ID: 973693068

View in Genome Browser
Species Human (GRCh38)
Location 4:53460070-53460092
Sequence GCCTCCTAGAAACTACACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973693068_973693069 3 Left 973693068 4:53460070-53460092 CCATAGTGTAGTTTCTAGGAGGC 0: 1
1: 0
2: 1
3: 7
4: 79
Right 973693069 4:53460096-53460118 TGTACACACACTCTTCATTGTGG 0: 1
1: 0
2: 1
3: 15
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973693068 Original CRISPR GCCTCCTAGAAACTACACTA TGG (reversed) Intronic
900915268 1:5633054-5633076 GCCTCTTAGCACCTACACGAAGG + Intergenic
904753625 1:32755853-32755875 CTCTCCTAGAATCTGCACTAAGG + Intronic
910734282 1:90435038-90435060 GCCTCCTTAAAGCTACCCTAAGG - Intergenic
911802207 1:102156259-102156281 CCCTCCTAGCACCTCCACTATGG + Intergenic
914430649 1:147618226-147618248 GCCTCCTGGAAACTCCAGGAGGG + Intronic
915641206 1:157228277-157228299 GACTCCTAGAAACATTACTAAGG + Intergenic
915668275 1:157464664-157464686 GACTCCTAGAAACATTACTAAGG - Intergenic
916659828 1:166912849-166912871 GCCTGCTAGAAATTACACTTGGG - Exonic
919629809 1:199949350-199949372 TCCTCATGGAAACCACACTAAGG - Intergenic
1068252842 10:54466440-54466462 GACACCAAGAACCTACACTAGGG - Intronic
1080297336 11:30745346-30745368 GCTTCCTGGAACCTATACTAGGG - Intergenic
1086558828 11:88143780-88143802 GCCTTCTACAAACTGAACTATGG + Intronic
1088460693 11:110079768-110079790 GCCTCCTGGAAACTATATTCTGG - Intergenic
1088680115 11:112233145-112233167 GCCTCCTAGAGACAAAACCAAGG - Exonic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1094386449 12:29899449-29899471 GCTTCCTAGAACCTACATTTAGG - Intergenic
1094616452 12:32040658-32040680 GCCTACTAGCAAATACACAATGG + Intergenic
1100427876 12:94504044-94504066 GCCTCCTAGAAACTGATCAAGGG - Intergenic
1100871450 12:98914512-98914534 GGCTCCTAGAGACCACTCTAAGG - Intronic
1101582387 12:106053391-106053413 ACCACCCAGAAACTCCACTAGGG + Intergenic
1110252267 13:73393881-73393903 GCCACATAGAAACAACAGTATGG + Intergenic
1110976661 13:81844920-81844942 GCCTCCACGAAAATACACAATGG - Intergenic
1122192559 14:100057771-100057793 GACTCCTAGAACCTCAACTATGG - Intronic
1124509546 15:30311660-30311682 GGCCCCTAGAAACTTCACTGAGG - Intergenic
1124734014 15:32227002-32227024 GGCCCCTAGAAACTTCACTGAGG + Intergenic
1134085682 16:11356022-11356044 GCCTGCTATAAACTACACAGGGG - Intergenic
1138930744 16:61653071-61653093 GCCTCCTAGATTATACAGTACGG - Exonic
1140381240 16:74489637-74489659 GCACCCTAGAAACAACACTGTGG + Intronic
1141462435 16:84185567-84185589 GCCTCCCAGAAAATGCACTAGGG + Intronic
1145725397 17:27116492-27116514 GCCTTCTAGCAAATACAATAAGG + Intergenic
1148762577 17:50014594-50014616 CCCTCAGAGAAACTCCACTAGGG - Intergenic
1150559472 17:66282206-66282228 GCCTCCTAGATACTGCCCTCTGG - Intergenic
1154111608 18:11573317-11573339 GGCTCCCAGAAACTTCACTCTGG - Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1161841771 19:6686043-6686065 GCCTCCTAGAGAAGACACTGAGG - Intronic
1164731532 19:30508606-30508628 GCCTCTTAGAAATTAAACCAGGG - Intronic
1165778841 19:38420531-38420553 GCGTCCTAGGAACTAGACTGGGG + Intronic
1167516107 19:49924126-49924148 ACCTCCCAGAGACTACACCATGG + Intronic
928487150 2:31744305-31744327 AATTCCTAGAAACTTCACTAAGG + Intergenic
934646047 2:96059972-96059994 GCCTCCAAGACACTACCCCATGG + Intergenic
934839451 2:97616062-97616084 GCCTCCAAGACACTACCCCATGG + Intergenic
936866807 2:117084308-117084330 ACCTTCTAGCAACTAGACTAAGG - Intergenic
938032781 2:128009646-128009668 GTCTGCTAAAAACTCCACTAAGG + Intronic
941024420 2:160442821-160442843 GCCTGCTAGAAAGGGCACTAAGG + Intronic
941220252 2:162769523-162769545 GCCTTCTATAGACTATACTAAGG + Intronic
942418307 2:175781550-175781572 GCCTCGTAGAACCTGTACTATGG - Intergenic
943075184 2:183185897-183185919 GCTCCCTAGAAACTGCACAAAGG - Intergenic
1170977155 20:21175708-21175730 GCCTCCTAGAGACTTAACTAAGG - Intronic
1179458255 21:41514571-41514593 GACCCCTAGAAATTTCACTAAGG + Intronic
1179975571 21:44863956-44863978 GCCTCCTCAAACCTACGCTACGG + Intronic
1180253881 21:46609018-46609040 ACCTGCTAGAAACTTCACTGAGG - Intergenic
951566114 3:24013946-24013968 CCCTCCCAGAAACAAGACTAAGG - Intergenic
952470491 3:33645222-33645244 GCGTGCTAGAAGATACACTATGG - Intronic
967409225 3:189150695-189150717 GCCTCGGAGAAACTTCACTGAGG - Intronic
971978346 4:33720647-33720669 GCCTCCTAGCAACTAGACCTTGG + Intergenic
973143629 4:46798170-46798192 GACTCCTAGAAATTTCACTGAGG - Intronic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
975429943 4:74277419-74277441 GCATCCTAGTAACTACAATGGGG - Intronic
976670515 4:87647399-87647421 GCCTCCTATAATCTACAATTTGG + Intergenic
985142629 4:186858117-186858139 GCCTCCTAGAAACAACCTAAAGG + Intergenic
988258129 5:28848119-28848141 GCGTCCTAGAAACTTCACTGAGG - Intergenic
996908771 5:128632538-128632560 GACTCCTAGAAATTTCACTGAGG + Intronic
997737769 5:136227080-136227102 ACCTCCTACAAACTACACTCAGG - Intronic
1002831618 6:826980-827002 TACTCCTAGAAACTTCACTAAGG - Intergenic
1004681990 6:17904915-17904937 GCCTCCTGGAAATTAGCCTAAGG + Intronic
1007413830 6:41680440-41680462 GCCTCCTAAAAACTAACCTCAGG - Intergenic
1009885452 6:69618772-69618794 GCCTGCTTAAACCTACACTAAGG + Intergenic
1010369005 6:75085758-75085780 GGCTCCTAGAAACTGAACTCGGG + Exonic
1012175929 6:96084617-96084639 GTCTCATAGAAATTAGACTAAGG + Intronic
1015549528 6:134397712-134397734 GTCTCCTAGAAGCTACATTTAGG - Intergenic
1016642652 6:146367166-146367188 GACTCCAAGAAAATACACTGGGG - Intronic
1027920411 7:84386375-84386397 GCCTCCTAGTAACCACAGCAGGG + Intronic
1029986687 7:104929166-104929188 GTCTCCTTGAAACTCCACTCTGG + Intergenic
1034474603 7:151275277-151275299 GCCTCCTTGAATCTACGCTGGGG - Intronic
1036527401 8:9547951-9547973 GACCCCTAGAAACTTCACTGGGG + Intergenic
1046284137 8:112073632-112073654 GCCCCCTTGAAAACACACTAAGG + Intergenic
1047435131 8:124829781-124829803 ACCACCCAGAAACTAGACTAAGG + Intergenic
1047445307 8:124913953-124913975 GCCCCCTAGAACCTAGACTGGGG - Intergenic
1048641535 8:136368867-136368889 GTCTCATATAAACTACACTTGGG - Intergenic
1050067470 9:1775495-1775517 GACTCCTAGAAACCTCACTGAGG + Intergenic
1054843928 9:69772432-69772454 GACTCCTAGAAACTTCACTAAGG + Intergenic
1187068571 X:15865304-15865326 ACCTCCTAGAGACTACTCTGAGG - Intergenic
1190255126 X:48756758-48756780 GACTCCTAGAAATTTCACTGAGG - Intergenic
1191095769 X:56671614-56671636 GACTCCTAGAAACTTTACTGAGG + Intergenic
1196815250 X:119660383-119660405 GCCTCCTTGAAATTGCACTGAGG - Intronic
1199310490 X:146314853-146314875 GACTCCTAGAAATTTTACTAAGG + Intergenic
1199371667 X:147056892-147056914 GCCTCCTAGAAATTTCACTTGGG + Intergenic
1199499300 X:148492482-148492504 AACTTCTAGAAACTACACTTTGG + Intergenic