7:43258513-43258535 TAATTATATATTTCATTTACAGG + Intronic
1024103315 7:46056371-46056393 TAATCATGTGTTGGTCTTTCTGG - Intergenic
1025111470 7:56220305-56220327 TAACCAGGTGATGCATTTGCTGG + Intergenic
1026243328 7:68596357-68596379 TAATCAACTGTAGCATTCACAGG - Intergenic
1026306420 7:69146145-69146167 TAACCAGGTGATGCATTTGCTGG - Intergenic
1027449601 7:78315827-78315849 TAAACATGTTCTTCATTTACAGG + Intronic
1030847062 7:114431956-114431978 TAATTCTGTCTTGCATTAACTGG + Intronic
1031120290 7:117714380-117714402 TACGTATGTGTTGCATTTGCTGG - Intronic
1031429989 7:121656406-121656428 AAATCATGAGTTACATTAACCGG - Intergenic
1031950172 7:127883723-127883745 GAATCAGGTGTTGCAGTTAGAGG + Intronic
1035374455 7:158398274-158398296 TAATAATATCTAGCATTTACTGG - Intronic
1035838088 8:2778128-2778150 TAATCAAGTTTTGCATGTAGCGG - Intergenic
1038941869 8:32314125-32314147 TAAGCATGTGATGAATTTGCTGG - Intronic
1038993824 8:32899797-32899819 TATTCATGTTTTCCATGTACAGG - Intergenic
1039337380 8:36606970-36606992 TAATAATGTATCGTATTTACAGG - Intergenic
1040638680 8:49305366-49305388 TAATGATGTGTTACATTGACTGG - Intergenic
1041477267 8:58280233-58280255 AAATCATCTTTTGCATTTAAAGG + Intergenic
1042815318 8:72872182-72872204 TAAGCATGTGGTGCATTTTATGG + Intronic
1042845302 8:73163968-73163990 AGATCATGTTTTGCATTCACTGG - Intergenic
1045074434 8:98547611-98547633 TAATAGTCTGTTGAATTTACTGG + Intronic
1045578268 8:103449237-103449259 CAATTAAGGGTTGCATTTACTGG - Intergenic
1046716214 8:117570480-117570502 TATTCCTGTGATGCTTTTACTGG - Intergenic
1052410982 9:28120728-28120750 TAATTATGTGTTGCTTCAACCGG - Intronic
1055090182 9:72356456-72356478 TTATCCTGCGTTGCATCTACAGG - Intronic
1061749312 9:132765327-132765349 TAATCATGTGGTGCATCTCAGGG + Intronic
1189983826 X:46536066-46536088 TAACCAGCAGTTGCATTTACAGG + Intronic
1191991623 X:67043122-67043144 TAATCATGTGTTTCAGTTTATGG + Intergenic
1193202662 X:78710275-78710297 TAATAATGTGTTGAATTGATGGG + Intergenic
1196400979 X:115316184-115316206 TCATCATTTGTTACATTTCCCGG - Intergenic
1197231558 X:124009530-124009552 GAATCAAGTGTTGCATTTTAGGG + Intronic
1199505254 X:148554182-148554204 TAAACATTTGTTGCAATGACTGG + Intronic