ID: 973698105

View in Genome Browser
Species Human (GRCh38)
Location 4:53510905-53510927
Sequence CTCTGCTGCCCCATCAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973698100_973698105 2 Left 973698100 4:53510880-53510902 CCTAGTAAAAGAAACTGGCACCT 0: 1
1: 0
2: 0
3: 26
4: 176
Right 973698105 4:53510905-53510927 CTCTGCTGCCCCATCAATGGGGG 0: 1
1: 0
2: 0
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973698105 Original CRISPR CTCTGCTGCCCCATCAATGG GGG Intronic
900523016 1:3115269-3115291 CCCAGCTGTCCCATCAGTGGGGG + Intronic
903546753 1:24128967-24128989 CTCTGCAGGCTCATCAATGCTGG + Intronic
905466554 1:38158688-38158710 CTCAGCTGTCCCATGTATGGTGG + Intergenic
907924745 1:58944715-58944737 CGCTGCTCCCCCATCAGAGGAGG - Intergenic
907938883 1:59067920-59067942 TTCTGCAGCCCCATCAGTGGAGG + Intergenic
910392421 1:86758650-86758672 CTTGGCTGCCCCATTGATGGTGG + Intergenic
912258473 1:108085210-108085232 GTCGCCTGCCCCAGCAATGGTGG + Intergenic
913291332 1:117274901-117274923 CTCTGCTGCCCCTTCAAAGAAGG - Intergenic
915276404 1:154791759-154791781 CTCTGCTGCCAAATGAATGGGGG + Intronic
917674354 1:177305074-177305096 CTCTCCTGTCCCAACAAAGGGGG + Intergenic
1062799692 10:369889-369911 CTCTCCTGCCCCCTCTATGCAGG + Intronic
1063493350 10:6485306-6485328 CTGAGCTGTTCCATCAATGGTGG - Intronic
1068909039 10:62358683-62358705 CAATGCTGCCCCTTCCATGGTGG - Intergenic
1069678610 10:70267512-70267534 CTGTGCTGCAGCATCATTGGAGG - Intronic
1070282962 10:75063153-75063175 AGCTGCTGCCCCCTTAATGGAGG - Intergenic
1070779942 10:79131701-79131723 CTCTGCTGCCCCCTGAGTTGGGG + Intronic
1070835155 10:79443386-79443408 CTCTGCTCCCCCTACCATGGTGG - Intronic
1071007030 10:80895009-80895031 CTCTGCTCTCCCAGCAGTGGTGG - Intergenic
1074298069 10:112209480-112209502 TGCTGCTGCCCCATCCCTGGGGG + Intronic
1074839973 10:117341311-117341333 CTCTCTTGCCTTATCAATGGGGG - Intronic
1075341239 10:121648281-121648303 ATCTGGTGCCCCATGCATGGGGG + Intergenic
1077896672 11:6458069-6458091 CTCTCCTGCCCCAACCATGAAGG - Exonic
1083904768 11:65662591-65662613 CTCTGCTCCCCCACCCAGGGAGG + Intronic
1084414325 11:69022303-69022325 CTCTACTGCCCCAGTAAGGGTGG - Intergenic
1088591585 11:111408194-111408216 TTCTCCTGCCCCATCAAGTGTGG - Intronic
1089115075 11:116088235-116088257 CTCTGCTTCCCCATCCCTGGAGG - Intergenic
1089337027 11:117732321-117732343 CTCTGCTGCCACATCACTGTTGG - Intronic
1090200065 11:124847578-124847600 CTCTGGTGCCAAACCAATGGGGG + Intergenic
1090617339 11:128527295-128527317 ATCTGCAGCCCCAACAATGTGGG + Intronic
1091805800 12:3355053-3355075 CACTGCTGCCCCTTCTAGGGTGG + Intergenic
1092407244 12:8229607-8229629 CACTGCTTCCCCCTCAGTGGTGG - Intergenic
1101630754 12:106491795-106491817 CTCTACTTCCCCAGCAATTGAGG + Intronic
1102578285 12:113871042-113871064 CTGTGCTGGCCCCTAAATGGTGG - Intronic
1109662116 13:65474633-65474655 CCTAGGTGCCCCATCAATGGGGG + Intergenic
1115125478 14:29988177-29988199 CTCTTCTGCCCCATCAGCAGAGG - Intronic
1116114511 14:40629893-40629915 CTCTGCCGCCCCGGCAATGAGGG - Intergenic
1117244976 14:53875724-53875746 TTCTGCTGCCCCTTGAAAGGGGG + Intergenic
1120130910 14:80806750-80806772 CTCTGCTGCCACATTAATATTGG - Intronic
1120827198 14:88966702-88966724 CTCTAAAGCCCCAGCAATGGAGG - Intergenic
1120942075 14:89958212-89958234 ATCTGCAGCCCAATGAATGGGGG + Intronic
1124945589 15:34262612-34262634 ATCTGCAGCCCCATGGATGGCGG - Intronic
1128604816 15:69028564-69028586 CCCTGCTGCCCCAGAAAGGGGGG - Intronic
1128923285 15:71631338-71631360 CTCTGCTCCTCTGTCAATGGAGG - Intronic
1129095478 15:73202439-73202461 CTCTTATGCCCCATCCAAGGAGG - Intronic
1129701052 15:77768932-77768954 CACTGCAGCCCCATCACTGCAGG + Intronic
1132866242 16:2094005-2094027 CTCTGCTTCCCCAGGACTGGTGG - Exonic
1134008067 16:10831646-10831668 CTCTGCAACCCCATCTAAGGGGG - Intergenic
1137338859 16:47578624-47578646 TTCTCCTGCCCTATAAATGGAGG - Intronic
1141076563 16:81011095-81011117 CTCTGCTGTCCCCTGACTGGAGG + Intronic
1141687229 16:85577357-85577379 CTCTGCTGTCCCTGCAAGGGTGG + Intergenic
1144673645 17:17147080-17147102 CTGTGCTGCCTCTTCACTGGAGG + Intronic
1146804495 17:35854572-35854594 CTCTGCTGCCTCTTCAATCTAGG - Intronic
1147249971 17:39147403-39147425 CTCTGCTGCCCCCTCGGTGTTGG + Intronic
1151545294 17:74789171-74789193 CTATGCTGCCCCATTAGAGGTGG - Intronic
1151807799 17:76417307-76417329 CCCTGGTGCCCCAGCCATGGGGG - Intronic
1154060555 18:11055968-11055990 ATCTGGTTCCCCAGCAATGGAGG + Intronic
1156459521 18:37313904-37313926 CTCCGCTGCCACATCAGTGCTGG + Intronic
1157390139 18:47294982-47295004 CTCTGCTGCACAGTCCATGGTGG + Intergenic
1161585295 19:5102427-5102449 GTCTGCTGACCCTTCAAGGGAGG - Intronic
1161828833 19:6588297-6588319 CCCTGGTGCCCCATCGATGTGGG + Intronic
1163624872 19:18383302-18383324 CTCTGCTGACCCAAGACTGGTGG - Intronic
1165166212 19:33859012-33859034 CACTGCAGCCCCATAAAAGGGGG + Intergenic
1166597092 19:44059583-44059605 CTCTGCTGCCATATCCTTGGGGG + Intronic
1167035175 19:46990982-46991004 CTCTCCTGCCCCATCCCTGTGGG - Intronic
1167449872 19:49560779-49560801 CTCCGCTTTCCCATCAAGGGGGG - Intronic
928595424 2:32855309-32855331 ATCTGCTTCCCCATGTATGGGGG + Intergenic
931501614 2:62875087-62875109 CACTGCTGCCCCATCCCTGCTGG + Intronic
932068125 2:68588416-68588438 CTCTGAGGCCTCAGCAATGGAGG - Intronic
932322513 2:70832656-70832678 CTTTCCTGCCCCAGCAATTGTGG + Intronic
937998813 2:127715823-127715845 CGCCGCCGCCCCATCACTGGTGG - Intronic
941278190 2:163517176-163517198 CTCTGTTGAGCCAGCAATGGAGG + Intergenic
942398531 2:175577081-175577103 CTCTGCTGCTGAATCAGTGGGGG - Intergenic
943494766 2:188606648-188606670 CCCTGCTGCCCCGGCAATGAGGG - Intergenic
945195063 2:207229810-207229832 GTCTTCTACACCATCAATGGAGG - Intergenic
947063246 2:226190728-226190750 CTCTTCTTGCCCATCAATAGAGG + Intergenic
947201943 2:227621825-227621847 CTCTGCAGCCCCAGGAATGAAGG - Intronic
948628994 2:239289738-239289760 CTCTGGTGCCCCATCAGGCGGGG - Intronic
1171344353 20:24454292-24454314 CTCTGCTTCCCCATTGATTGTGG - Intergenic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1172765360 20:37347880-37347902 CTCCACTGCCCCATCACTGGAGG - Intronic
1174561347 20:51432687-51432709 ATCTGCAGCCCCACCCATGGAGG - Exonic
1178400073 21:32278243-32278265 CTCTGCGGCTCTATCACTGGAGG + Intronic
1178453622 21:32727655-32727677 CTCTTCTGGCGCATAAATGGAGG - Intronic
1178956698 21:37029118-37029140 CCCTGCTGGCCCATCTTTGGGGG - Intergenic
1180592981 22:16956446-16956468 CTGTGCTTCCCCTTCAATGCAGG + Intergenic
1181261247 22:21599411-21599433 CTCAACAGCCCCATCAATGTAGG - Intronic
1181682505 22:24505594-24505616 CTCTGCTGAACCATCTCTGGAGG + Intronic
1181757199 22:25032366-25032388 CTCTACTGCCTCTTCACTGGGGG - Intronic
1182667067 22:31967699-31967721 CTCCTCTGCACCCTCAATGGTGG - Intergenic
1183472206 22:38015662-38015684 CTCAGCTGCCCCCTCTGTGGGGG + Intronic
950053978 3:10011088-10011110 CGCTGCTGCCCCAACACAGGCGG - Intronic
952960172 3:38584071-38584093 CTCTGCTGTCCCATCATGAGGGG - Intronic
954976425 3:54699360-54699382 CTCTTCTGCCCCATTAAAGAAGG - Intronic
955874738 3:63477093-63477115 CTCTGCTCCCCCATGTAAGGAGG + Intronic
960047729 3:113213082-113213104 CTCTACTGCCACATCTCTGGAGG - Intronic
970086410 4:12352258-12352280 CTCTCCTGCCCCAGCTATTGGGG + Intergenic
971314363 4:25554875-25554897 CTAAGCTGCCCCATCCAGGGAGG + Intergenic
973698105 4:53510905-53510927 CTCTGCTGCCCCATCAATGGGGG + Intronic
984047017 4:174814044-174814066 CTCTGCAGCAGCATCAAGGGGGG + Intronic
985162648 4:187060681-187060703 CTCTGCTGCCCCAGCGAGGATGG + Intergenic
987207704 5:15644496-15644518 CTCTCCTGCCACATCAAAGGTGG + Intronic
989188783 5:38649751-38649773 CTCTGTTTCCCCATAAATGCAGG - Intergenic
990825087 5:59890674-59890696 GTCTCCTGCCTCATCAAAGGTGG - Intronic
994730497 5:103485524-103485546 CTCTGCTGCTGCATAAATCGAGG - Intergenic
997285285 5:132673462-132673484 CTCTCCTACCCCAGCACTGGGGG - Intergenic
1001080205 5:168662076-168662098 CTCTGCTTCCCCATCATGTGGGG + Intronic
1004361428 6:14974558-14974580 CTCTGCTGCCTCCTCCATGTGGG - Intergenic
1006180570 6:32151341-32151363 CTCTGCTGTTCCTTCAGTGGGGG + Intronic
1006914050 6:37583289-37583311 CTCTGCTGAACCATCAGGGGAGG + Intergenic
1007747864 6:44054319-44054341 CTCTGGTGCCCAATCAGTGCTGG + Intergenic
1010198542 6:73263387-73263409 CTCCGCTGGCTCAGCAATGGGGG - Intronic
1012989215 6:105907974-105907996 CCCAGCTGCCCCACCAATGATGG + Intergenic
1018800256 6:167216682-167216704 TTCTGCTGCCCCAGTAATGCAGG - Intergenic
1018812843 6:167309824-167309846 TTCTGCTGCCCCAGTAATGCAGG + Intronic
1019653168 7:2171750-2171772 CTCTGCTGCCCTTTGCATGGCGG - Intronic
1021065914 7:16172161-16172183 CTCTACTGCCTTATCTATGGTGG - Intronic
1024055751 7:45658991-45659013 CTGTGCTGCCCCATCTACAGGGG - Intronic
1024258342 7:47556415-47556437 CTCTGCACCCCCATGAATGTGGG + Intronic
1024471695 7:49773555-49773577 CTCTGCTGCCCCCGCTCTGGAGG - Intergenic
1025086628 7:56028704-56028726 CTCTGCTGCCCAATCAAGCAGGG - Intronic
1026468606 7:70675629-70675651 CTCTGCTCCACCATGACTGGTGG + Intronic
1029629079 7:101739315-101739337 CTCTGCTGCCCTACCCGTGGGGG - Intergenic
1033755331 7:144394361-144394383 GAATGATGCCCCATCAATGGTGG + Intergenic
1041992998 8:64017096-64017118 ATCTTCTGCCCCACCAGTGGGGG - Intergenic
1042059495 8:64801390-64801412 CTCTGCTGTCCCAGCAGTGACGG - Intergenic
1043077046 8:75715560-75715582 CTCTGCAGCCCAATGAATGGGGG - Intergenic
1043448987 8:80348027-80348049 CTCTGCTGCCCCAGCAGTGCAGG - Intergenic
1049407690 8:142459019-142459041 CACTGGTCCCCCAGCAATGGGGG + Intronic
1049578202 8:143399135-143399157 CTCTGCTTCCCCACCGAGGGAGG - Intergenic
1052643472 9:31200542-31200564 CTCTGATGGCACACCAATGGGGG - Intergenic
1056287629 9:85107577-85107599 CTCTGCTTCCCCCTCCCTGGTGG - Intergenic
1058746060 9:107991745-107991767 CTCTGCTGCCAGACCAAGGGTGG - Intergenic
1060374604 9:123107179-123107201 CTCTCCTGCTCCTTGAATGGCGG - Intergenic
1061002022 9:127907973-127907995 CTCGGCTGCCCCAACCAGGGCGG + Exonic
1061074414 9:128332466-128332488 CTCTGCTGCTCCATTAGTGCAGG - Intronic
1061371553 9:130200527-130200549 CTCGGCTGCCCCACCTATGTGGG - Intronic
1061390787 9:130316066-130316088 CTCTGCTGCACCACCGAGGGTGG + Intronic
1185658019 X:1701747-1701769 CTCTGCTGAGTCATCAATGCTGG - Intergenic
1185658031 X:1701833-1701855 CTCTGCTGAGTCATCAATGCTGG - Intergenic
1188328173 X:28833217-28833239 CCTGGGTGCCCCATCAATGGTGG - Intronic
1188886813 X:35560974-35560996 CCCTGTTGCCCCATCACTGCTGG + Intergenic
1194682278 X:96869140-96869162 CTCTGCTCCCCCAAAAATGAGGG - Intronic
1195285177 X:103376745-103376767 CCCTGCTTCCCCATCCCTGGGGG - Intronic
1195889451 X:109676496-109676518 CTCTGCTCCTCCAACACTGGGGG - Intronic
1195966983 X:110437789-110437811 ATCTGCTGCCCCCTCAATCCTGG - Intronic
1199245414 X:145598809-145598831 GGCTGCAGCACCATCAATGGGGG + Intergenic