ID: 973673877

View in Genome Browser
Species Human (GRCh38)
Location 4:53244165-53244187
Sequence CAGTATTAGATCATTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973673874_973673877 15 Left 973673874 4:53244127-53244149 CCACATAATAATTGTGGGAGACT 0: 3
1: 100
2: 1553
3: 5449
4: 5411
Right 973673877 4:53244165-53244187 CAGTATTAGATCATTGAGGCAGG No data
973673873_973673877 16 Left 973673873 4:53244126-53244148 CCCACATAATAATTGTGGGAGAC 0: 3
1: 83
2: 1449
3: 5239
4: 5134
Right 973673877 4:53244165-53244187 CAGTATTAGATCATTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973673877 Original CRISPR CAGTATTAGATCATTGAGGC AGG Intronic
No off target data available for this crispr