ID: 973661523

View in Genome Browser
Species Human (GRCh38)
Location 4:53112063-53112085
Sequence CTGTGGATACAGAGCTAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973661523 Original CRISPR CTGTGGATACAGAGCTAGGC CGG Intronic
900365915 1:2311937-2311959 CTGAGGATGCAGAGGTAGGGTGG - Intergenic
900380609 1:2382085-2382107 CTCTGGGGACAGGGCTAGGCTGG + Intronic
902373102 1:16017512-16017534 CTGTGGTTACAGAGCATGGGTGG + Intronic
904431118 1:30465145-30465167 ATATGGACACAGAGCTGGGCAGG + Intergenic
905171019 1:36109597-36109619 CTTTTGAGACAGAGCCAGGCTGG + Intronic
905508916 1:38503030-38503052 CTGTGGGTAAAGAGCTTGCCTGG - Intergenic
906000662 1:42421615-42421637 CTGTGGAGGCAGGACTAGGCGGG + Exonic
906662137 1:47590573-47590595 CTGAGGATAGAGAGGGAGGCTGG + Intergenic
908755650 1:67466868-67466890 CTGTGGATACAGAGGTGGACAGG + Intergenic
910273658 1:85424519-85424541 TTGTAGATACAGAGATAGTCTGG + Intronic
913093099 1:115493079-115493101 CAGTGGCTACAGTGCTGGGCAGG - Intergenic
913271438 1:117097566-117097588 CTATAGATACAGATCTAAGCAGG + Intronic
913532594 1:119743292-119743314 CTGAGGATCCACAGCTGGGCAGG - Intronic
919792798 1:201302949-201302971 CTGAGGCTGCACAGCTAGGCAGG + Intronic
920030420 1:203034394-203034416 CTGGGGGTACAAAGCTAGACAGG + Intronic
920046564 1:203136517-203136539 CTGGGGATACACAGATGGGCAGG + Intronic
924211360 1:241770492-241770514 CTGTGGATACTGAGCCACTCAGG - Intronic
924445622 1:244127784-244127806 CTGGGGATACAGAGGAAGGTGGG - Intergenic
1063510707 10:6642743-6642765 TCCTGGATACAGAGCAAGGCAGG - Intergenic
1063622883 10:7665764-7665786 CTTTGGATGCAGAGACAGGCTGG - Intronic
1068026824 10:51656449-51656471 ATGTGGAAACAGAGCTAGGTAGG + Intronic
1068046584 10:51893811-51893833 CTGTAGTTACACAGCTAGGAAGG + Intronic
1068401277 10:56530854-56530876 CTCTGGATAATAAGCTAGGCAGG - Intergenic
1068637392 10:59362666-59362688 CTGCGGGGACAGAGCTGGGCGGG + Intronic
1069395876 10:67987190-67987212 CTGAAGTTACTGAGCTAGGCAGG + Intronic
1069767436 10:70873654-70873676 CTATGGATACTTAGCCAGGCAGG - Intronic
1070193472 10:74133682-74133704 TTGTTGAGACAGAGCCAGGCTGG + Intronic
1070369756 10:75771118-75771140 CAGTGAATCCAGAGCTAGGCAGG - Intronic
1072913107 10:99521049-99521071 GTGTGTCTACAGAGCTAGGGCGG - Intergenic
1075242089 10:120788221-120788243 CTATGGATGCAGAGCTGGCCTGG + Intergenic
1075738451 10:124678717-124678739 CTGTGGATACAGATGAGGGCAGG + Intronic
1076669666 10:132112561-132112583 CTGTGAACACAGAGCCAAGCGGG - Intronic
1076729508 10:132431356-132431378 TTGGGGCCACAGAGCTAGGCAGG - Intergenic
1077853628 11:6099861-6099883 CTGTGGATACAGAGCAAGGTGGG + Intergenic
1078136651 11:8657543-8657565 CTGTGGCTACAGAGGTAATCAGG - Intronic
1078508038 11:11966516-11966538 CTGGGGATGCAGAGCTGGGGAGG + Intronic
1084415727 11:69032013-69032035 CTGTGGATAGAGCTCTAAGCAGG + Intergenic
1089223006 11:116890857-116890879 CTGGGGCTGAAGAGCTAGGCAGG + Intronic
1089497223 11:118913896-118913918 CTGTGAAACCAGAGCTAGGTTGG - Intronic
1091063581 11:132488013-132488035 CTGTGGCTGCAAAGGTAGGCTGG - Intronic
1091931721 12:4401827-4401849 CTCTGGATGCTGAGCCAGGCAGG + Intergenic
1092418216 12:8308380-8308402 CTGGGGATCCTGAGCTAGGGAGG + Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093006243 12:14054340-14054362 CTGAGGTTCCAGAGCTATGCTGG + Intergenic
1101065911 12:101020512-101020534 ATGATGATACAGAGATAGGCTGG + Intronic
1102821169 12:115910350-115910372 CTGTGGAAAAAGAGCCTGGCTGG - Intergenic
1105648267 13:22344819-22344841 ATGTGGTTACAGTGCTATGCTGG - Intergenic
1108530742 13:51324988-51325010 CTGAGGCTACGGAGCTGGGCTGG - Intergenic
1111919670 13:94396849-94396871 CTGGGGCTCCAGAGCTAGACTGG + Intronic
1111990055 13:95107628-95107650 CTGTAGATAAAGATATAGGCTGG + Intronic
1112763707 13:102718610-102718632 CTGTGGAAACAGAGCCAGGTTGG + Intergenic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113579787 13:111420872-111420894 CTGAGAAGAGAGAGCTAGGCAGG - Intergenic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1121978474 14:98429925-98429947 ATGTGAATACAGAGCTGGGCAGG + Intergenic
1122122288 14:99561009-99561031 CTGTGGAGACTGAGGGAGGCAGG - Intronic
1122847621 14:104509337-104509359 CTTTGGATAAATAGCTAGGAGGG - Intronic
1122915377 14:104855940-104855962 ATGTGGACACAGTGCTGGGCAGG + Intergenic
1122989244 14:105229248-105229270 CTGAGGATGCGGAGCCAGGCTGG + Intronic
1123024476 14:105418313-105418335 CTGAGGAGACAGAGGTAGGCTGG + Intronic
1125580646 15:40782999-40783021 TAGTGAAAACAGAGCTAGGCAGG - Intronic
1125592996 15:40866423-40866445 CTGTGTGTATACAGCTAGGCTGG - Intergenic
1127572615 15:60259055-60259077 CATTGGACACAGACCTAGGCTGG + Intergenic
1129383956 15:75185492-75185514 CTGAGGTCACAGAGTTAGGCTGG + Intergenic
1133409842 16:5559037-5559059 ACGTGGGTACAGAGCTGGGCTGG + Intergenic
1134043433 16:11084829-11084851 CTGTGGAGAAAGAGGTAGCCGGG + Intronic
1135471860 16:22738180-22738202 CTGTGGATACAGAGAGGGGCTGG + Intergenic
1136614899 16:31392803-31392825 CTGTGGTCCCAGAGCTTGGCAGG - Intergenic
1137431183 16:48419056-48419078 CTGAGGATACAAAGATAAGCAGG + Intronic
1137520388 16:49190198-49190220 CTGTGGATGAAGAGTTAGGCAGG - Intergenic
1138206969 16:55132516-55132538 CTGTGGGTAAAGAACAAGGCTGG - Intergenic
1139592379 16:67940479-67940501 CTGTGGATATGGAGCAAGGTGGG + Intronic
1139646862 16:68338004-68338026 CTGAGGCTAGAGAGCTGGGCAGG + Intronic
1139771364 16:69280250-69280272 CTGTGTATAAAGAGGTAGACAGG - Intronic
1140417853 16:74789290-74789312 CTGGGGAGACTGAGCTGGGCAGG - Intergenic
1140877142 16:79163172-79163194 CTGTGTATACAAACCTAGGAGGG + Intronic
1142612161 17:1115020-1115042 CTGAGGCCACAGAGGTAGGCAGG + Intronic
1143017086 17:3896643-3896665 CTGTTCAGACAGAGCCAGGCAGG + Exonic
1144356410 17:14451101-14451123 CTGTAGATAGAGAGCAGGGCAGG + Intergenic
1147745506 17:42692040-42692062 CTGGGGAGACAGGGGTAGGCTGG + Intronic
1148766037 17:50038684-50038706 CTGTGGATGCAGGGCTGCGCTGG + Intergenic
1156147288 18:34199510-34199532 CTGTGGATTCAGAGTTAAGTTGG - Intronic
1156650487 18:39220412-39220434 CTGTGGATCCAGGTCTAGGAGGG + Intergenic
1158007206 18:52686323-52686345 CTGTTGGAACAGAGGTAGGCTGG - Intronic
1159941421 18:74411850-74411872 CTGTGGACACAGACCTCGGGTGG - Intergenic
1160503931 18:79416935-79416957 CTGTGGGTACTGGGCTGGGCTGG + Intronic
1161595679 19:5149979-5150001 TGGTGGACACAGAGCCAGGCAGG - Intronic
1162260425 19:9529149-9529171 ATGTGAATACTGAGGTAGGCTGG + Exonic
1162931234 19:13958979-13959001 CTGGGGACACTGAGCGAGGCTGG + Intronic
1163476049 19:17526851-17526873 CTGGGGAGACAGAGCTGGACAGG - Intronic
1163663007 19:18589589-18589611 CGGTGGAAGCAGAGCTGGGCGGG + Exonic
1164566530 19:29329741-29329763 CTGGGGAAACAGAGCCAAGCTGG + Intergenic
1165797407 19:38526970-38526992 CTGGGGAGACAGAGCCAGGCTGG - Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1167271862 19:48510593-48510615 CTGTGGGCACAGGGCTGGGCTGG + Intronic
1167688239 19:50969516-50969538 CTGGGGACACAGAGGTCGGCAGG - Intronic
925036677 2:692457-692479 CTGTGGAAACAGAGAAAGACCGG + Intergenic
927558226 2:24050366-24050388 CTGTGGGGACAGACCCAGGCTGG + Intronic
930847262 2:55919214-55919236 ATGAGGTTACAGAGGTAGGCAGG + Intronic
931840773 2:66145739-66145761 CTGTGGTTTCACAGCTAGGAGGG + Intergenic
938229440 2:129645881-129645903 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229445 2:129645911-129645933 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229450 2:129645941-129645963 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229455 2:129645971-129645993 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229470 2:129646061-129646083 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229475 2:129646091-129646113 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229480 2:129646121-129646143 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229485 2:129646151-129646173 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229490 2:129646181-129646203 CTGTGGACACAGAGCCATGCTGG - Intergenic
942678110 2:178450228-178450250 CTGTGTATACAGACCTGTGCAGG + Exonic
942943272 2:181644946-181644968 ATGAGGATGCAGAGATAGGCAGG + Intronic
942996202 2:182263570-182263592 CTGTGAATTCAGAGCTAAGAGGG - Intronic
944683418 2:202097234-202097256 CTGTGGAAACAGAGCTGCACTGG - Intronic
946016118 2:216605516-216605538 CTGTGGCTATTGAGCCAGGCAGG + Intergenic
947945609 2:234099322-234099344 CTGTGAAGACAGAGCTACACAGG + Intergenic
1169200151 20:3705363-3705385 CTGAGAAAACAGAGCCAGGCAGG + Intronic
1169603630 20:7290753-7290775 TTGTAGATACAGAGATAGGTAGG - Intergenic
1170622676 20:18008587-18008609 CTGGGGTTACAGAGATGGGCTGG - Intronic
1172447272 20:34999768-34999790 CTGTGGATACAGAGCAGGCAGGG - Intronic
1173247824 20:41348459-41348481 CAGTGGCTACAGGGCCAGGCTGG + Intronic
1173317886 20:41961395-41961417 CTGTGGAGACACAGGGAGGCAGG - Intergenic
1174521992 20:51138817-51138839 CTGTGGCTAGAGAGATGGGCAGG - Intergenic
1175039198 20:56029863-56029885 CTGTGGATACAGAGAAAAGATGG + Intergenic
1175675134 20:60939747-60939769 CTGCGGGTACAGAGCTTGTCAGG - Intergenic
1179191017 21:39121659-39121681 CTGGGGGTGCAGAGCCAGGCTGG - Intergenic
1181296716 22:21846024-21846046 ATGGGGAAACAGACCTAGGCAGG + Intronic
1181296783 22:21846694-21846716 ATGGGGAAACAGACCTAGGCAGG - Intronic
1181336817 22:22141435-22141457 ATGGGGAAACAGAACTAGGCAGG - Intergenic
951630463 3:24714573-24714595 CTGTGGAAACAGCACTAGACAGG - Intergenic
952131569 3:30370247-30370269 CAGTGGTTGCAGAGCTAGACTGG + Intergenic
952505317 3:34001987-34002009 CAGTGAACACAGAACTAGGCTGG - Intergenic
953563364 3:44011947-44011969 CCCAGGATACAGAGCTAGGAGGG - Intergenic
954349170 3:50028349-50028371 CTGTGAATGCAGAGCAATGCAGG + Intronic
961152377 3:124650069-124650091 GTGTGGATACACAGTGAGGCTGG - Intronic
962274060 3:133999017-133999039 CAATGGAGTCAGAGCTAGGCAGG - Intronic
965258554 3:166448759-166448781 ATGTGGAAACACAGCCAGGCTGG + Intergenic
965629178 3:170713344-170713366 CTGTGGATGAAGAGCCAGCCTGG + Intronic
965822744 3:172701120-172701142 CTCAGGAGACAGAGCTGGGCTGG - Intronic
967905874 3:194499560-194499582 CTGAGGATGCAGAACTAGGGAGG - Intergenic
968187660 3:196644199-196644221 CTGTGGAGACAAAGCAAGACGGG - Intronic
968500745 4:948725-948747 ATGAGGACACAGAGCCAGGCAGG - Intronic
969323033 4:6424541-6424563 CTGTGGATACACAGGGAGGCCGG + Intronic
972308026 4:37851084-37851106 CTGTGGACACAGAGCTTAGTTGG + Intronic
973661523 4:53112063-53112085 CTGTGGATACAGAGCTAGGCCGG + Intronic
973829909 4:54748168-54748190 CTGTGGAGGAAGAGCTGGGCAGG - Intergenic
974136043 4:57819853-57819875 CTTTGGATTCAGACATAGGCTGG - Intergenic
975791973 4:77962930-77962952 CTCTGGAAGTAGAGCTAGGCAGG + Intergenic
976035276 4:80810973-80810995 CTGTGGAGACAGACATATGCAGG - Intronic
979723104 4:123926296-123926318 CTGTGGTGACTGAGCAAGGCGGG - Intergenic
979769196 4:124501632-124501654 CTGTGGCCACAGACCTAGGTAGG - Intergenic
980017488 4:127668640-127668662 CTGTGGTTACATAGCTACACAGG - Intronic
985546686 5:513468-513490 CTGCGGATGCAGAGTTGGGCGGG + Intronic
990356924 5:54976794-54976816 GTGTGGAAAAAGAGCTAGACTGG - Intergenic
990389861 5:55307789-55307811 CAGTGGATAAAGAGCGAGGGCGG - Exonic
992201640 5:74390143-74390165 ATGTGGCCACAGAGCTGGGCTGG + Intergenic
994925218 5:106108570-106108592 CAGTGGATACAGAGAGATGCAGG - Intergenic
997613197 5:135229449-135229471 CTTGGGATACAGAGCCAAGCAGG - Intronic
998376372 5:141693540-141693562 CAGATGACACAGAGCTAGGCTGG - Intergenic
999250602 5:150180152-150180174 CTGTGGATTCAGAGCCATGTTGG + Intronic
1001924637 5:175627290-175627312 CTGTGGGCACAGAGCAAGTCGGG - Intergenic
1005380423 6:25228731-25228753 CTGAGCCCACAGAGCTAGGCGGG - Intergenic
1005953273 6:30646933-30646955 CTGTGAATACAGCGCTTGGGGGG + Intergenic
1006749285 6:36366528-36366550 CTGTGGGTACAGAGTCTGGCTGG + Exonic
1007256392 6:40532209-40532231 CTGTGGAGACAGTTTTAGGCAGG + Intronic
1007540823 6:42642584-42642606 CTGAGGAGACAGGGCTAGGCTGG - Intronic
1008664944 6:53706828-53706850 CTCTGGGTGCAGAGCAAGGCAGG + Intergenic
1011329019 6:86183561-86183583 CTGTGGATACAGAGCCTTTCTGG + Intergenic
1015373790 6:132487154-132487176 TTCTTGATATAGAGCTAGGCAGG + Intronic
1018027340 6:159816465-159816487 CTGTGGATGGTGAGCTAGGATGG + Intronic
1021640211 7:22729144-22729166 CTGTGGAGAATGAGCTGGGCAGG - Intronic
1022472155 7:30688629-30688651 CTGTGGATGCAGACCTGGGAAGG + Intronic
1022891676 7:34707466-34707488 CTGTGGAAACTGAGTGAGGCAGG - Intronic
1023071735 7:36441554-36441576 CAGTGGAGGCAGAGCTAGCCCGG - Intronic
1024167621 7:46750365-46750387 CTGTGGATCTGGAGCTAGCCTGG + Intronic
1032001962 7:128271519-128271541 CTGTGGCCTCAGAGCTCGGCTGG - Intergenic
1032233123 7:130093807-130093829 CTGTGCATACAGACTTATGCTGG + Intronic
1034536944 7:151731316-151731338 CTCTGGCTGCAGAGCCAGGCAGG - Intronic
1035109133 7:156465477-156465499 CTGTGGAGAGAGACCGAGGCAGG - Intergenic
1035650379 8:1259646-1259668 CTGTGGAAGCAGAGCTGGGCTGG - Intergenic
1036370024 8:8154726-8154748 CTGAGGAGACTGAGCTAGGGAGG - Intergenic
1036880868 8:12510904-12510926 CTGAGGAGACTGAGCTAGGGAGG + Intergenic
1038316622 8:26489868-26489890 CTGTGAAGACACAGCAAGGCGGG + Intronic
1040457208 8:47610656-47610678 CTGTGGAGAAAGAGCTGAGCTGG - Intronic
1040973444 8:53163444-53163466 CTGAGGATACAGAGCCAGGACGG - Intergenic
1042252842 8:66774203-66774225 TTAAGGCTACAGAGCTAGGCTGG + Intronic
1044924132 8:97195449-97195471 CTCTGGACACAGAGTGAGGCTGG + Intergenic
1045085574 8:98680198-98680220 CTGTGCAGACAGAGCTAAGAGGG + Intronic
1047753214 8:127898488-127898510 CTTTGGAGACCAAGCTAGGCAGG + Intergenic
1049038616 8:140096006-140096028 CTCTTGATACAGAGCCAAGCAGG - Intronic
1049250667 8:141587254-141587276 CTGGGGACACAGAGGTTGGCAGG + Intergenic
1051189865 9:14500052-14500074 ATGTGGCTAAAGAGGTAGGCAGG - Intergenic
1053118033 9:35522592-35522614 CTGTGTATAAGGAGCTATGCTGG - Intronic
1054971952 9:71098390-71098412 GTGTGGAAACAGAGCAAGCCAGG + Intronic
1057385808 9:94605172-94605194 CAGTGGATACAGGGCTTGGCTGG - Intronic
1059561628 9:115340410-115340432 CAGAGGACACAGAGCCAGGCAGG + Intronic
1061198874 9:129124763-129124785 CTGTGGCTAGAGAGCTGGGTAGG - Intronic
1061341907 9:129989139-129989161 GGGTGGTTACTGAGCTAGGCTGG - Intronic
1061419004 9:130463279-130463301 CTCTGGGGACAGAGCTGGGCTGG + Intronic
1061731207 9:132615505-132615527 CAGTGGGGTCAGAGCTAGGCTGG - Intronic
1062524825 9:136973936-136973958 CTTTGGAGCCAGGGCTAGGCTGG - Intergenic
1062627239 9:137448841-137448863 CAGTGTAGACAGAGCCAGGCTGG + Exonic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1188000528 X:24976338-24976360 CTGTGCATACAGAGGTGGGCAGG - Intronic
1192510120 X:71716512-71716534 CTGGGGATACTGAGATAGCCCGG + Intronic
1192516577 X:71765041-71765063 CTGGGGATACTGAGATAGCCCGG - Intronic
1194809596 X:98374515-98374537 CAGTGGCTAGAGAGATAGGCAGG - Intergenic
1195343825 X:103928769-103928791 CGGAGGATACAGAACTAGGCAGG - Intronic
1195363160 X:104104562-104104584 CAGAGGATACAGAACTAGGCAGG + Exonic
1202246291 Y:22823627-22823649 CTGTGGACAAAAAACTAGGCAGG - Intergenic
1202251434 Y:22877612-22877634 ATGTGGACAAAAAGCTAGGCAGG + Intergenic
1202399279 Y:24457375-24457397 CTGTGGACAAAAAACTAGGCAGG - Intergenic
1202404422 Y:24511361-24511383 ATGTGGACAAAAAGCTAGGCAGG + Intergenic
1202466357 Y:25158721-25158743 ATGTGGACAAAAAGCTAGGCAGG - Intergenic
1202471501 Y:25212711-25212733 CTGTGGACAAAAAACTAGGCAGG + Intergenic