ID: 973687458

View in Genome Browser
Species Human (GRCh38)
Location 4:53386982-53387004
Sequence CCCTAATTAGGTTTTTAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973687452_973687458 26 Left 973687452 4:53386933-53386955 CCAGAAACAGAAACTAAGGACTC 0: 1
1: 13
2: 54
3: 80
4: 255
Right 973687458 4:53386982-53387004 CCCTAATTAGGTTTTTAGACAGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973687458 Original CRISPR CCCTAATTAGGTTTTTAGAC AGG Intronic
901210195 1:7520261-7520283 CTCTCATTTGGTTTTTAGGCAGG - Intronic
907439812 1:54472205-54472227 CTCTATTTTTGTTTTTAGACAGG + Intergenic
917087212 1:171315835-171315857 CACTAACTAGGTCTCTAGACAGG + Intronic
919672887 1:200353925-200353947 CCCTAGAAAGGTTTTTAGAGGGG + Intergenic
919967655 1:202544818-202544840 CCCTAATTAGTTTGTAGGACTGG - Intronic
920056301 1:203194995-203195017 GCCTAATTAATTTTTGAGACAGG + Intergenic
1068297291 10:55089034-55089056 CTCTAATTAGTTATTTAGCCTGG + Intronic
1071207857 10:83303068-83303090 TCCTAAATAGCTTTTTAGAAAGG - Intergenic
1072479016 10:95792702-95792724 CTCTATTTTGGTTTTTAGGCTGG + Intronic
1080601748 11:33828001-33828023 CCCTCCTAAGGTCTTTAGACAGG + Intergenic
1083052723 11:59791491-59791513 CCCTAGTTAGGTTTTTGCAAGGG + Intronic
1088787528 11:113195808-113195830 CCCTTAGTAGATTTTTAGACAGG + Intronic
1091611977 12:2018381-2018403 ACATAATTCGGTTTTTATACTGG + Intronic
1095260017 12:40086933-40086955 GCATAATTAGGTCTTGAGACAGG + Intronic
1098109745 12:67109684-67109706 TCCTAGTTCAGTTTTTAGACAGG + Intergenic
1104400051 12:128467899-128467921 CCCTCATGAGGTTTATAGTCCGG + Intronic
1112670740 13:101634620-101634642 CCTTAATTACGTTTTTACAGTGG + Intronic
1116403945 14:44545109-44545131 CTCTAGTTAGTTTTTTGGACAGG - Intergenic
1117373057 14:55096465-55096487 GCTTAATTAGATTATTAGACTGG - Intergenic
1131624417 15:94102400-94102422 CCCCAATTCGGCTTTCAGACTGG + Intergenic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1149046558 17:52253129-52253151 CACTAATTAGGCTTTTAGGAAGG - Intergenic
1150467036 17:65402829-65402851 CCCTGATGAGATTTTTTGACAGG - Intergenic
1160098227 18:75895928-75895950 CCCTCATTATGTTTAGAGACAGG + Intergenic
1161846794 19:6716222-6716244 CCCCAATTATTTTTTGAGACAGG + Intronic
1165367423 19:35376935-35376957 CCCTAAATAGGGGTTTAGCCTGG - Intergenic
925129776 2:1486668-1486690 CCCCAATTAGTTTTTTGGAAGGG + Intronic
927322244 2:21760522-21760544 CCCAATTTAGGTTATAAGACTGG - Intergenic
928110631 2:28506113-28506135 CCCAACTTGGGTTTTTAGAAGGG - Intronic
931600144 2:63994775-63994797 CCCAAATTAAGGTTTTAGATGGG - Intronic
932840893 2:75081394-75081416 CCCTCATTATGCTGTTAGACAGG + Intronic
941374891 2:164715428-164715450 CCCTTTTTAGATTTTTACACAGG - Intronic
942532017 2:176921165-176921187 CTAAAATTAGGTTTTTATACAGG - Intergenic
944360357 2:198847519-198847541 CCCTAATTGGGCTTTGAGTCTGG + Intergenic
947097780 2:226585667-226585689 CTCTAATTATATTTTTAGAAGGG - Intergenic
1169713958 20:8594870-8594892 CCCAAATTAGGTGTTTAAAAAGG + Intronic
1170075060 20:12410283-12410305 CCCTCCTCAGGTTCTTAGACAGG - Intergenic
1176742762 21:10619861-10619883 GCATAATTGGGTTTTTAGAAGGG - Intergenic
1179199731 21:39205469-39205491 CCCTATTTATTTTTTAAGACAGG - Intronic
952346786 3:32495575-32495597 CCCTAATTAGAGTTTTAGGCTGG - Intronic
954544106 3:51418038-51418060 CCTTCATTTGGTTCTTAGACTGG - Intronic
958164772 3:89866445-89866467 TCCTAATTAAATTTATAGACTGG - Intergenic
963052460 3:141153678-141153700 ACCTAATTAGGTTGTGAGAGTGG - Intergenic
964366070 3:155951974-155951996 CCATAATTAGGGTTATAGAGAGG + Intergenic
969037463 4:4266230-4266252 CCCTAATTAGGTATGTGGTCTGG + Intergenic
973687458 4:53386982-53387004 CCCTAATTAGGTTTTTAGACAGG + Intronic
981503877 4:145479739-145479761 CCATATTTAGGTTTTTATAATGG + Intergenic
987502359 5:18729946-18729968 CCCTAATAAGGTGGTTAGTCAGG + Intergenic
988963399 5:36391680-36391702 GCCTAATGAGGTTTTTACAAAGG + Intergenic
992940396 5:81755334-81755356 CCCTAACCAGCTTTTTAAACTGG + Intergenic
999661389 5:153866863-153866885 ACCTAATTAGCATTCTAGACAGG - Intergenic
999686524 5:154108120-154108142 CCCTAACAAGGTTCTTAGAATGG + Intronic
1000036889 5:157455601-157455623 CCCCAGTCAGGTTTTCAGACTGG - Intronic
1013049896 6:106522610-106522632 CCCTACTCAGGTTTCTAGCCTGG - Intronic
1013261446 6:108447500-108447522 CCCTAATTAGTTTTTTGGGGTGG + Intronic
1013646638 6:112148973-112148995 CCCTAATTTGGTTATTGGATTGG + Intronic
1015229685 6:130900265-130900287 CAAAAATTAGGTTTTTAAACAGG - Intronic
1016712141 6:147186000-147186022 CCCTGATTAGATTTTTACATTGG + Intergenic
1020971905 7:14954042-14954064 CCCTAATAAAGTGATTAGACCGG - Intronic
1021882283 7:25106518-25106540 CCCTAGTTGGGTTTTTTTACAGG - Intergenic
1023071697 7:36441237-36441259 ACCTAATTAGTTTTTTAGATGGG + Intronic
1026710755 7:72737350-72737372 CCTTAATGAGATTTTTAGAAAGG - Intronic
1034267144 7:149786514-149786536 TCCAAATTAGGTTTTTGGCCAGG + Intergenic
1039327536 8:36501789-36501811 CACTAACTAGGTTTTTACAAAGG - Intergenic
1043851780 8:85224445-85224467 CCCTAATTTTTTTTTTAAACAGG + Intronic
1044142507 8:88672807-88672829 CCCAAATTAAGGTTTTAGATGGG + Intergenic
1061745263 9:132734728-132734750 ACCTATTTATGTATTTAGACAGG - Intronic
1062681482 9:137784334-137784356 CCCCAATGAGGTTTTGAGGCTGG - Intronic
1189587785 X:42478306-42478328 CCCTACTTAGATTTCAAGACAGG + Intergenic
1190743330 X:53305217-53305239 CCTTATTTATTTTTTTAGACAGG + Intronic
1191125313 X:56947786-56947808 CCCAAATTAAGGTTTTAGATGGG - Intergenic
1194723117 X:97363778-97363800 CCCGAAATGGGTTTCTAGACAGG + Intronic
1201050809 Y:9933010-9933032 CATTCATTAGGTTTTTAGAATGG - Intergenic
1202303255 Y:23440578-23440600 CCCTAATTAGTTTGTAGGACTGG - Intergenic
1202567556 Y:26230016-26230038 CCCTAATTAGTTTGTAGGACTGG + Intergenic