ID: 973695512

View in Genome Browser
Species Human (GRCh38)
Location 4:53486557-53486579
Sequence CCCGGAATGTTTCCTACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973695501_973695512 26 Left 973695501 4:53486508-53486530 CCCTGGGCAGACAACACACTGGG 0: 1
1: 0
2: 0
3: 13
4: 153
Right 973695512 4:53486557-53486579 CCCGGAATGTTTCCTACTGCAGG No data
973695503_973695512 25 Left 973695503 4:53486509-53486531 CCTGGGCAGACAACACACTGGGA 0: 1
1: 0
2: 2
3: 18
4: 188
Right 973695512 4:53486557-53486579 CCCGGAATGTTTCCTACTGCAGG No data
973695506_973695512 1 Left 973695506 4:53486533-53486555 CCTTGAGGACATGGTTCCTGCCC 0: 1
1: 0
2: 1
3: 24
4: 256
Right 973695512 4:53486557-53486579 CCCGGAATGTTTCCTACTGCAGG No data
973695499_973695512 30 Left 973695499 4:53486504-53486526 CCTGCCCTGGGCAGACAACACAC 0: 1
1: 0
2: 0
3: 19
4: 192
Right 973695512 4:53486557-53486579 CCCGGAATGTTTCCTACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973695512 Original CRISPR CCCGGAATGTTTCCTACTGC AGG Intronic
No off target data available for this crispr