ID: 973698628

View in Genome Browser
Species Human (GRCh38)
Location 4:53515208-53515230
Sequence CTGGCGGCCTTAAGTGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973698628_973698633 10 Left 973698628 4:53515208-53515230 CCCACATCACTTAAGGCCGCCAG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 973698633 4:53515241-53515263 TCAGCTCTGCCTTGGCTAGCTGG 0: 1
1: 0
2: 1
3: 23
4: 192
973698628_973698636 21 Left 973698628 4:53515208-53515230 CCCACATCACTTAAGGCCGCCAG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 973698636 4:53515252-53515274 TTGGCTAGCTGGTTAGCTGCGGG 0: 1
1: 0
2: 1
3: 6
4: 76
973698628_973698632 2 Left 973698628 4:53515208-53515230 CCCACATCACTTAAGGCCGCCAG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 973698632 4:53515233-53515255 AAGACACATCAGCTCTGCCTTGG No data
973698628_973698635 20 Left 973698628 4:53515208-53515230 CCCACATCACTTAAGGCCGCCAG 0: 1
1: 0
2: 0
3: 1
4: 59
Right 973698635 4:53515251-53515273 CTTGGCTAGCTGGTTAGCTGCGG 0: 1
1: 0
2: 1
3: 7
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973698628 Original CRISPR CTGGCGGCCTTAAGTGATGT GGG (reversed) Intronic
903564421 1:24253945-24253967 CTGGTGGCCTTAAGTGAGGCAGG - Intergenic
905442811 1:38005617-38005639 CTGGCGGCCGAAAGGGAGGTGGG - Intergenic
923950579 1:238947505-238947527 CTGGGGGCCATCAGTGAAGTTGG + Intergenic
1067082829 10:43221336-43221358 CTGGTGGCACTAACTGATGTGGG - Intronic
1067118880 10:43456980-43457002 CAGGTGGCCTTGAGAGATGTGGG + Intronic
1069577372 10:69540606-69540628 CTGGCTGCCCTAAGTGGTGCTGG + Intergenic
1073217320 10:101843648-101843670 CTGGCGGCCTACTGTGCTGTCGG + Intronic
1075850187 10:125580627-125580649 CTAGCGGGCTTCAGTAATGTGGG - Intronic
1078430087 11:11281765-11281787 TTGGCTGCCTGAAGGGATGTGGG + Intronic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1084496336 11:69505771-69505793 CTGGAGGCCCTTGGTGATGTGGG - Intergenic
1084510073 11:69597772-69597794 TTGGCCCCCTTAAGTGATGCTGG - Intergenic
1086176609 11:83899373-83899395 CTGGAGGTGTGAAGTGATGTTGG + Intronic
1098030392 12:66247749-66247771 CTGAAGGACTTTAGTGATGTGGG - Exonic
1101267740 12:103108299-103108321 TTGGCCTCCTTAAGTGATTTGGG - Intergenic
1121478930 14:94244212-94244234 CTGAAGGCCTACAGTGATGTCGG - Intronic
1121593827 14:95143246-95143268 ATGGCTGTCCTAAGTGATGTAGG - Intronic
1121838229 14:97110762-97110784 CTGGCGTCCTTAAGAGAAGAGGG - Intergenic
1130733281 15:86521775-86521797 CTGGAGGCCATAAGTCAAGTGGG + Intronic
1135491493 16:22913359-22913381 CTTGAGACCTTAAGGGATGTGGG - Intronic
1135522157 16:23185994-23186016 CTGGGGGCCGTAAGAGAAGTAGG + Intronic
1141739643 16:85882502-85882524 CTGGCCACATTAAGTCATGTGGG - Intergenic
1144378411 17:14668532-14668554 CTGGAGGGATTAAGTGCTGTTGG - Intergenic
1147462352 17:40581429-40581451 CAGGCTGCCTTTACTGATGTTGG + Intergenic
1148244445 17:46021311-46021333 CTGTCCGCCTCAAGAGATGTGGG + Intronic
1152175031 17:78781962-78781984 CTGGCGGCGCTGAGGGATGTGGG - Intronic
1157492054 18:48130343-48130365 CTGGGGGCTTTAAGGGAAGTGGG + Intronic
1161741659 19:6024623-6024645 CTGGGGGCAGAAAGTGATGTAGG - Intronic
1162740107 19:12769325-12769347 CTCCTGGCCTCAAGTGATGTGGG + Intronic
1164634291 19:29781245-29781267 CTGGCTGCCCCAAGTGATGCCGG + Intergenic
1165211980 19:34243283-34243305 CTGGATGCCTTAAGAGATGGTGG + Intergenic
925290591 2:2745777-2745799 TTGGGGGCTATAAGTGATGTTGG - Intergenic
931080630 2:58765914-58765936 CTGGCAGCATAAAGTGGTGTGGG + Intergenic
948881009 2:240857119-240857141 CTGTCGCCCTTAGGTGCTGTAGG - Intergenic
1171217643 20:23363404-23363426 CTGGAGGCCTTAGGTGGGGTTGG + Intronic
1171825541 20:29899673-29899695 ATTGAGGCCTTTAGTGATGTAGG + Intergenic
1180199967 21:46218189-46218211 CTGGCTTCCTTGAGTGTTGTGGG - Intronic
953902715 3:46852236-46852258 ATGGAGGCCTTAAGAGAGGTCGG - Intergenic
954573778 3:51663435-51663457 CTGGGGGCCCCAAGTGAGGTGGG - Exonic
960278777 3:115757372-115757394 TTGGAGGCCTTCAGCGATGTTGG - Intergenic
961459704 3:127042646-127042668 CTGGCTGCCTGGAGTGAGGTTGG + Intergenic
968359851 3:198139214-198139236 CTGCCGGCCTTCAGTGCTGATGG - Intergenic
969323953 4:6430167-6430189 CTGGCTGCTTTCAGTGATCTTGG - Intronic
971203725 4:24540236-24540258 CTGGCTGCTTTAAATGATGATGG - Exonic
973698628 4:53515208-53515230 CTGGCGGCCTTAAGTGATGTGGG - Intronic
986212627 5:5688768-5688790 CTGGCTGCAGAAAGTGATGTGGG - Intergenic
994205373 5:97028903-97028925 CCAGCGGCCTGAAGTGATGGCGG - Exonic
997351560 5:133234805-133234827 CTGCCTGCCTTATGTGGTGTTGG + Intronic
1002842292 6:916467-916489 CTGGCTGACTTAAGTAATGAAGG - Intergenic
1013048037 6:106507342-106507364 CAGGCTGCCTTAAGTAAGGTGGG + Intergenic
1015872435 6:137790712-137790734 CTGGCGGCCTGAGAGGATGTGGG + Intergenic
1033997958 7:147375528-147375550 ATGGCTGCCTTGAGTGGTGTAGG + Intronic
1047221626 8:122923279-122923301 CTGGGGGCCTCAAGTGAGATGGG + Intronic
1053461761 9:38277006-38277028 CTGGCTGCCTGCAGTCATGTGGG - Intergenic
1056679653 9:88706084-88706106 CTGGCAGCCTTACGGGATGCAGG + Intergenic
1060410896 9:123399540-123399562 CTGACAACCTTAAGGGATGTTGG + Intronic
1060658305 9:125387952-125387974 CTGGCTGCCAGAAGGGATGTGGG + Intergenic
1203356678 Un_KI270442v1:156448-156470 ATTGTGGCCTTTAGTGATGTAGG - Intergenic
1186975938 X:14904964-14904986 CTGGGGGCCTTAAGTGACAATGG - Intronic
1195660255 X:107371046-107371068 CTTGTGGCCTTCAGTGTTGTAGG + Intergenic
1197661483 X:129178704-129178726 CTGTGGGCCTGAAGTGATGGTGG - Intergenic