ID: 973661724

View in Genome Browser
Species Human (GRCh38)
Location 4:53114352-53114374
Sequence GGGGGCGAAAAGATGGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973661724_973661731 2 Left 973661724 4:53114352-53114374 CCATACTCCATCTTTTCGCCCCC 0: 1
1: 0
2: 1
3: 2
4: 156
Right 973661731 4:53114377-53114399 TGAATGCAAGTAGAAAACCTGGG No data
973661724_973661730 1 Left 973661724 4:53114352-53114374 CCATACTCCATCTTTTCGCCCCC 0: 1
1: 0
2: 1
3: 2
4: 156
Right 973661730 4:53114376-53114398 CTGAATGCAAGTAGAAAACCTGG 0: 1
1: 0
2: 2
3: 35
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973661724 Original CRISPR GGGGGCGAAAAGATGGAGTA TGG (reversed) Intronic
902534358 1:17110779-17110801 GGGGGCAAATGGATGGAGTTAGG - Intronic
902547233 1:17197745-17197767 GGAGGGGAAAAGGTGGAGTTAGG + Intergenic
904762783 1:32817617-32817639 GGGGGCGATAAAATGGCGCAGGG + Exonic
905259551 1:36707872-36707894 GGGGAAGAGAAGATGGAGGAAGG - Intergenic
906951209 1:50335649-50335671 GGGGAGAAAAAGATGGAGGAGGG + Intergenic
908544193 1:65148139-65148161 GGGGGCGAGGAGGTGGAGGAGGG + Intronic
908833107 1:68200918-68200940 AGGGTCGAAAAGAGGGAGAAAGG + Intronic
909483079 1:76146501-76146523 GAGGGAGAAAAGAAGGAGGAGGG - Intronic
912374837 1:109201589-109201611 GAGGGCGGAAAGAGGGAGGAGGG + Intronic
912643075 1:111365957-111365979 GGGGAAGAAAAGATGCAGTTTGG + Intergenic
912701068 1:111878531-111878553 GGGGAGGAAAAGAAGGGGTAAGG + Intronic
915304229 1:154968770-154968792 GGGGGCGACAAGGAGGAGAAAGG - Exonic
916213233 1:162374977-162374999 GGTGGCGAAAAGAGGGACTGTGG - Intronic
917069622 1:171136102-171136124 GGGGGCTAAAAGGTGGAACATGG - Intergenic
917693991 1:177500256-177500278 GCGGGTGAAAATATGGAGAAAGG + Intergenic
919956297 1:202420286-202420308 GGGGAGGAGAAGAGGGAGTATGG + Intronic
922445094 1:225690386-225690408 GAGTGCCAAAAGATGGAGAAGGG - Intergenic
922854180 1:228760149-228760171 GTGGGCAAAGAGATGGAGTTAGG + Intergenic
922885767 1:229019356-229019378 GGGGGAGAGAAGCTGGATTATGG + Intergenic
1064803767 10:19108088-19108110 GAGGGAGAAAAGATGAAGAAAGG - Intronic
1066705259 10:38170897-38170919 GAGGGAGAAAAGAAGGAGGAAGG - Intergenic
1068729713 10:60343321-60343343 GAGGGAGAAAAGGGGGAGTAGGG + Intronic
1071764909 10:88652582-88652604 GGAGGGGAAAAGATAGAGAATGG + Intergenic
1074377231 10:112950574-112950596 GGAGGGGAAAAGAGGGAGGAGGG - Exonic
1077881891 11:6357347-6357369 GGTGGAGAAAAGATTGAGAATGG + Intergenic
1079865518 11:25729080-25729102 GGTGGCAAAATGATGGAGGAAGG + Intergenic
1080147622 11:29006115-29006137 GGGTGAGAAAAGTTGGAGTTTGG + Intergenic
1089561591 11:119345931-119345953 GGAGGCGAGAAGATGGAGGGTGG + Intronic
1089621257 11:119723704-119723726 GGGGGCTAGGAGATGGAGAAAGG - Intronic
1089752787 11:120663193-120663215 GGGGGTGCAAAGATGGGGTGGGG - Intronic
1091041951 11:132289547-132289569 GGGGGTGAGGGGATGGAGTATGG - Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093052806 12:14522148-14522170 GAGGGAGAAGAGATGGAGAAGGG + Intronic
1096104122 12:48986732-48986754 GGGGCCGACAAGGTGGGGTAAGG - Intergenic
1098221837 12:68278358-68278380 GGGGGAAAAAAGATGGTTTAGGG + Intronic
1101000323 12:100351517-100351539 GGGGGTGAGAAGGAGGAGTATGG + Intergenic
1102059565 12:109922540-109922562 AGGTGTGAAAAGATAGAGTAAGG + Intronic
1104310933 12:127653797-127653819 GAGGGCACAAAGATGGAGAAAGG + Intergenic
1105408479 13:20150848-20150870 AGGGCCCAAAGGATGGAGTAGGG + Intronic
1106989898 13:35406331-35406353 TGGGGGGAAAAGATGGTGTTTGG + Intronic
1108500251 13:51063865-51063887 AGGCGGGACAAGATGGAGTAAGG - Intergenic
1112743956 13:102506762-102506784 GGCAGAGAAAAGATTGAGTATGG + Intergenic
1115849860 14:37583088-37583110 GGGGGTGAAGAGGGGGAGTAAGG + Intergenic
1116321333 14:43468118-43468140 GGGGGCATAAAGAGGAAGTATGG - Intergenic
1117671979 14:58117563-58117585 TGGGGCACAAAGATGGATTAAGG - Intronic
1117863427 14:60118516-60118538 AAGGGTGAAAAGAGGGAGTAAGG - Exonic
1120618820 14:86737910-86737932 GAGGAAGGAAAGATGGAGTAAGG - Intergenic
1121308819 14:92923832-92923854 GCGGGGGAAGAGATGGAGGAAGG - Intronic
1122254239 14:100464940-100464962 AGGGGAGAGGAGATGGAGTAGGG - Intronic
1123173635 14:106397959-106397981 GTGAGCGAAAAGAGGGAGGACGG - Intergenic
1126181949 15:45793954-45793976 GGGGGCAAAGAGATGGAGATGGG + Intergenic
1126362800 15:47863577-47863599 GGGGAGGAAAAGAGGGAGGAAGG + Intergenic
1126676111 15:51160414-51160436 GGGGCTGAGAAGATGGATTAGGG + Intergenic
1131365231 15:91833380-91833402 GGGAACGAAAAGGTGAAGTAAGG + Intergenic
1131849182 15:96519767-96519789 GAGGGAGAAGAGATGGAGAATGG + Intergenic
1133519714 16:6545276-6545298 GAGGGGGAAAAGATGGGGAAAGG - Intronic
1134619103 16:15674211-15674233 GGGAGGGAGAAGATGGAGGAAGG - Intronic
1135707485 16:24687286-24687308 GGTGGAGATAAGATGGAGAAAGG - Intergenic
1136139890 16:28281808-28281830 GAGGGCGAGAAGCTGGAGAAGGG + Intergenic
1137860338 16:51840422-51840444 GGGGGCCAAGAGGTGGAGAAAGG + Intergenic
1138567875 16:57846597-57846619 GGGGGAGAAAGGAGGGAGGATGG - Intronic
1142013646 16:87731459-87731481 GGGGGAAAAAAGATGGAAAAAGG + Intronic
1203071072 16_KI270728v1_random:1074366-1074388 GGGGGCGAAATAATGGAGATGGG + Intergenic
1142971517 17:3615030-3615052 GGAGGAGAAAAGAGGGAGCAGGG + Intronic
1144408254 17:14973907-14973929 GGCAGGGAGAAGATGGAGTAGGG - Intergenic
1147527065 17:41235797-41235819 GGGAGGGAAAAGAGGGAGCAGGG + Intronic
1148020851 17:44552511-44552533 GGGGTGAAATAGATGGAGTAGGG - Intergenic
1152072588 17:78141160-78141182 GGGGTCTGGAAGATGGAGTAAGG - Exonic
1153898532 18:9592340-9592362 GGAGGGGAAAAGATAGAGAAAGG - Intronic
1163124304 19:15236501-15236523 TGGGGGGACAGGATGGAGTAGGG + Exonic
1163124311 19:15236520-15236542 AGGGGGGACAGGATGGAGTAGGG + Exonic
1163350372 19:16773156-16773178 GGTGGCGAAGAAATGGAGTCTGG - Exonic
1166887975 19:45973196-45973218 GGGGGGGAAAGGATGGAGAAAGG + Intronic
927784200 2:25961237-25961259 GGGAGTGAAGAGATGGAGAAAGG + Intronic
928389254 2:30896783-30896805 GGAGGGGGAAAGATGGAGCAAGG - Intergenic
929438861 2:41949785-41949807 GAGGGAGAAGAGATGGAGTTTGG - Intronic
930909202 2:56610580-56610602 GAGGGATAAAAGATGGAGTTGGG - Intergenic
931724673 2:65097320-65097342 GGGGGTGTAAAGATGGATAAGGG + Intronic
935416992 2:102829448-102829470 GGGGGCGAAAAGAGAAAGAAAGG - Intronic
937042977 2:118835558-118835580 GGGGGCGCAAAGTTGGAGGCAGG + Intergenic
939966008 2:148610889-148610911 GGTGGAGAACAGATGGAGGAAGG + Intergenic
939991042 2:148876595-148876617 GGGGGAGAAAAGGTGGGGAAGGG - Intronic
945223092 2:207504508-207504530 TGGGGAGAAAAGAGGGACTAAGG + Intergenic
946236597 2:218328107-218328129 GGGTGCTAAAAGATGTGGTAAGG - Intronic
948136159 2:235637919-235637941 GAGGGCAAAAAGGTGGAGGAAGG - Intronic
1172537954 20:35688763-35688785 GGGAGGGAAAAGAGGGAGAAAGG + Intronic
1173193988 20:40898948-40898970 GGGGAGGAAAAGCTGGGGTAGGG + Intergenic
1173420263 20:42894860-42894882 GGAGGAGAAGAAATGGAGTAGGG + Intronic
1174582208 20:51579922-51579944 GGAGGGAAAATGATGGAGTAGGG - Intergenic
1175934859 20:62509892-62509914 GAGGGCGAAGGGATGGAGGATGG - Intergenic
1180669236 22:17540527-17540549 GCGGGAGAAAAGACGGAGTCGGG + Exonic
1183273410 22:36876002-36876024 GGGGGTGACAGGCTGGAGTAAGG - Exonic
949508780 3:4750705-4750727 GGGGGCAAAAGGAAGGAGTCAGG - Intronic
950198046 3:11023216-11023238 AAGGGAGAAAAGGTGGAGTAAGG - Intronic
950863830 3:16173566-16173588 GGGGGCAAAAAGCAGGAGCAGGG - Intergenic
952471201 3:33653707-33653729 GGCTGGGAAAAGATGGGGTAGGG + Intronic
952740741 3:36731791-36731813 GAGGGAGAAAAGAAGGAGTGAGG - Intronic
953018875 3:39101235-39101257 AGGGGTGAAATGAGGGAGTATGG - Intronic
959491196 3:106990364-106990386 GAGAGAGAAAAGATGGAGAAAGG + Intergenic
962894821 3:139704736-139704758 GTGGGGGAATAGAGGGAGTATGG + Intergenic
966599046 3:181756870-181756892 GGGGGTGAACAGCTGGAGGAGGG + Intergenic
968530126 4:1086991-1087013 GGGGGTGAGAAGATGGGGTGGGG + Intronic
968530196 4:1087200-1087222 GGGGGTGAGAGGATGGGGTAGGG + Intronic
968667743 4:1830083-1830105 GGGGGAGAAAGGATAGAGCAGGG - Intronic
969291736 4:6244499-6244521 GGTGGGGTGAAGATGGAGTAAGG + Intergenic
972928062 4:44037178-44037200 GGGAGGGCAAGGATGGAGTATGG - Intergenic
973661724 4:53114352-53114374 GGGGGCGAAAAGATGGAGTATGG - Intronic
973845161 4:54904253-54904275 GGGTGGGAAAAGAAGGAGTTGGG + Intergenic
974129239 4:57732292-57732314 GTGCACGCAAAGATGGAGTAGGG + Intergenic
975889211 4:79004985-79005007 GGTGGGGAAGAGGTGGAGTAGGG + Intergenic
979663246 4:123282806-123282828 GGGGGAGAAAAGAAGAAGGAAGG + Intronic
979872659 4:125844644-125844666 AGGGGCAAAGAGATGGATTAAGG - Intergenic
980563032 4:134502051-134502073 GGGGGGGAAAAGGGGGAGGAAGG - Intergenic
981223090 4:142259413-142259435 GGGGTAGAAGAGATGGAGAAGGG + Intronic
982837094 4:160132358-160132380 TAGGGAGAAAAGATGGAGAAAGG + Intergenic
986690213 5:10307795-10307817 GGGGGCGGAGAGGTGGAGGAGGG + Exonic
991050211 5:62264826-62264848 GGGAGAGAACAGATGGAGGATGG + Intergenic
996595622 5:125199355-125199377 GGGGAGGAGAAGATGGAGGAGGG - Intergenic
997013433 5:129904734-129904756 GGGGGCGCAAAGGCGGAGGAGGG + Exonic
1002069783 5:176672304-176672326 GGAGGCGAGGAGATGGGGTAGGG + Intergenic
1003020213 6:2502952-2502974 GGGGAAGAAAAGAAGGAGAAAGG + Intergenic
1003451855 6:6242088-6242110 GGGGAGGAAAAGATGGACAAAGG + Intronic
1006009807 6:31032777-31032799 AGGAGGGAAAAGATGGAGTTGGG + Intronic
1006602093 6:35233013-35233035 GGGGGTGAAAACATAGAGGAAGG + Intronic
1010995861 6:82531677-82531699 GTGGGAGAAAAGAAGGAGGATGG + Intergenic
1019360166 7:600717-600739 GGGAGCAAAAAGAGGGAGTCGGG + Intronic
1021239573 7:18183533-18183555 GTGGGGGAAAAGATGGAGTAAGG - Intronic
1021291906 7:18855720-18855742 GGGGAAGAAAAGAGGGAGAAGGG + Intronic
1022641673 7:32191387-32191409 GGGGGTTAAAAGAGGGGGTAGGG - Intronic
1030076264 7:105739555-105739577 TGGAGTGAAAAGATGGAGGAGGG + Intronic
1030888302 7:114965541-114965563 GGAGGGGAAAGGATGGATTATGG + Intronic
1032590293 7:133185918-133185940 GTGGGAGAAAAGAAGGAATATGG + Intergenic
1034128628 7:148696769-148696791 TGGGGGGTAAAGATGGAGGAAGG + Intergenic
1036599451 8:10246600-10246622 GGAGGGGAAAAGCTGGAGTTTGG + Intronic
1038035886 8:23686577-23686599 AGGGGAGAAAAGATGCAGTGAGG - Intergenic
1038298363 8:26317933-26317955 GGGGGAGAAAAGAGAGAGAAGGG + Intronic
1040566769 8:48574443-48574465 GGGGCAGAAAAAATGGAGGACGG - Intergenic
1042397399 8:68307975-68307997 GGGGATGGAAAGATGAAGTAGGG + Intronic
1042463054 8:69093290-69093312 GGGGTGGGAAAGATGGAGGAGGG + Intergenic
1042578226 8:70246353-70246375 GTGGGGAAAAAGATGGTGTAAGG + Intronic
1043526766 8:81105707-81105729 TGGGGTGAAAGGATGGCGTAGGG + Intronic
1049324383 8:142014493-142014515 GGAGGCCAAAAGATGGGGAAGGG - Intergenic
1051196596 9:14568401-14568423 GAGGGCGGAAAGAGGGAGGAAGG + Intergenic
1055569840 9:77605446-77605468 GGGGGAGAAAAGTGGGAGGAAGG - Intronic
1059687832 9:116654509-116654531 CGGGGAGAAAAAATAGAGTAGGG + Intronic
1059814665 9:117899331-117899353 GGGGGAGAAGAGATGGAGCAAGG - Intergenic
1061115672 9:128609866-128609888 GGGGGAGAGAAGGGGGAGTAAGG - Intronic
1185942692 X:4339103-4339125 GTGGGAGGAAAGATGGAATATGG + Intergenic
1189928446 X:45982418-45982440 GGGAGGGAAAAGATGGGGAAAGG - Intergenic
1190124331 X:47690130-47690152 GGGGGTGGAAAGATGGAGAGTGG - Intergenic
1190322224 X:49186087-49186109 GGAGGCGAATGGATGGAGGAAGG - Intronic
1192831348 X:74753915-74753937 GGGGGAGAATAGAGGGACTAGGG + Intronic
1196548546 X:116994878-116994900 GAGGAGGAAAAGATGGAGAAAGG + Intergenic
1196891589 X:120295979-120296001 GGGGGAGACAAGATGGAACAAGG - Intronic
1197651604 X:129071542-129071564 GAGGGGGAAAAGAGGGAGGAAGG + Intergenic
1199600666 X:149539708-149539730 GGGGGAGCCAAGCTGGAGTAAGG - Intergenic
1201458931 Y:14201342-14201364 GGGGAGGAAGAGAAGGAGTAAGG + Intergenic
1201727608 Y:17170910-17170932 GTGGGAGGAAAGATGGAATATGG + Intergenic
1202578296 Y:26350879-26350901 GGGGAGGAGAAGAGGGAGTATGG - Intergenic
1202594516 Y:26522130-26522152 GGGTCAGAAAACATGGAGTATGG - Intergenic