ID: 973685425

View in Genome Browser
Species Human (GRCh38)
Location 4:53365349-53365371
Sequence CGACCGGACAAGAGGAAGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973685425_973685434 6 Left 973685425 4:53365349-53365371 CCCAGCTTCCTCTTGTCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 973685434 4:53365378-53365400 ATTAAGGAGGTGCACATCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 85
973685425_973685430 -10 Left 973685425 4:53365349-53365371 CCCAGCTTCCTCTTGTCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 973685430 4:53365362-53365384 TGTCCGGTCGGGCGCTATTAAGG 0: 1
1: 0
2: 0
3: 0
4: 5
973685425_973685433 5 Left 973685425 4:53365349-53365371 CCCAGCTTCCTCTTGTCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 973685433 4:53365377-53365399 TATTAAGGAGGTGCACATCCTGG 0: 1
1: 0
2: 0
3: 7
4: 79
973685425_973685432 -7 Left 973685425 4:53365349-53365371 CCCAGCTTCCTCTTGTCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 973685432 4:53365365-53365387 CCGGTCGGGCGCTATTAAGGAGG 0: 1
1: 0
2: 0
3: 1
4: 7
973685425_973685440 24 Left 973685425 4:53365349-53365371 CCCAGCTTCCTCTTGTCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 973685440 4:53365396-53365418 CTGGGGTAGCAGTGGGAAAAGGG 0: 1
1: 0
2: 4
3: 52
4: 438
973685425_973685439 23 Left 973685425 4:53365349-53365371 CCCAGCTTCCTCTTGTCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 973685439 4:53365395-53365417 CCTGGGGTAGCAGTGGGAAAAGG 0: 1
1: 0
2: 1
3: 38
4: 397
973685425_973685436 16 Left 973685425 4:53365349-53365371 CCCAGCTTCCTCTTGTCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 973685436 4:53365388-53365410 TGCACATCCTGGGGTAGCAGTGG 0: 1
1: 0
2: 2
3: 14
4: 212
973685425_973685437 17 Left 973685425 4:53365349-53365371 CCCAGCTTCCTCTTGTCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 973685437 4:53365389-53365411 GCACATCCTGGGGTAGCAGTGGG 0: 1
1: 0
2: 3
3: 20
4: 164
973685425_973685435 7 Left 973685425 4:53365349-53365371 CCCAGCTTCCTCTTGTCCGGTCG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 973685435 4:53365379-53365401 TTAAGGAGGTGCACATCCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973685425 Original CRISPR CGACCGGACAAGAGGAAGCT GGG (reversed) Exonic
900031407 1:375497-375519 GGATGGGACAAGAAGAAGCTGGG + Intergenic
900051958 1:603697-603719 GGATGGGACAAGAAGAAGCTGGG + Intergenic
905414505 1:37794794-37794816 TGACAGGACCAGAGGGAGCTGGG - Intronic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
908588180 1:65597428-65597450 GGACAGGATAAGAGGAATCTGGG + Intronic
913201305 1:116496926-116496948 GGTCAGGACAAGAGGAAGCAAGG - Intergenic
915062724 1:153199545-153199567 CAAATGGACAAGAGGCAGCTGGG + Intergenic
923271816 1:232362027-232362049 CCACCTGACAAGAGGAAGATGGG - Intergenic
1067555443 10:47266607-47266629 GGACAGGGCAAGATGAAGCTTGG - Intergenic
1075618613 10:123909474-123909496 CCACCTGACAAGCGGAAGCCCGG + Intronic
1081696299 11:45111389-45111411 CGACAGGACAACAGGGACCTTGG + Intronic
1104959623 12:132482359-132482381 GGACCGGACATGAGGGGGCTGGG - Intergenic
1117369098 14:55059724-55059746 CAGCTGGAGAAGAGGAAGCTTGG - Intronic
1122024129 14:98862521-98862543 CGAGAGGCCAAGAGCAAGCTTGG - Intergenic
1128248484 15:66148999-66149021 AGACCAGACAAGAGGAGGCAGGG + Intronic
1131271641 15:90950760-90950782 CGACAGGCCAAGAGGCAGCACGG + Intronic
1138976595 16:62214837-62214859 AGACTGGACAGAAGGAAGCTGGG - Intergenic
1139424865 16:66873381-66873403 TGGACGGAGAAGAGGAAGCTGGG - Intergenic
1141670283 16:85488029-85488051 GGACCAGACAAGGGGAATCTGGG + Intergenic
1143383156 17:6508796-6508818 CGCCCGGACAGTAGGAAGCCGGG + Intronic
1148124362 17:45229286-45229308 GGCCCAGACAACAGGAAGCTGGG - Intronic
1152264702 17:79287587-79287609 AGACCGGCCAACAGGCAGCTGGG + Intronic
1152549255 17:81021216-81021238 CGGCCGGGCACGGGGAAGCTGGG - Intergenic
1152943579 17:83185839-83185861 CTATCTGACAAGAGGATGCTGGG + Intergenic
1152948246 17:83210216-83210238 GGATGGGACAAGAAGAAGCTGGG - Intergenic
1158306845 18:56115503-56115525 CCACCGGACAAGCAGAAGTTGGG - Intergenic
1160164605 18:76499109-76499131 AGACCCCACAAGAGAAAGCTCGG - Intergenic
1161217963 19:3104215-3104237 CCACCGGGGAAAAGGAAGCTGGG + Intronic
1161475685 19:4483559-4483581 CGGCCGGGCAAGAGGGAGCAGGG - Intronic
1161685170 19:5698955-5698977 TGACCGGAGAAGACGAAGCCCGG + Intronic
940237518 2:151527058-151527080 TGACAGCACAGGAGGAAGCTGGG + Intronic
1173023712 20:39288613-39288635 TAAAGGGACAAGAGGAAGCTTGG + Intergenic
1174177323 20:48653214-48653236 TGACCCAACAAGAGGGAGCTGGG - Intronic
1174634694 20:51988833-51988855 TGACGGGAGTAGAGGAAGCTGGG + Intergenic
1176143624 20:63555688-63555710 GGCCTGGACAAGATGAAGCTGGG + Exonic
1181019554 22:20092188-20092210 GGGCAGGACAAGAGGAAGGTGGG - Intronic
951744062 3:25957335-25957357 CTCCAGGACATGAGGAAGCTGGG - Intergenic
952712923 3:36449849-36449871 AGACAGGACAAGAGGAAGTGAGG + Intronic
973685425 4:53365349-53365371 CGACCGGACAAGAGGAAGCTGGG - Exonic
985055505 4:186032417-186032439 CGTCTGGATAAGAAGAAGCTTGG - Intergenic
999619985 5:153463098-153463120 TGACAGGAGAAGAGCAAGCTTGG + Intergenic
1001532046 5:172470069-172470091 AGACCGGACAAGGGGCAGCTTGG - Intergenic
1001776114 5:174330265-174330287 CCAAAGGACAAGAGGAAGATGGG + Intergenic
1002742413 5:181443371-181443393 GGATGGGACAAGAAGAAGCTGGG - Intergenic
1006828646 6:36955361-36955383 GGAGAGGACAAGAGGAAGCAGGG + Intronic
1013017133 6:106170061-106170083 AGACAGGAAAAGAGGAAGCAGGG - Intergenic
1016977118 6:149820149-149820171 CCACAGAACAAGGGGAAGCTGGG + Exonic
1019247549 6:170719110-170719132 GGATGGGACAAGAAGAAGCTGGG - Intergenic
1035500588 8:88826-88848 GGATGGGACAAGAAGAAGCTGGG + Intergenic
1041739146 8:61139829-61139851 CGACGGCACAAGAGGGAGCCGGG - Intronic
1055029438 9:71758665-71758687 GAACCGGACAAGAGAAAGCCTGG + Intronic
1203608320 Un_KI270748v1:74590-74612 GGATGGGACAAGAAGAAGCTGGG - Intergenic
1194645700 X:96455899-96455921 CCTCCGGGCAGGAGGAAGCTTGG + Intergenic