ID: 973671617

View in Genome Browser
Species Human (GRCh38)
Location 4:53224611-53224633
Sequence GCATCTACTAAGGTTATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973671617 Original CRISPR GCATCTACTAAGGTTATTTG GGG (reversed) Intronic
901917609 1:12511881-12511903 GCAGCTACTATGGTATTTTGAGG - Exonic
906462743 1:46048912-46048934 GTATTTACTAAAGCTATTTGAGG - Intronic
909408775 1:75323818-75323840 GAATCAACTAAGCTTATTTTGGG + Intronic
909693658 1:78439228-78439250 GCATTTACTATGGGAATTTGTGG - Intronic
911760582 1:101610022-101610044 ACATCTCATAAGGTTATCTGTGG + Intergenic
924766493 1:247036143-247036165 GCATCTATTGAGATGATTTGTGG - Intergenic
924796959 1:247299707-247299729 GCATTTACCAAGGATCTTTGGGG + Exonic
1063993280 10:11590371-11590393 TCTTCTACTAAGGGAATTTGTGG - Intronic
1070219867 10:74429995-74430017 CAATCTAATAAGGTTGTTTGAGG - Intronic
1070981770 10:80654165-80654187 GAAACTACTAAGGTGATTTTTGG + Intergenic
1080320441 11:31003238-31003260 GCATCTACTAAAGTGCTTCGTGG - Intronic
1080926140 11:36758106-36758128 CCATGTAGTAAGGTTCTTTGTGG - Intergenic
1085750736 11:79158926-79158948 CCATATACTAGGGTTATTTGGGG - Intronic
1089747813 11:120629336-120629358 CTATCTCCTAAGGTTGTTTGAGG + Intronic
1089967693 11:122666952-122666974 GCATCTTCATAGGTGATTTGGGG - Intronic
1101469460 12:104983040-104983062 GCATCTGCTAAGCTTCTTGGTGG - Intergenic
1111803611 13:93010408-93010430 GAATCTAGTCAGGATATTTGTGG - Intergenic
1112005385 13:95249265-95249287 GCATCTATCAAAGTTATTAGAGG - Intronic
1112537207 13:100271041-100271063 GAATCTACTAATGTGCTTTGAGG + Intronic
1117126735 14:52636752-52636774 GCATATACTTATGTTATTTTGGG + Exonic
1119745074 14:77038263-77038285 GCCTCTACTAGGGTTAGCTGGGG + Intergenic
1136416709 16:30108550-30108572 GCAACTACAAAGGTTATTCTGGG - Intronic
1136665311 16:31806233-31806255 CCATCTACTAAAGTTATAAGTGG - Intergenic
1142220179 16:88850417-88850439 GCATCCATTCATGTTATTTGTGG - Intronic
1150516658 17:65818615-65818637 TCTTGTAATAAGGTTATTTGGGG + Intronic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
925273032 2:2628349-2628371 ACATCTTCTAAGGTTATTTGAGG - Intergenic
925274507 2:2639274-2639296 TCATCTACTGAGATGATTTGGGG + Intergenic
932347805 2:71007174-71007196 GCATCTACCCAGTTTTTTTGAGG + Intergenic
936661723 2:114550365-114550387 ACATCACCCAAGGTTATTTGAGG - Intronic
937263983 2:120604611-120604633 GCATCTACTCAGGTTTGGTGAGG - Intergenic
945858713 2:215096188-215096210 GCATGTAATAAGATAATTTGTGG - Intronic
1168954809 20:1827483-1827505 GCACCTGGTAAGGTTATGTGTGG - Intergenic
1169805485 20:9555103-9555125 TCCTCTAGTAAGCTTATTTGGGG - Intronic
1170413375 20:16114299-16114321 GCATGTATTATTGTTATTTGGGG - Intergenic
1177444309 21:21172010-21172032 TGATTTATTAAGGTTATTTGAGG - Intronic
953966586 3:47312095-47312117 GCATCTACGAAGCAAATTTGGGG - Intronic
955017749 3:55088424-55088446 GCTTCTACTAAGGCTAGTGGTGG - Intergenic
957489798 3:80908906-80908928 GCATCTATTAAGGTAATCTGTGG - Intergenic
959191823 3:103122319-103122341 GGATATACTAAGGTCTTTTGGGG + Intergenic
959979476 3:112499243-112499265 GCACCTGCTTAGGTTATTTCTGG - Intronic
962434296 3:135350319-135350341 GCATCTGCTGAAATTATTTGAGG + Intergenic
963408572 3:144901346-144901368 GCATCTAATAGGGATATTTTAGG + Intergenic
967242466 3:187454325-187454347 GCATAGACTAAGGATCTTTGAGG + Intergenic
967510408 3:190304596-190304618 GCAGCTTCTAGGGTTATGTGGGG - Intergenic
969388505 4:6873145-6873167 GCATCTCCTAAGGTTCTTGTGGG - Intronic
970246294 4:14067520-14067542 GAGTCACCTAAGGTTATTTGAGG - Intergenic
971860995 4:32105363-32105385 TCATCTGCTAAGTTTATTTTAGG - Intergenic
973671617 4:53224611-53224633 GCATCTACTAAGGTTATTTGGGG - Intronic
982333444 4:154208155-154208177 GCAATTTCTAGGGTTATTTGAGG + Intergenic
986637957 5:9842653-9842675 CCAGCTACTAAGCTGATTTGTGG + Intergenic
987269114 5:16287052-16287074 GCATGTACCAAGGTTACTTCTGG - Intergenic
987441173 5:17958772-17958794 GAACCTAGTAAGGTTCTTTGAGG - Intergenic
987525699 5:19046663-19046685 GCATCTACAGAACTTATTTGTGG + Intergenic
988237687 5:28566733-28566755 TGATCAACTCAGGTTATTTGAGG - Intergenic
994104035 5:95925707-95925729 GCATTTCCTAAATTTATTTGAGG - Intronic
995241270 5:109887325-109887347 GCATCTTCATAGGTTCTTTGGGG + Intergenic
998373376 5:141675226-141675248 GAATCTACTCAGGTTAGTTAAGG - Intronic
998787931 5:145732671-145732693 GCATCTCTGAAGGTTATTTTTGG - Intronic
999027877 5:148256099-148256121 GCATCTATTGAGATAATTTGTGG + Intergenic
1000379947 5:160620183-160620205 GCATGTTTTAAGGATATTTGAGG + Intronic
1002354520 5:178614404-178614426 GCATCTGCTAAGGTTTTTCTGGG - Intronic
1008653653 6:53588965-53588987 GCTTGTACTCAGTTTATTTGGGG - Intronic
1009259776 6:61470406-61470428 GCATCTCCAAAGTGTATTTGGGG + Intergenic
1009747526 6:67837320-67837342 GCATTTAACAAGGTTTTTTGGGG + Intergenic
1009788905 6:68374143-68374165 GTATCTTTTAAGGTTATTTTCGG - Intergenic
1013740782 6:113281605-113281627 CCATCTACTAAGGTTATGGTAGG - Intergenic
1015055915 6:128903122-128903144 ACATCTAGTATGTTTATTTGAGG + Intronic
1028721779 7:94041056-94041078 GCATTTTTTAAGATTATTTGTGG + Intergenic
1031407294 7:121401484-121401506 GCAACTATTAAGGTTACTAGTGG + Intergenic
1032483770 7:132267498-132267520 GCCTCTACCAAGACTATTTGGGG - Intronic
1037370548 8:18172844-18172866 GCATCCACTCAAGTTCTTTGGGG - Intronic
1054363185 9:64199298-64199320 GCATCTCCAAAGTGTATTTGGGG + Intergenic
1060598190 9:124860805-124860827 GCCTCTACTAAGGTTGTTTGGGG + Intronic
1062299601 9:135857951-135857973 GCATCTACTGAGGGCATGTGAGG + Intronic
1185779462 X:2831757-2831779 GAAGCTGCTAAGGTTATTTTGGG + Intronic
1186797206 X:13058496-13058518 GCCTCTCCTAGGGTTATATGAGG + Intergenic
1189687414 X:43579621-43579643 GCCTCTACAAAGGTGATTTCTGG - Intergenic
1190503224 X:51099527-51099549 GCATCTTCTCATGTTATTTCTGG + Intergenic
1191263264 X:58352960-58352982 GAATCTGCGAAGGATATTTGGGG + Intergenic
1198883767 X:141310670-141310692 ATATCTACTATGGTGATTTGTGG - Intergenic