ID: 973696367

View in Genome Browser
Species Human (GRCh38)
Location 4:53494701-53494723
Sequence GGTTAGATGCAGAAATTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973696367_973696375 18 Left 973696367 4:53494701-53494723 CCCTCCAATTTCTGCATCTAACC 0: 1
1: 0
2: 1
3: 15
4: 202
Right 973696375 4:53494742-53494764 AGAACTTAACAGATATTTGCTGG 0: 1
1: 0
2: 2
3: 34
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973696367 Original CRISPR GGTTAGATGCAGAAATTGGA GGG (reversed) Intronic
900730692 1:4257333-4257355 TGTTAGATTCAGAAGTTGGATGG + Intergenic
904101013 1:28027238-28027260 TGTTAGAGGAAGAACTTGGAAGG + Intronic
907497967 1:54857800-54857822 GGTTAGCTGCATAATTTGTAGGG - Intronic
908170602 1:61500915-61500937 GATCAGAAGCAGAAGTTGGAGGG - Intergenic
911292275 1:96071544-96071566 AGTTAGATTCAGAACTTGGGAGG + Intergenic
918904347 1:190474137-190474159 GGTTAGAGGAAGAAATGGGAAGG - Intronic
920805379 1:209229024-209229046 TGTTTAATGCAGAAATTGGCTGG + Intergenic
920822427 1:209393443-209393465 GGTTATTTGCAGACAATGGAGGG + Intergenic
921668005 1:217895506-217895528 GATTAGAGGCAGATTTTGGAAGG - Intergenic
923779368 1:237008542-237008564 GGGTAGACGAAGAACTTGGAGGG - Intergenic
924012384 1:239679855-239679877 GGTTAGACGCAGAAATTAAGAGG - Intronic
1063284420 10:4669078-4669100 TGTAAGATGCAGACATTAGATGG - Intergenic
1066083380 10:31954387-31954409 GGTAACAGGCAGAAGTTGGAGGG + Intergenic
1066326357 10:34363656-34363678 GATAAGGTGCAGAATTTGGATGG - Intronic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1070699634 10:78591812-78591834 GGTTGGATGCAGAAGTGGCATGG - Intergenic
1074089457 10:110235050-110235072 TCTAAGAAGCAGAAATTGGATGG - Intronic
1074645676 10:115449440-115449462 GGTTGCATGAACAAATTGGAGGG - Intronic
1077546312 11:3171711-3171733 GGATGGAGGCAGAGATTGGAGGG - Intergenic
1078040408 11:7856421-7856443 GGTTAGATGCAGAGATACCAGGG - Intergenic
1081036114 11:38148662-38148684 GGTGAGATGCATAAATTTGTGGG - Intergenic
1081141500 11:39506547-39506569 GAGTAGAGGCAGAAATTGTAGGG + Intergenic
1083196502 11:61091662-61091684 TGTAAAATGCAGAGATTGGATGG - Intergenic
1084666630 11:70579855-70579877 GGATGGAAGCAGAAGTTGGAGGG + Intronic
1084766686 11:71313811-71313833 GGTTAAATACAGACATTAGAGGG + Intergenic
1085361345 11:75890481-75890503 GCTTAGATGAAGTAACTGGATGG + Intronic
1085832624 11:79917676-79917698 GGTGGAAAGCAGAAATTGGATGG - Intergenic
1086451626 11:86922806-86922828 TGTTAGATGCAGGAATATGAAGG - Intronic
1086453745 11:86941878-86941900 TGTTAGATGGAGAAACTGAAGGG - Intronic
1087263570 11:96037671-96037693 GGTTAGAACCAGCAATTGGCTGG + Intronic
1087660935 11:100987085-100987107 GGTGAGATCCAAAAATTGAAAGG - Intronic
1088838648 11:113603410-113603432 AGTCAGAAGCAGAGATTGGAGGG + Intergenic
1089142619 11:116299167-116299189 AGATAAATGCAGAAATTGAAAGG - Intergenic
1089699682 11:120237028-120237050 GCTCAGATTCAGAAACTGGAGGG + Intronic
1091030354 11:132181601-132181623 GGTTTGATTCAAAAATGGGAAGG + Intronic
1091203758 11:133803014-133803036 GGAGACATGCAGAAATTGAAGGG + Intergenic
1091446761 12:548191-548213 GGGTAGATGCAGAAGGTGGGAGG - Intronic
1091485520 12:883762-883784 TGTTTGTTGTAGAAATTGGAAGG + Exonic
1092913969 12:13172840-13172862 GGATAGATGGAGAAAGGGGAAGG - Intergenic
1093563536 12:20573969-20573991 GCTTAGAAGCAGAAAATGCAGGG - Intronic
1093670770 12:21872643-21872665 GGTGAGATGCAGACATTGGAAGG - Exonic
1096517127 12:52163028-52163050 GCCTAGAGGCAGAGATTGGAGGG - Intergenic
1098357617 12:69626507-69626529 TGTCAGATGAAGAAATAGGAGGG + Intergenic
1098641750 12:72847024-72847046 GTTTAGAGGTAGAAATTGGTTGG - Intergenic
1099610490 12:84862183-84862205 AGAAAGAAGCAGAAATTGGAAGG - Intronic
1104463649 12:128973648-128973670 GGTGAGAGGCAGAAAAGGGAGGG - Intronic
1105234792 13:18539563-18539585 GTTTCTATGCAGAAATTGCATGG + Intergenic
1106843428 13:33711037-33711059 GGTTAAATGCACATCTTGGAGGG - Intergenic
1107600204 13:42005145-42005167 TGTTGGATGTAGAAATCGGATGG + Intergenic
1108166466 13:47698506-47698528 GTCTAGATGCAGAAATTGTATGG + Intergenic
1109153637 13:58876264-58876286 GTTTAGAGGAAGAAATTGAAAGG + Intergenic
1110152916 13:72276605-72276627 GATTAGATTTAGAAATTAGAAGG - Intergenic
1110440020 13:75517343-75517365 GGCTGGATGTAGAAACTGGATGG + Intergenic
1111306248 13:86416590-86416612 AGTTACATACAAAAATTGGATGG - Intergenic
1111451831 13:88428882-88428904 GGTCACATGAACAAATTGGAAGG - Intergenic
1111967796 13:94878464-94878486 GGATGGAAGCAGAGATTGGAGGG + Intergenic
1112652005 13:101409645-101409667 GGTTAGATAAAGAAGGTGGATGG + Intronic
1113862152 13:113493977-113493999 GGTTAGATGCAGCAAAAGTAAGG - Intronic
1114925921 14:27398356-27398378 GGTTGGATGTAGAAATTATAAGG + Intergenic
1116700745 14:48238277-48238299 GGTTTTATGCAGAAATTCGTAGG + Intergenic
1117972388 14:61265052-61265074 GGTTAGAAGTTGACATTGGAAGG + Intronic
1119981456 14:79086290-79086312 GGTTAGAGGCAGAGGTAGGAAGG + Intronic
1123842855 15:24267016-24267038 GGTTACATGCATGAATTGTATGG + Intergenic
1123852413 15:24373003-24373025 GGTTACATGCATGAATTGTATGG + Intergenic
1123857894 15:24433042-24433064 GGTTACATGCATGAATTGTATGG + Intergenic
1123954058 15:25315410-25315432 TGATAGAGGCAGAGATTGGAGGG - Intergenic
1127907169 15:63384426-63384448 GGTTTGATGAAGAACATGGATGG - Intergenic
1135106868 16:19657419-19657441 GTTTATCTGCAGAAATGGGAAGG - Intronic
1138143408 16:54587442-54587464 GTTTAGCTGGAGACATTGGAGGG - Intergenic
1138775707 16:59721298-59721320 GAATAGATGCAGATATTAGATGG + Intronic
1139153637 16:64414921-64414943 AGTTAGATGCAGGCATGGGAAGG - Intergenic
1140197355 16:72866051-72866073 CGTGAGATGCCCAAATTGGAAGG + Intronic
1140564614 16:76027069-76027091 GGTCACATGAACAAATTGGAGGG - Intergenic
1142313417 16:89327604-89327626 GGTAGCATGCAGAAATAGGATGG - Intronic
1143707315 17:8707921-8707943 GGTTAGATGCAGAAACATGAAGG + Intergenic
1149276051 17:55038652-55038674 GGTTATATGCAGAAAGGGCAAGG + Intronic
1153748610 18:8206916-8206938 GGACAGAGGCAGAGATTGGAGGG + Intronic
1153749033 18:8210390-8210412 GGACAGAGGCAGAGATTGGAGGG + Intronic
1153908968 18:9689757-9689779 GGTGACATACAGAAAATGGAAGG - Intergenic
1154360225 18:13654561-13654583 GCTTAGCTTCAGAAGTTGGAGGG - Intergenic
1154998138 18:21660902-21660924 GGTAAAATGCACAAATTAGAAGG + Intronic
1157108350 18:44796024-44796046 GATTAGAAGCACAAATTGGAAGG - Intronic
1157311802 18:46558668-46558690 GGGTAGAGGCAGGAATGGGAAGG + Intronic
1159835197 18:73327716-73327738 GGTAAAATGGAGAAATTGTAAGG - Intergenic
1163350697 19:16774811-16774833 GATCAGATGAAGAAAATGGAAGG - Intronic
1163966741 19:20753199-20753221 TGTTAGCTGCAGCAATTAGAGGG - Intronic
1166239555 19:41480631-41480653 AGTTATATGAAGAAACTGGAGGG - Intergenic
928966664 2:36982749-36982771 AGTTAGATGCAGGAATTGATAGG - Intronic
929388884 2:41444639-41444661 TGTTATATGCATAAATAGGATGG + Intergenic
930353551 2:50288919-50288941 AGTCAGATGCAGAGATTGTAGGG + Intronic
930533215 2:52615533-52615555 GGTCACATGAACAAATTGGAGGG - Intergenic
935594959 2:104871160-104871182 GTTTGGATGCAGAATTGGGATGG - Intergenic
938514998 2:131995062-131995084 GTTTCTATGCAGAAATTGCATGG - Intergenic
939188476 2:138887868-138887890 GGTCAGTTGCCAAAATTGGAAGG + Intergenic
940871809 2:158866995-158867017 GGTTAGCTGCAGCAATCAGAGGG + Intergenic
941257656 2:163253625-163253647 GCTTTGATGCAAAAATTGGCAGG - Intergenic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
943245359 2:185442051-185442073 GCTCAGATGCAGAAATAGGATGG + Intergenic
944076836 2:195742371-195742393 GGTTAGAGGCAGAAATTTGTTGG - Intronic
1169610504 20:7374683-7374705 GTTTAGATACAGAAATAAGAAGG - Intergenic
1170426813 20:16243336-16243358 GGCTAGAGGCATAAATTTGAAGG + Intergenic
1175571271 20:60024601-60024623 AGTCAGATGCAGTGATTGGATGG + Intronic
1175655534 20:60766517-60766539 TGTGGGATGCAGAAATTGGCTGG + Intergenic
1176778784 21:13167851-13167873 GTTTCTATGCAGAAATTGCATGG + Intergenic
1177108256 21:16988814-16988836 GGGTTGATGAAGAAATTAGAAGG - Intergenic
1177560466 21:22744262-22744284 GATTGGATCAAGAAATTGGAGGG + Intergenic
1177976423 21:27856978-27857000 GTTTCTATGCAGAAATTGCATGG + Intergenic
1182205906 22:28626373-28626395 GGAGAGAGACAGAAATTGGAAGG + Intronic
1184004014 22:41695848-41695870 AGTTAGATAGTGAAATTGGAGGG + Exonic
949666955 3:6350140-6350162 GGTTTGATGCAGTAATAGGTGGG - Intergenic
951725713 3:25756219-25756241 GGGTAGGTGCAGAAAATGAATGG - Intronic
954794640 3:53155253-53155275 GGGCAGAGGCAGAAATTGGCAGG - Intergenic
955783418 3:62510177-62510199 AGATAGATGCAGAAATAGGTAGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
957543213 3:81603082-81603104 GGTTAGAAGAGGAAAATGGAAGG - Intronic
958913435 3:100021359-100021381 GCTGAGATGCTGAACTTGGAAGG - Intronic
962935947 3:140080892-140080914 GGTAAGAAGCAGAAGTGGGATGG - Intronic
964019297 3:151988533-151988555 GGTTGGATGCAGAAATATTATGG - Intergenic
964804600 3:160594513-160594535 AATTAGATGGACAAATTGGATGG + Intergenic
965002896 3:162980578-162980600 AGACAGAGGCAGAAATTGGAGGG - Intergenic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
965351965 3:167624251-167624273 GGCTATATGCACAAAATGGAAGG + Intronic
965703035 3:171477981-171478003 GGTTAGCTGCAGTAGTTTGAAGG - Intergenic
967552361 3:190811399-190811421 GGTTAGCTACTGAAATTAGATGG - Intergenic
968768736 4:2489499-2489521 TGTTAGATACGTAAATTGGAGGG + Intronic
969215789 4:5721292-5721314 TGATATATGCAGACATTGGAAGG + Intronic
970789647 4:19841626-19841648 GCTTAGATCCAGGAAATGGATGG + Intergenic
972157485 4:36182194-36182216 AGTAAGATGCAGAAACTGGCCGG + Intronic
973696367 4:53494701-53494723 GGTTAGATGCAGAAATTGGAGGG - Intronic
974937715 4:68428194-68428216 GGTAAGATGCAGATCTAGGATGG - Intergenic
975000173 4:69215275-69215297 GGGTGGATGCAGAAATTTGGTGG - Intergenic
975004446 4:69268859-69268881 GGTTAAATCCAGTAGTTGGAGGG + Intergenic
975936066 4:79582418-79582440 GTTTAGATGTAGAAGTTGGTGGG - Intergenic
978857628 4:113411362-113411384 GGTTAGATTCAGAATCTTGACGG + Intergenic
979194921 4:117909364-117909386 GGTTACATGGATAAATTAGATGG + Intergenic
980249875 4:130301290-130301312 TGTTAGATGCAATAATTTGATGG - Intergenic
982241301 4:153302468-153302490 GGTAAGCTGTAGAAATGGGAAGG + Intronic
982958555 4:161805070-161805092 GGTGAGCTGCTGAAATGGGATGG - Intronic
983339863 4:166447285-166447307 GCTTAGATTAAGAAATAGGAAGG + Intergenic
984589565 4:181601903-181601925 AGCTGGAGGCAGAAATTGGAAGG - Intergenic
984886576 4:184455191-184455213 GGTTAGAAGAAGAAGGTGGAGGG - Intronic
984947125 4:184978361-184978383 GGTTAGAGACAGAAAGAGGACGG - Intergenic
986275404 5:6270875-6270897 GGTTAGATGAAGCACGTGGATGG - Intergenic
986482416 5:8202576-8202598 GTCTAGATGAAGAAATTGGGAGG - Intergenic
987292828 5:16524488-16524510 GGTTTGATGCTGAAAGTAGATGG - Intronic
987335345 5:16893835-16893857 TGTTACGTGCTGAAATTGGAGGG + Intronic
987668209 5:20972933-20972955 GGATAGAATCAGAAATTCGAAGG - Intergenic
989103714 5:37841722-37841744 AGTTAGATTCAGAAATTAGAGGG + Intergenic
990974958 5:61551835-61551857 GGTTAGCAGCAGATAGTGGAAGG + Intergenic
991178364 5:63718331-63718353 GTTTAGTTGCAGAAAATGGATGG + Intergenic
993057663 5:83001045-83001067 GGCCAGATGCAGAAATGGGTGGG + Intergenic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
998739155 5:145179067-145179089 TGATAGATGCAGAAATTTCAAGG + Intergenic
1000461489 5:161525778-161525800 AGTTAGATGCATTAGTTGGATGG - Intronic
1001930524 5:175669704-175669726 TGTTAGCTGCAGCAATGGGAGGG - Intronic
1001954788 5:175841743-175841765 GGTTAGAAGCAGAGACTGAATGG + Intronic
1003687554 6:8319461-8319483 GGTTAGATGAAGAGTTTGCATGG + Intergenic
1008959010 6:57246780-57246802 GGGCAGATGCAGAAACTGGCAGG - Intergenic
1009539008 6:64926469-64926491 GGTTAGATCCAGAGCTTGGTTGG + Intronic
1010256422 6:73763494-73763516 GGTTAGATGGAGAGATTTGGTGG + Intronic
1011194632 6:84768449-84768471 AGCTAGAAGCAGAAATGGGACGG + Intergenic
1011221980 6:85064304-85064326 TGTAAGACGCAGAAATTGGCTGG + Intergenic
1012388549 6:98709918-98709940 GGTGTGATGCAGTGATTGGAAGG - Intergenic
1015015424 6:128407043-128407065 AGTTGGAAGCAGAAATTGGAGGG - Intronic
1019617114 7:1969025-1969047 GGCAAGTTGCGGAAATTGGACGG - Intronic
1022020548 7:26396591-26396613 GGTTAGGTGCAGATTGTGGAGGG + Intergenic
1022980126 7:35596420-35596442 GGAGAGAGGAAGAAATTGGATGG - Intergenic
1023243912 7:38179762-38179784 GGTTGTATGGAGAAATGGGATGG + Intronic
1024700059 7:51897078-51897100 GGTGAGCTGCACAAAATGGAGGG - Intergenic
1026977426 7:74507051-74507073 GGCTTGATGCAGAAATGTGACGG + Intronic
1027600003 7:80228243-80228265 GGACAGATGCAGAGATTGGAGGG - Intergenic
1028833358 7:95348675-95348697 GGAGAGATGAAGAAATTGGCAGG + Intergenic
1033826336 7:145194724-145194746 GGTTAGTTGGAGAAATTTCAGGG + Intergenic
1033952440 7:146801603-146801625 GGTTAGATCCAGAAATATGGTGG + Intronic
1033965088 7:146965574-146965596 GGGTACAAGCAGAAGTTGGATGG + Intronic
1034738014 7:153446870-153446892 GGTGAGATGTATAAGTTGGAAGG - Intergenic
1037311774 8:17563683-17563705 GGTCAGATTCAGCATTTGGATGG + Exonic
1037658355 8:20906522-20906544 TATTAGATGCAGGCATTGGAGGG + Intergenic
1038798734 8:30730976-30730998 TGTTAGCTGCAGCAATTAGAGGG + Intergenic
1038826951 8:31013781-31013803 GGTTAGAAGCTGAAAATTGAGGG + Intronic
1038829359 8:31040094-31040116 GATTAGATGCAGAATGTGAAAGG + Intronic
1039392133 8:37189808-37189830 GCTTGAGTGCAGAAATTGGAGGG + Intergenic
1040684870 8:49859937-49859959 GGCCAGATGAAGAAATTGGTGGG + Intergenic
1041842425 8:62287778-62287800 GGTTAGAATCAGAATGTGGAAGG - Intronic
1042061093 8:64818840-64818862 TCTTAGCTGCAGAAATTTGAGGG + Intergenic
1042680447 8:71377733-71377755 GGGTAGAGGCAGAAATTGGGAGG - Intergenic
1044359006 8:91259553-91259575 GGTGAGATTCAGATATTGAAGGG - Intronic
1044688660 8:94854642-94854664 GGTTAAAGGCAGCATTTGGAAGG + Intronic
1044915505 8:97109159-97109181 GGCTAGAAGCAGGAATGGGATGG - Intronic
1045439028 8:102191684-102191706 GATAAGAGGCAGAAGTTGGAAGG - Intergenic
1047754611 8:127908906-127908928 GGTTCAAAGCTGAAATTGGATGG - Intergenic
1048019912 8:130528425-130528447 GGTTCTCTGCAGAAATTGGCTGG + Intergenic
1048773712 8:137922393-137922415 TGTAAGATGCAGAAAATGGAAGG + Intergenic
1050874713 9:10619460-10619482 TGTTAGATGCAAAATTTAGATGG - Intergenic
1059261114 9:112977703-112977725 GGTTAAATACAGATATTGGCAGG - Intergenic
1060474690 9:123977884-123977906 AGATGGAAGCAGAAATTGGAGGG - Intergenic
1060476672 9:123992239-123992261 AGATGGAAGCAGAAATTGGAGGG + Intergenic
1185613614 X:1406989-1407011 GGATAGATGCATGGATTGGATGG + Intronic
1185632673 X:1526696-1526718 GGATAGATGGATGAATTGGATGG - Intronic
1185752876 X:2628050-2628072 GCTTAGATGCAGCTGTTGGAGGG + Intergenic
1185866969 X:3632743-3632765 GTTTAGAGACAGAAATTTGAGGG - Intronic
1185953978 X:4468775-4468797 GGTTACATGGATAAATTGTATGG + Intergenic
1185997984 X:4974175-4974197 GGTTAGATGCAAAATTTTGGGGG - Intergenic
1186367957 X:8915206-8915228 GGATAGATCCAGAAAGTGTAGGG - Intergenic
1186924033 X:14312440-14312462 TTTTAGATTCAGAAATTGCATGG - Intergenic
1188461994 X:30438584-30438606 GTTTTGATGCAGAAAATGGAAGG - Intergenic
1191767103 X:64709941-64709963 GGTTGCATGAACAAATTGGAGGG + Intergenic
1191925405 X:66303971-66303993 GGGCAGATGCAAATATTGGATGG - Intergenic
1193636011 X:83949395-83949417 GGTTGGATGCAGAGCTTTGAGGG + Intergenic
1194203221 X:90979614-90979636 GGTAAGAAGCAGAAAATAGAGGG + Intergenic
1194984115 X:100471640-100471662 GATGAGATACAGAAATAGGAAGG + Intergenic
1196635875 X:118002169-118002191 GGTTAGATGCACGAAATAGATGG + Intronic
1197106053 X:122717596-122717618 GGTTAGATGCTAAGATTTGAGGG + Intergenic
1197621247 X:128752248-128752270 GGTAAAATGCAGTAATTGGTGGG + Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1199363438 X:146949242-146949264 TTTTAAATGCAGAATTTGGAGGG - Intergenic
1200549052 Y:4555040-4555062 GGTAAGAAGCAGAAAATAGAGGG + Intergenic
1200797027 Y:7350188-7350210 GTTTAGAGACAGAAATTTGAGGG + Intergenic
1201379463 Y:13357656-13357678 GGCTAGAGGTAGAAACTGGAAGG + Intronic