ID: 973693069

View in Genome Browser
Species Human (GRCh38)
Location 4:53460096-53460118
Sequence TGTACACACACTCTTCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973693068_973693069 3 Left 973693068 4:53460070-53460092 CCATAGTGTAGTTTCTAGGAGGC 0: 1
1: 0
2: 1
3: 7
4: 79
Right 973693069 4:53460096-53460118 TGTACACACACTCTTCATTGTGG 0: 1
1: 0
2: 1
3: 15
4: 109
973693064_973693069 30 Left 973693064 4:53460043-53460065 CCTCTATGAAATAAATTAATTAA 0: 1
1: 0
2: 4
3: 92
4: 894
Right 973693069 4:53460096-53460118 TGTACACACACTCTTCATTGTGG 0: 1
1: 0
2: 1
3: 15
4: 109
973693066_973693069 4 Left 973693066 4:53460069-53460091 CCCATAGTGTAGTTTCTAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 89
Right 973693069 4:53460096-53460118 TGTACACACACTCTTCATTGTGG 0: 1
1: 0
2: 1
3: 15
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973693069 Original CRISPR TGTACACACACTCTTCATTG TGG Intronic
900883619 1:5400358-5400380 TGTTTATACACTCTTCAGTGTGG + Intergenic
903223580 1:21882535-21882557 TGTACCTACACTCTTCATTACGG + Intronic
903465218 1:23547324-23547346 CGTACACACACCCTTCCTTGGGG - Intergenic
905493553 1:38364481-38364503 TGTATATACCCTCTTCATTGAGG - Intergenic
906385168 1:45362010-45362032 TGTACACACATTCTCTATCGTGG - Intronic
906391250 1:45418608-45418630 TTCACACTCACTCTCCATTGAGG - Intronic
910535043 1:88288042-88288064 TGTTCACAGACTATTCACTGAGG + Intergenic
913252620 1:116924533-116924555 TTTACTTACACTCTTCTTTGGGG - Intronic
917837926 1:178955352-178955374 TGTACACACATTTTTCTTTTTGG - Intergenic
919022170 1:192120535-192120557 TGTACACATAATCTTCATTGAGG + Intergenic
920974746 1:210775300-210775322 TGTACAGAGACTGTTCTTTGTGG + Intronic
922708713 1:227809438-227809460 TATACACACACCCAACATTGGGG + Intergenic
1063982849 10:11470002-11470024 TGTATATACACTGCTCATTGTGG - Intronic
1068146036 10:53071808-53071830 TATATACACACTCTTAATTCAGG - Intergenic
1069177289 10:65308524-65308546 TACACACACACACTTCTTTGTGG - Intergenic
1071709467 10:88035576-88035598 TTTTCACATACTCTTCATTGGGG + Intergenic
1072471380 10:95717298-95717320 CTTACACACATTGTTCATTGAGG + Intronic
1073831110 10:107384600-107384622 TGTACAAAGACTCTTAAGTGTGG - Intergenic
1075270345 10:121043982-121044004 TGTACACACTCTGTTCTTTTGGG + Intergenic
1077746449 11:4912052-4912074 TTAACACACATTCTTCTTTGTGG + Intronic
1078458510 11:11494714-11494736 AGTACACACACTCCTCATCCTGG + Intronic
1081216819 11:40410466-40410488 TCTACACACAGTGTTCATTACGG - Intronic
1082908691 11:58344251-58344273 TGTACACACACTTGTCATCATGG + Intergenic
1083556795 11:63635937-63635959 TGTCCACACCATCTTCCTTGAGG + Intronic
1085901463 11:80704721-80704743 TTCACACTCACTGTTCATTGTGG - Intergenic
1089669154 11:120040415-120040437 CCTGCACACACTCTCCATTGGGG + Intergenic
1091069931 11:132553456-132553478 TGCATGCACACTCTTCCTTGTGG - Intronic
1101118541 12:101555324-101555346 TGTACGCAGTCTCTTCATTGAGG + Intergenic
1108297157 13:49034395-49034417 GGTACACACACTTGTCATTTGGG + Intronic
1111717279 13:91895324-91895346 TATACACACACAGTTCACTGTGG - Intronic
1114302571 14:21391667-21391689 TGAGCACATACTCTTCTTTGGGG + Intronic
1115070366 14:29315341-29315363 TGTACACAAATTCTGCTTTGTGG - Intergenic
1115211681 14:30972842-30972864 TTTAGACACACTTTTCGTTGTGG - Intronic
1116050679 14:39799498-39799520 TGTATACATACTATTCATTCAGG - Intergenic
1120859979 14:89246439-89246461 TGTAGAATTACTCTTCATTGTGG - Intronic
1126589005 15:50320504-50320526 TGTACACACAGTCTTTTTAGTGG + Intronic
1128589796 15:68885624-68885646 TGTTCACAAACTATTCATTGAGG + Intronic
1137473829 16:48789439-48789461 TGTAGACACTCCCTTCTTTGGGG + Intergenic
1141247849 16:82327070-82327092 TGTCTACACACCCTTCATTCAGG + Intergenic
1146771833 17:35575947-35575969 TGGGCACACAGTCTTCATTTTGG + Exonic
1157302287 18:46487719-46487741 AGTACAGACTCTCTCCATTGTGG - Intronic
1157799045 18:50603468-50603490 TCTACACACACACATTATTGGGG + Intronic
1158123539 18:54077264-54077286 TGTACACAAACTCTTGATACTGG - Intergenic
1158546327 18:58400416-58400438 TGTATAGACACTGTTCATTAAGG - Intronic
1158779184 18:60626025-60626047 TGTACACACACTAGGCATTGTGG - Intergenic
1159218511 18:65428658-65428680 TGTACACAGAGTCCTCAGTGGGG + Intergenic
1159498836 18:69241826-69241848 TGGACACATACTCTGCTTTGTGG - Intergenic
1160241785 18:77130207-77130229 GGTACACTCACTCATCATTGGGG + Intronic
1161184810 19:2910370-2910392 TCTACAGACATTCATCATTGGGG + Intronic
1162469317 19:10862958-10862980 TCTACACACAGTCTTCCTAGGGG - Intronic
925220196 2:2133060-2133082 TGTACACACCGTCTTCTTTGGGG + Intronic
926153536 2:10437473-10437495 TGTACACACACAGTTTGTTGGGG + Intergenic
928057966 2:28077611-28077633 AGAACAAATACTCTTCATTGTGG + Intronic
930108040 2:47655408-47655430 TGTACACTTTCCCTTCATTGTGG - Intergenic
939489797 2:142863767-142863789 TGTAAACACAGTCTTTTTTGTGG + Intergenic
940114133 2:150189460-150189482 AGTACAGAAACTCTTCTTTGAGG + Intergenic
942945549 2:181668291-181668313 TCTAGCCACACTCTTGATTGAGG + Intronic
947958919 2:234218288-234218310 TGTACACACACAGTTTCTTGGGG + Intergenic
1170485274 20:16809387-16809409 TGTACACACACACAGTATTGGGG + Intergenic
1170528336 20:17263655-17263677 TTTACATACATTCTTAATTGTGG + Intronic
1174025438 20:47570097-47570119 TGTTCACAGAATCTTCACTGGGG + Intronic
1174163808 20:48570566-48570588 TGTAGACACACTCTTGCCTGTGG - Intergenic
1176688190 21:9873540-9873562 TTTACACACACACATCAGTGGGG - Intergenic
1177602346 21:23332131-23332153 TGAACACACACTGGGCATTGAGG + Intergenic
1178731723 21:35109753-35109775 TGTACACAAACTTTTCATTTCGG - Intronic
1181504856 22:23346432-23346454 GCTACAAACACTCTTCATTTGGG - Intergenic
951686944 3:25354944-25354966 TGAGCACACACTCTGCATTCAGG + Intronic
953830454 3:46293558-46293580 TAGACTCACACTCTGCATTGTGG + Intergenic
956319072 3:67975138-67975160 TATATAGACACTCTTCCTTGAGG + Intergenic
956380048 3:68655573-68655595 GGTATACAAACTCCTCATTGTGG + Intergenic
957006928 3:74959705-74959727 TGTACCAACACTATTTATTGAGG + Intergenic
957356717 3:79098190-79098212 TGTACACACTGTTATCATTGTGG + Intronic
960810307 3:121621786-121621808 TGTCCAAACACTCCTCACTGGGG - Exonic
961848718 3:129793327-129793349 AGTGCACACACTCTACACTGGGG + Intronic
962427653 3:135286636-135286658 TGAACAAACACTCTACAATGAGG + Intergenic
962720823 3:138173577-138173599 AGTTCTCACGCTCTTCATTGGGG - Exonic
970168040 4:13260814-13260836 TGTACAGAAACTCTTCCTTTTGG + Intergenic
971583833 4:28378996-28379018 TTTAGACACACACTTCATTAAGG + Intronic
973226570 4:47791670-47791692 TATACACACACTTTTCATTCTGG + Intronic
973693069 4:53460096-53460118 TGTACACACACTCTTCATTGTGG + Intronic
976339431 4:83930061-83930083 TATACACACACACTTTATTTTGG + Intergenic
977358228 4:95973042-95973064 TATTCTCACACTGTTCATTGAGG + Intergenic
981322806 4:143412370-143412392 TGAAAGCACTCTCTTCATTGTGG + Intronic
985170583 4:187145477-187145499 TGTAGACACACTGTTCATTAAGG + Intergenic
986173870 5:5335221-5335243 TGGACAGAGACTCTTCTTTGAGG - Intergenic
986529462 5:8720731-8720753 TTTGCACACACTCTACAATGTGG + Intergenic
988488648 5:31688743-31688765 TATTCATTCACTCTTCATTGAGG - Intronic
988672327 5:33395278-33395300 TGCACAAAAACTCTTCAATGGGG - Intergenic
988707603 5:33741077-33741099 TGCACACACACACCTCAGTGAGG - Intronic
990853179 5:60230760-60230782 TGTTTACACAATCTTCATTGAGG + Intronic
992466481 5:77011193-77011215 TTTGCACACACTCTTCTTTCGGG + Intergenic
993915300 5:93737463-93737485 TATACACACACACACCATTGTGG - Intronic
994225436 5:97247062-97247084 CACACACACACACTTCATTGGGG + Intergenic
996092041 5:119361034-119361056 GGTACAGACACTCTTCCTTGGGG + Intronic
998949295 5:147375686-147375708 TGAACAGACACTCTTCTGTGAGG - Intronic
1000766564 5:165298934-165298956 TATACACACAGAATTCATTGTGG + Intergenic
1001649119 5:173302656-173302678 GGGACACACACTCATCCTTGTGG - Intergenic
1002947245 6:1774542-1774564 TTTACACACAATCATCATTTGGG - Intronic
1003351540 6:5322393-5322415 GGGACAAACACTCTTCATTGTGG - Intronic
1004350479 6:14886166-14886188 TGTTCACACTCTCCTCCTTGAGG - Intergenic
1008252665 6:49259069-49259091 TGAAAACACACTCTACAGTGTGG - Intergenic
1011173188 6:84529229-84529251 TGAACACACACTTCTCATAGAGG - Intergenic
1011198984 6:84813885-84813907 TGTTCATACACTGTTCTTTGAGG - Intergenic
1011588842 6:88951625-88951647 TGAACACACATTCCCCATTGGGG + Intronic
1019585075 7:1796257-1796279 TCTAAGGACACTCTTCATTGAGG - Intergenic
1020908124 7:14091556-14091578 TGAACACCCACATTTCATTGTGG + Intergenic
1021249339 7:18305048-18305070 TGCTCACACACTCTTCCTTCAGG + Intronic
1028157195 7:87443901-87443923 TATACACACAATCTTCATCTTGG - Intronic
1030465102 7:109891080-109891102 TATACACACACACATCCTTGTGG + Intergenic
1033540768 7:142353658-142353680 GGGACACACAGTCTTCTTTGGGG + Intergenic
1036023433 8:4874813-4874835 TTTACACACACACTTAATTCTGG + Intronic
1041600270 8:59709029-59709051 TGTAAACATACTCTCCAGTGCGG - Intergenic
1043935906 8:86141975-86141997 TGTACACAAATTGTTCATTCTGG - Intronic
1046593336 8:116231465-116231487 TGTTCACACATTCTTTGTTGTGG + Intergenic
1048341959 8:133547106-133547128 TGCACGCACACTCTGCAGTGTGG + Intronic
1048456843 8:134586085-134586107 AGTACACACACCATACATTGGGG - Intronic
1048528416 8:135225798-135225820 TGTTCAGACACTGTTGATTGTGG + Intergenic
1050208276 9:3222632-3222654 TGAAAAAACACTCTTCATTTTGG - Exonic
1050208549 9:3226820-3226842 TTAACACAAACTCTTCATGGTGG + Intronic
1052029065 9:23607999-23608021 AGTACACACACAGTTTATTGTGG + Intergenic
1058584129 9:106488320-106488342 TGTACTCACCCTTTTCACTGAGG - Intergenic
1059054195 9:110961746-110961768 TGTACACACTCTCTTGCCTGCGG - Intronic
1195228981 X:102827001-102827023 TCTGCACTCACTCTTCATTTGGG - Intergenic
1196103875 X:111875500-111875522 TACACATACACACTTCATTGTGG - Intronic
1197285525 X:124590912-124590934 TATACACACACCCAACATTGGGG - Intronic
1201666993 Y:16468947-16468969 TGAACACTCAGTCTTCACTGAGG + Intergenic