ID: 973665845

View in Genome Browser
Species Human (GRCh38)
Location 4:53158473-53158495
Sequence TTGGTCAACTGGAAGAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973665845_973665847 -10 Left 973665845 4:53158473-53158495 CCATCACTCTTCCAGTTGACCAA 0: 1
1: 0
2: 1
3: 19
4: 169
Right 973665847 4:53158486-53158508 AGTTGACCAAGTCAGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973665845 Original CRISPR TTGGTCAACTGGAAGAGTGA TGG (reversed) Intronic
900644775 1:3703936-3703958 CTGGTCACCTGGAAGAGAGAGGG + Intronic
904987486 1:34563804-34563826 CTGGAGACCTGGAAGAGTGAGGG - Intergenic
909759814 1:79272503-79272525 GTGGTCATTTGGAAGAGAGAGGG - Intergenic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910261105 1:85294626-85294648 TTGATGGACTGGAAGAGAGATGG - Intergenic
912451315 1:109769303-109769325 TTGGACAACTGGGAGGGTTATGG + Intronic
916428987 1:164709670-164709692 TTGGGAAAGTGGAAGAGCGAAGG + Intronic
917068864 1:171127538-171127560 ATGGTCAAGGGGAGGAGTGAAGG - Intergenic
918313495 1:183303679-183303701 CTGGACAACTTGAAGAGGGAGGG - Intronic
921343703 1:214159888-214159910 TTGGACAACTTGAAGTGGGAAGG - Intergenic
923836734 1:237618966-237618988 TTGGACATCTGGAGGAGGGAAGG - Intronic
1067282010 10:44880127-44880149 GTGTTCAACTGGGAGAGGGAAGG - Intergenic
1067715651 10:48689079-48689101 TTGGCCAACTGGCAGAAAGAAGG + Intronic
1067740452 10:48891541-48891563 TGGGTCAACTGGAAAAGGCAAGG - Intronic
1073048162 10:100652115-100652137 GTGGTCAACTGGAAGAAGGTGGG - Intergenic
1078618296 11:12884793-12884815 GTGGCTAACAGGAAGAGTGATGG + Intronic
1081553948 11:44140153-44140175 TTGGGCAACTTGAAGGGTTAGGG + Intronic
1084619429 11:70259181-70259203 TTGGGCAACAGGAAGAGTATAGG + Intergenic
1087095075 11:94310244-94310266 TTGATCAACAGGAGGAGTGATGG + Intergenic
1087746042 11:101948107-101948129 TTGGTCTACGGGAAAAGGGAAGG - Exonic
1090258636 11:125303299-125303321 TTGCTCATCTGCAAAAGTGAGGG - Intronic
1094334607 12:29334641-29334663 GTGGTCAACAGGGAGAGGGATGG + Exonic
1096684966 12:53282249-53282271 TTGGTCACCTGAAGGAGAGAAGG - Exonic
1097190778 12:57218398-57218420 TTAGTGAACTGGAGGAGTGGGGG + Intronic
1098965835 12:76787216-76787238 GAGGTCAAGGGGAAGAGTGAAGG + Intronic
1099197509 12:79635358-79635380 TTGGTCACCTTGATGACTGAGGG + Intronic
1100252028 12:92836152-92836174 TTGGTCAAATGGTAGAATCATGG + Intronic
1102281271 12:111620789-111620811 TTGAGCAACTGGAAGACTGGAGG - Intergenic
1102848352 12:116213140-116213162 TTGGTTTATTGGAAGAGTGTGGG - Intronic
1106544255 13:30716659-30716681 TTAGCCAACTGGAAGTGGGAGGG + Intronic
1106571092 13:30928727-30928749 TTGTCCAAATGTAAGAGTGAAGG + Intergenic
1106798465 13:33231758-33231780 TTAGTCATCTGGAAAAGTTATGG - Intronic
1106945648 13:34824662-34824684 TTGGCCAGGTGGAAGAATGAGGG + Intergenic
1109393478 13:61724136-61724158 TTGGTCAGATGGAAGAGACATGG + Intergenic
1110233594 13:73193007-73193029 TTGGGCAACTGGAAGAATAAAGG + Intergenic
1112654384 13:101434317-101434339 TTAGTCAACTAGAAGAATGGAGG + Intergenic
1112744745 13:102514119-102514141 TTGATCACCTGGCAGAGGGAGGG - Intergenic
1116389383 14:44374926-44374948 TTGGTCAACAGGAAGCAGGAAGG - Intergenic
1117065543 14:52010087-52010109 TAAGTCAACTGGAATAGAGAAGG + Exonic
1118005674 14:61562574-61562596 TAGGTCAGCTGGAAGAGTCTTGG + Intronic
1118540224 14:66814753-66814775 GTGGTCATCTGGAAGAAAGAAGG - Intronic
1118851151 14:69584498-69584520 TTGGTCAACTGGATAGGTGTGGG + Intergenic
1119661169 14:76452799-76452821 TTCGTCAGCTGGGAGAGTCAGGG + Intronic
1120063466 14:80012567-80012589 ATGGATAACTGGAAGAGTGATGG - Intergenic
1120688040 14:87562018-87562040 TTGTTCAACTGGATGATTGGAGG - Intergenic
1122815775 14:104312538-104312560 TTGGTCAATTGGCTGAGGGATGG + Intergenic
1124006308 15:25798065-25798087 CTAGTTAACTGGAAGAGGGAGGG + Intronic
1125259837 15:37810638-37810660 TTGTACAACTTGAAGAGTAAAGG + Intergenic
1126819071 15:52483352-52483374 CAGGTCAACAGGGAGAGTGAGGG + Intronic
1127812172 15:62573726-62573748 TTGGGCAACTTGTAGACTGAAGG - Intronic
1128187096 15:65651560-65651582 AAGGTCTAATGGAAGAGTGATGG - Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1135232292 16:20720150-20720172 ATGGTCAAGTGGGAGAGGGAGGG + Intronic
1137491077 16:48933317-48933339 GTGGTGGACAGGAAGAGTGAAGG - Intergenic
1139941427 16:70608558-70608580 CTGGTCATCTGGTAGAGGGAGGG + Intronic
1144130897 17:12246860-12246882 TTGGTTAACTTTAAGAGCGAAGG + Intergenic
1144601092 17:16614629-16614651 TTGGTCCTCTGGAAGAGTGTGGG - Intergenic
1146477042 17:33171412-33171434 TTGTGCAACTGGATGTGTGATGG - Intronic
1146486731 17:33249176-33249198 TTGAACAACTGGAAGGATGAAGG + Intronic
1150719735 17:67604203-67604225 TTTATCAACTGGAATAGTGAGGG + Intronic
1151273851 17:73018179-73018201 TTAGTCATCTTAAAGAGTGATGG - Intronic
1151859857 17:76752374-76752396 TTGGTAAACTGGAAAAGTCAGGG + Intronic
1152455976 17:80416388-80416410 TTGGGCAACTGGGAGCGTGGTGG - Intronic
1155511160 18:26578803-26578825 TTGATCAACTGGAAGGGGTAAGG - Intronic
1157051866 18:44175639-44175661 TTGGTCATATCCAAGAGTGATGG + Intergenic
1157221671 18:45832619-45832641 TTGGACAACAGGAAGAATGTGGG + Intronic
1158503156 18:58021882-58021904 TTGGGCCACAGGGAGAGTGAGGG + Intergenic
1158811215 18:61037998-61038020 TAGATAAACTGGAAGAATGAAGG + Intergenic
1160093178 18:75846149-75846171 TTGGGCAACTTAAAGAGAGAAGG - Intergenic
1161010373 19:1956966-1956988 TGGCTCACCTGGAAGAGAGAAGG + Intronic
1164458573 19:28428702-28428724 TTTGTCATTAGGAAGAGTGATGG - Intergenic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1166707286 19:44914978-44915000 TTGGAGATTTGGAAGAGTGAAGG + Intronic
1166709390 19:44927062-44927084 TTGGAGATTTGGAAGAGTGAAGG + Intergenic
924997516 2:375972-375994 TTTGTCAAATGGAGGAATGAAGG - Intergenic
926762532 2:16291652-16291674 GTGGTCCACTGGAAGTGGGAAGG - Intergenic
926972921 2:18484809-18484831 TTGGGCAACAGGAAGAGAGCAGG - Intergenic
927048105 2:19300324-19300346 GTGGCCAACCGGCAGAGTGAGGG - Intergenic
928400931 2:30978212-30978234 TTGGGCAGCTGGAGGAGGGAAGG - Intronic
928847087 2:35689267-35689289 ATGGTCTTCTGGAAGAGAGAGGG - Intergenic
929442404 2:41974240-41974262 ATGACCAACTGGAAGAGTGAGGG + Intergenic
933464236 2:82631128-82631150 TTGGTCATCTGTAAGATTAAAGG - Intergenic
934756302 2:96827152-96827174 TTGGTCATCTGGCAGAGAGGAGG - Intronic
935431628 2:102982140-102982162 TTGGTGAACTGAAAGAGAGTGGG + Intergenic
939235333 2:139485119-139485141 TGGGACAACTGGAAGAGGGGAGG - Intergenic
939511607 2:143113233-143113255 TTGGCTCACTGGAAGATTGAGGG - Intronic
940537711 2:154967608-154967630 TTGGGCAACTGGATGAATGTTGG + Intergenic
944076490 2:195737978-195738000 TTGGTCAGAGGGAAGAGTCATGG + Exonic
948594151 2:239068634-239068656 TGGGTCAGCTGAAAGAGGGACGG + Intronic
1169986329 20:11449281-11449303 TTTGTCAATTTGAGGAGTGATGG + Intergenic
1173655179 20:44695323-44695345 TTATTCTACTGGAGGAGTGAGGG - Intergenic
1174212847 20:48893651-48893673 TTGGTAAACTTGAAGGGTGTAGG - Intergenic
1176691183 21:9911799-9911821 TTGGTCAATTTCAAGAGTGATGG - Intergenic
1178585142 21:33865381-33865403 TTGGGCAGCTGGATGTGTGAGGG + Intronic
1178679729 21:34663713-34663735 TTTTTCATCTGGAACAGTGAGGG - Intergenic
1179236474 21:39551768-39551790 TTGGTCAGCTGGTAGAGGGAGGG + Intergenic
1179422948 21:41250592-41250614 TTAGTCCCCTGGAAGAGTGACGG - Intronic
1182032922 22:27174472-27174494 TTGAAAAACTGTAAGAGTGAAGG + Intergenic
1183319760 22:37157770-37157792 TTGGACAACAGGAACAGTGTGGG + Intronic
1183740736 22:39667159-39667181 TTTGTCAACAGGGACAGTGATGG + Intronic
1185032226 22:48450188-48450210 GTGGCCCACTGGGAGAGTGAGGG - Intergenic
1185349102 22:50325175-50325197 ATGGTCAGCTGGCAGAGTGTTGG - Intronic
951847135 3:27096751-27096773 TTTGTGAACTGAAAGAGTGAGGG + Intergenic
951922469 3:27871576-27871598 TTGGTAAATTGGTTGAGTGATGG - Intergenic
953154992 3:40361555-40361577 CTGAACAACTGGAAGAGAGAAGG - Intergenic
955624282 3:60900185-60900207 TTGGTCAAGAGGCAGAGTAATGG + Intronic
959139929 3:102473337-102473359 TTGGGCAACTGGATGTGGGATGG - Intronic
961122063 3:124381214-124381236 TTGGTCAAATAGAAGAGTGAAGG + Intronic
961496750 3:127298622-127298644 TTGGAGAACTGGCAGAGAGATGG + Intergenic
961497005 3:127300905-127300927 ATGGTCACCTGGCAGAGTTAGGG + Intergenic
961679837 3:128592105-128592127 TTGGTCAGATGGAAGGGTGTAGG + Intergenic
962902863 3:139776194-139776216 TGGGTAAAGTGGTAGAGTGAGGG - Intergenic
963500351 3:146117892-146117914 GTGGACAACTGGTATAGTGAGGG - Intronic
964793504 3:160474341-160474363 TGGGACAACTAGAAGGGTGATGG - Intronic
965485838 3:169277529-169277551 GTGCTCAACTGGGAGAGTGATGG - Intronic
965742004 3:171885288-171885310 TTGGTTGACTGGAAGAATGATGG - Intronic
965780919 3:172285124-172285146 TTGCTCAACTGGATGGATGACGG - Intronic
969328567 4:6459032-6459054 GTGGGTAACTGGAAGAGTCATGG - Intronic
970333464 4:15005623-15005645 TTGGTCAACTGAAAAAGTTATGG - Intronic
970558305 4:17257834-17257856 TTGGTCAACTGGGTGGGTAATGG - Intergenic
972993408 4:44850540-44850562 TTGATAAAGTGGAGGAGTGAAGG + Intergenic
973182744 4:47289656-47289678 CTGGTGTACTGGATGAGTGATGG + Intronic
973665845 4:53158473-53158495 TTGGTCAACTGGAAGAGTGATGG - Intronic
975671048 4:76781053-76781075 ATGGTCATCTCGAAGAGTGTTGG - Exonic
979867359 4:125773382-125773404 TTAGTCAACTGATGGAGTGATGG + Intergenic
980363762 4:131771975-131771997 TTGGTCAATTTCGAGAGTGATGG - Intergenic
981065224 4:140476653-140476675 TTGGTCAATTCGAAAAGTGTGGG - Intronic
981195396 4:141914171-141914193 TTGGTGATCTGGAAAATTGAGGG - Intergenic
983524360 4:168745487-168745509 TTCTTCAACTGGAATAGTTAGGG + Intronic
984426134 4:179588391-179588413 TTGGACAACTTGAAAAGTGTGGG - Intergenic
985510228 5:309415-309437 TTGGTCATCAGTAATAGTGAAGG - Intronic
986603288 5:9495789-9495811 TTGCTAAACTGGAAGAATTAAGG - Intronic
987328689 5:16835642-16835664 TTGGTGGACAGGAAGAGTGTGGG - Intronic
988486843 5:31674542-31674564 TTGGGCAATTAGAACAGTGAAGG + Intronic
990766741 5:59192520-59192542 TTTTTCAACTGGTAGAGTTAGGG - Intronic
993311255 5:86336183-86336205 TTGGTGAACCAGAATAGTGATGG + Intergenic
995159684 5:108964568-108964590 GTGGTCAAAAGGGAGAGTGATGG + Intronic
998728902 5:145051369-145051391 TTGGTAAAATAGAAGAGTCAAGG + Intergenic
999360741 5:150984548-150984570 TTGGCCATCTGGGAGAGAGATGG - Intergenic
999566304 5:152866261-152866283 TTGGTCAACTGCAGAAGTGATGG + Intergenic
1001696809 5:173676259-173676281 TTAGACAACTGGGAAAGTGAGGG + Intergenic
1003024304 6:2540018-2540040 TTGGTGACCTCAAAGAGTGATGG + Intergenic
1011357282 6:86484989-86485011 ATACTCATCTGGAAGAGTGAAGG - Intergenic
1011685030 6:89817093-89817115 TGGGACAACTCGAAGGGTGAGGG - Intronic
1011771306 6:90676481-90676503 GTGGTCCACTGGAAGCCTGACGG + Intergenic
1013070452 6:106724311-106724333 TTTTACAACTGGAAGAGTGATGG + Intergenic
1013159361 6:107526406-107526428 TTGGTCAACTGGATGACTGCAGG + Intronic
1013835722 6:114332952-114332974 CTGGTCCACTGGAATAGTAAGGG + Intronic
1016314296 6:142769945-142769967 ATGGTCAGCTGGAAGAGGAAGGG - Exonic
1017249208 6:152261518-152261540 GTGGTCAGCTGGAATAGTTATGG - Intronic
1018753364 6:166826785-166826807 TTGGTCTACTGGATTATTGAGGG + Intronic
1018887525 6:167952463-167952485 TTTCTCAACTGGAAGTGTTAAGG - Intronic
1020629330 7:10621556-10621578 TTGTTTAACAGGAAGAGTGTAGG - Intergenic
1022993216 7:35728669-35728691 TGGGTCAACTGGAAGAATCTGGG + Intergenic
1024516927 7:50267140-50267162 TTGCTCAACTGGAACTGGGAAGG + Intergenic
1027196294 7:76032832-76032854 TTGGGCAAGAGGAAGAGGGAGGG + Intronic
1029904820 7:104080929-104080951 TTTGTAAAATGGAAGAATGAGGG + Intergenic
1032099496 7:128962042-128962064 TTGGTCAACTTGAAGAAAGCTGG - Intronic
1032343690 7:131099903-131099925 GTGCTCAACTTGAAAAGTGATGG + Intergenic
1034733288 7:153406409-153406431 TTTGGCAAATGGAAGAATGAAGG + Intergenic
1039817969 8:41111405-41111427 ATGCCCACCTGGAAGAGTGAGGG - Intergenic
1040449909 8:47534617-47534639 GAGGTCAACTTGAAGAGGGAGGG + Intronic
1040539656 8:48340727-48340749 TTGGACAACTTGAAAACTGAAGG + Intergenic
1040792721 8:51252115-51252137 TTTGTGAAATGGAGGAGTGATGG - Intergenic
1042601441 8:70503192-70503214 ATGGGAAGCTGGAAGAGTGATGG + Intergenic
1043155276 8:76771014-76771036 TTGTTAAACTGGAAGTGTGCTGG + Intronic
1043315832 8:78920475-78920497 TTTTTAAACTGGAAGTGTGAAGG - Intergenic
1043402511 8:79897948-79897970 CTGGTCAGCTAGAATAGTGAGGG - Intergenic
1045071357 8:98507695-98507717 TTGGGCAGCTGAATGAGTGAGGG - Intronic
1050790701 9:9465239-9465261 TTGTTTTATTGGAAGAGTGATGG - Intronic
1051411878 9:16798077-16798099 TTGTTGATCTGGAAGTGTGAAGG + Intronic
1051898412 9:22012392-22012414 TAGGTGAGCTGGAAGAGTGAAGG - Intronic
1053777943 9:41568461-41568483 TTGGTCAATTTCGAGAGTGATGG + Intergenic
1057529843 9:95834813-95834835 TGGGTTTACTGGAGGAGTGAGGG - Intergenic
1059508854 9:114825297-114825319 TGGGTACACTGGAAGAGGGATGG - Intergenic
1059653210 9:116334475-116334497 CTGGTCAGTTGGAAAAGTGATGG - Intronic
1059935013 9:119301230-119301252 TTGGTCAGCTGGGTGGGTGATGG - Intronic
1060102368 9:120851761-120851783 TTGTTTACCTGGAAGAGTGTGGG + Intergenic
1186265281 X:7825887-7825909 TTGGTCAACTGGCAGGGTTTGGG + Intergenic
1187925523 X:24246496-24246518 TTGATGAACTGGAAGATAGATGG - Intergenic
1187970835 X:24656334-24656356 TTGGTCACATTGATGAGTGAAGG - Intronic
1190580893 X:51892712-51892734 TTGCTCAAATGGAGGAGGGAGGG + Intronic
1192081947 X:68056786-68056808 TAGGTTAAATGGTAGAGTGAGGG + Intronic
1192250150 X:69406111-69406133 TTGGTTAAATGAAAGAATGAAGG - Intergenic
1192373378 X:70534379-70534401 TTGGGCAACCAGAAGAATGATGG + Intronic
1194175597 X:90643364-90643386 TTTCTCCATTGGAAGAGTGAAGG - Intergenic
1199879349 X:151960861-151960883 TTGCGCAACTGGGTGAGTGATGG + Intronic
1200522240 Y:4224323-4224345 TTTCTCCATTGGAAGAGTGAAGG - Intergenic
1201972974 Y:19816421-19816443 GGGGGCAGCTGGAAGAGTGAGGG + Intergenic
1202099825 Y:21295432-21295454 TTGGCTAACTTGAAGAGTGCAGG - Intergenic