ID: 973686095

View in Genome Browser
Species Human (GRCh38)
Location 4:53371321-53371343
Sequence GGTTCTTGTGGACCACTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973686095_973686103 21 Left 973686095 4:53371321-53371343 CCTGGTAGTGGTCCACAAGAACC No data
Right 973686103 4:53371365-53371387 CAAGCATTCACAGTACAACAGGG No data
973686095_973686104 27 Left 973686095 4:53371321-53371343 CCTGGTAGTGGTCCACAAGAACC No data
Right 973686104 4:53371371-53371393 TTCACAGTACAACAGGGTGAAGG No data
973686095_973686102 20 Left 973686095 4:53371321-53371343 CCTGGTAGTGGTCCACAAGAACC No data
Right 973686102 4:53371364-53371386 TCAAGCATTCACAGTACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973686095 Original CRISPR GGTTCTTGTGGACCACTACC AGG (reversed) Intergenic
No off target data available for this crispr