ID: 973699633

View in Genome Browser
Species Human (GRCh38)
Location 4:53523851-53523873
Sequence CAGGGGAAGCAGGAGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1234
Summary {0: 1, 1: 0, 2: 10, 3: 127, 4: 1096}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973699633_973699643 12 Left 973699633 4:53523851-53523873 CCACCATCCTCCTGCTTCCCCTG 0: 1
1: 0
2: 10
3: 127
4: 1096
Right 973699643 4:53523886-53523908 GATTTGGTTATTTATAGTCATGG 0: 1
1: 0
2: 1
3: 13
4: 292
973699633_973699638 -10 Left 973699633 4:53523851-53523873 CCACCATCCTCCTGCTTCCCCTG 0: 1
1: 0
2: 10
3: 127
4: 1096
Right 973699638 4:53523864-53523886 GCTTCCCCTGGCAGTGATAGAGG 0: 1
1: 0
2: 0
3: 16
4: 145
973699633_973699644 27 Left 973699633 4:53523851-53523873 CCACCATCCTCCTGCTTCCCCTG 0: 1
1: 0
2: 10
3: 127
4: 1096
Right 973699644 4:53523901-53523923 AGTCATGGAATAAGTTGATTAGG 0: 1
1: 0
2: 0
3: 15
4: 182
973699633_973699642 -4 Left 973699633 4:53523851-53523873 CCACCATCCTCCTGCTTCCCCTG 0: 1
1: 0
2: 10
3: 127
4: 1096
Right 973699642 4:53523870-53523892 CCTGGCAGTGATAGAGGATTTGG 0: 1
1: 1
2: 0
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973699633 Original CRISPR CAGGGGAAGCAGGAGGATGG TGG (reversed) Intronic
900300849 1:1976382-1976404 GAGGGGAAGCAAGAGGGTGGAGG - Intronic
900427014 1:2585539-2585561 AAGGGGAAGCACTAGGAGGGAGG - Intergenic
900428636 1:2591888-2591910 GTGGGGAAGCATGGGGATGGTGG + Intronic
900851047 1:5143344-5143366 TAAGAGAAGCAGGAGGAGGGAGG + Intergenic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901291449 1:8127387-8127409 CTGGGGAAGGAGGGAGATGGAGG - Intergenic
901395921 1:8981449-8981471 CTGAGAAAGCAGGAGGAAGGAGG - Intergenic
901629831 1:10642669-10642691 CCAGGGAGGCGGGAGGATGGCGG + Intronic
901737542 1:11321998-11322020 CAGGCTCAGCAGAAGGATGGAGG - Intergenic
902218312 1:14948708-14948730 CAGAGAAAGCAGTAGCATGGAGG + Intronic
902403854 1:16172545-16172567 CAGGAGAAACAGTAGGGTGGAGG - Intergenic
902410337 1:16208274-16208296 CAGGGGCAGCAGCAGGGAGGAGG - Intronic
902529957 1:17084616-17084638 CACGGGAGGCAGGATGTTGGGGG + Exonic
902620824 1:17649896-17649918 CAGGCGAGGCAGGAGGAGAGAGG + Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903098694 1:21007959-21007981 CAGGAGAAGCTGGAGGACAGAGG - Intronic
903173682 1:21568670-21568692 CTGGGCAAGTAGGAGGATGGAGG + Intronic
903283847 1:22265047-22265069 CAGGGGAAGCAGCTGATTGGGGG + Intergenic
903328480 1:22584989-22585011 CAGGGGCCGCAGGAGCAGGGCGG + Intronic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
903705129 1:25280029-25280051 CAGGAGAAGTGGGAGGATGAGGG + Intronic
903989199 1:27253435-27253457 AAGAGGAAGGAGGAGGAAGGAGG - Intronic
904416252 1:30362760-30362782 CAGGGGAAACAGGAGTGTGGAGG - Intergenic
904464678 1:30700812-30700834 CAGGGGAAACAGGAGCGAGGGGG + Intergenic
904486227 1:30826026-30826048 GATGGGAAGCAGGTGCATGGAGG - Intergenic
904889069 1:33764367-33764389 CAGGGGTGGTAGCAGGATGGGGG - Intronic
904998625 1:34650765-34650787 CTGAGGAAGCAGCAGGAAGGAGG + Intergenic
905109836 1:35587263-35587285 GAGGCTAAGCAGGAGGATGGAGG + Intronic
905296056 1:36955166-36955188 GAGGGGAAGCAGCTGGCTGGCGG - Intronic
905773758 1:40654938-40654960 CCTGGGCACCAGGAGGATGGAGG - Intronic
905801710 1:40848337-40848359 CAGGGGAAGGAGCAAGATTGTGG - Intergenic
906258412 1:44367986-44368008 CAGGGGCAGCAGGAGGTCGTAGG - Intergenic
907238407 1:53067095-53067117 CAGGGGCAGCAGGGGTGTGGTGG + Intronic
907270802 1:53289934-53289956 GAGGGGAAGCAGGAGTGTGGTGG - Intronic
907342069 1:53742296-53742318 TAGGAGAAGGATGAGGATGGAGG - Intergenic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
907418899 1:54333267-54333289 CAGAGGAGGCGGGAGGATGCAGG - Intronic
907794504 1:57701542-57701564 CAGGGGTAGGGGGAGGAGGGAGG + Intronic
907859522 1:58338279-58338301 GAGGGAGAGCAGGAGGAGGGAGG - Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908236238 1:62149929-62149951 CAGGGGAAGAGGGAGGAGTGTGG - Intronic
909416783 1:75415625-75415647 CAGAGGAAGCAGGAAAATGTGGG + Intronic
910555278 1:88524957-88524979 CAGGGGAGGCAGGAGGCAAGTGG + Intergenic
911829262 1:102530111-102530133 CAGGGAGGGCAGCAGGATGGAGG - Intergenic
912077778 1:105898270-105898292 TAGAGGAAGCTGGAGGAGGGAGG - Intergenic
912102948 1:106234158-106234180 GAGGGGAAGTAGAAGGTTGGAGG + Intergenic
912562119 1:110558450-110558472 AAGGGGAAGGAAGGGGATGGGGG - Intergenic
912778495 1:112522576-112522598 CACAGGCAGCAGGAGGTTGGGGG + Exonic
912804009 1:112741785-112741807 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
914196241 1:145449480-145449502 CAGGGGCAGGAGGGAGATGGAGG - Intergenic
914681163 1:149939186-149939208 GAGGGGCAGCCGGAGGAGGGAGG + Exonic
914918396 1:151831828-151831850 CAGGGGAGGGAGGAGGGCGGAGG + Exonic
914920953 1:151847205-151847227 CAGGGGAGGCAGGAGGCAGGAGG + Intergenic
914920962 1:151847232-151847254 CAGGGGAGGCAGGAGGCAGGAGG + Intergenic
914920978 1:151847279-151847301 CAGGGGAGGCAGGAGGCAGGAGG + Exonic
914920987 1:151847306-151847328 CAGGGGAGGCAGGAGGCAGGAGG + Exonic
915095437 1:153459241-153459263 GAGGAGATGCAGGTGGATGGCGG + Intronic
915112119 1:153570680-153570702 CGGGGGAAGCAGGAGGCTAGAGG - Intergenic
915145593 1:153794304-153794326 TTGGGGAAGCAGAGGGATGGAGG + Intergenic
915280417 1:154818604-154818626 CAGGGAAGGCAGGAGGCTGAGGG - Intronic
915287951 1:154864787-154864809 CAGGCGAGACAGGAGCATGGTGG + Intronic
915351681 1:155230808-155230830 CAGGGGAAGGAGTCTGATGGGGG + Intergenic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915934543 1:160082966-160082988 CATGGGAAGTAAGAGGCTGGGGG + Intronic
916051857 1:161042042-161042064 GAAGGGAATCAGTAGGATGGGGG - Intronic
916217715 1:162411690-162411712 CAGGGAGAGCAGGCAGATGGAGG + Intronic
916332075 1:163628338-163628360 GAGGGGGAGGAGGAGGAGGGAGG - Intergenic
916332090 1:163628376-163628398 GAGGGGAAGGGGGAGGAGGGGGG - Intergenic
916474235 1:165153345-165153367 CAGGTGAAGAAAAAGGATGGTGG + Intergenic
916491576 1:165306882-165306904 CAGGGGGAGGCGGAGGAGGGTGG - Intronic
916738371 1:167628122-167628144 CTGGGGACCCAGGAGCATGGTGG + Intergenic
917038294 1:170773573-170773595 CAGGGGAAGGGGGAGGAAGGGGG + Intergenic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
917514165 1:175693278-175693300 CAAGGGAGACAGGTGGATGGTGG - Intronic
917960851 1:180143161-180143183 TTGGGGAAGCAGGGGGATAGGGG + Intergenic
917965350 1:180175406-180175428 CAGGTGAAGAGGGAGGTTGGGGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918315185 1:183317242-183317264 CAGGGTATGCTGGAGGATGTGGG - Intronic
918511324 1:185316998-185317020 GATGGGAAGCAGGAGGAAGCGGG + Exonic
919420908 1:197369338-197369360 GAGGGGATGCAGGAGGAGAGGGG - Intronic
919738168 1:200966486-200966508 CTGCAGAAGCAGGAGGTTGGGGG - Intergenic
919808174 1:201393082-201393104 CAGGGGAGGAAGGAGTGTGGTGG + Intronic
920376828 1:205513277-205513299 CTCTGGAGGCAGGAGGATGGGGG + Intronic
920377320 1:205516145-205516167 CAGGGTCAGCTGGAGGATGAAGG + Intronic
920844332 1:209581118-209581140 CAGGCACAGGAGGAGGATGGAGG + Intergenic
921117804 1:212110928-212110950 CTGGGGAAGAAGGAGAAAGGAGG - Intergenic
921287368 1:213621396-213621418 CAGGGAAAGCAGGAGTTTGTGGG + Intergenic
921304767 1:213784878-213784900 CTAGGGAAGAAGGAGGATGTAGG - Intergenic
921382540 1:214539658-214539680 GAAGGGAAGAAGGAGGAGGGAGG + Intronic
922190735 1:223316448-223316470 CATGGGAACCTGGAGGAAGGGGG + Intronic
922707086 1:227795495-227795517 CGAGGGAAGGAGGAGGTTGGGGG - Intergenic
922720142 1:227896148-227896170 CAGGGGAGGCAGCTGGATGCTGG - Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
923180184 1:231510088-231510110 CAGCTGAGGCAGGAGAATGGCGG + Intergenic
923280157 1:232436097-232436119 CTAGGGAAGCAGGAGGAATGTGG - Intronic
923436943 1:233976083-233976105 AAGGCGAAGGAGGAGGAGGGAGG + Intronic
923475303 1:234326089-234326111 AAGGAGCAGGAGGAGGATGGAGG + Intergenic
923719682 1:236456251-236456273 CAGAGGAATCAGGGAGATGGAGG - Intronic
924361569 1:243247036-243247058 TTGAGGAAGCAGGAGGGTGGGGG - Intronic
1062805311 10:415386-415408 GAGAGGCAGCAGGAGGAGGGAGG + Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063034889 10:2276653-2276675 CTGGAGAAGCAGGAGTATGGTGG - Intergenic
1063371511 10:5525607-5525629 CAGGGGAGGCAGGGGGATGGGGG - Exonic
1063847330 10:10145222-10145244 CATGGGGAGCAGTAGGAAGGAGG - Intergenic
1063892743 10:10647154-10647176 AACGGGAACCAGGAGGATAGGGG - Intergenic
1064116984 10:12586657-12586679 AGGGGGCAGCAGGAGGGTGGCGG - Intronic
1064340112 10:14477943-14477965 CAGGGGAAGGGAGGGGATGGAGG + Intergenic
1064542016 10:16414814-16414836 CAGGGGAGGCGGGAGGTGGGGGG - Intergenic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1064971041 10:21067465-21067487 AAGAGAAAGCAGGAGGAGGGAGG + Intronic
1065926093 10:30434607-30434629 TACGGGAAGGAGGAGGAAGGGGG - Intronic
1066546652 10:36507463-36507485 CAGAGGAAGAATGAGGTTGGGGG - Intergenic
1066792445 10:39080803-39080825 TAGGGGTTGCAGGAGGATGAAGG + Intergenic
1067048262 10:42997940-42997962 CAGCAGAAGCTGGAGGATGTGGG + Intergenic
1067147284 10:43702828-43702850 CTAGGGAAGAAGGAGGGTGGTGG + Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067370609 10:45678608-45678630 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067375796 10:45727074-45727096 CGGAGGAAGCTGGAGGATAGGGG - Intergenic
1067389172 10:45847548-45847570 CAGGGGAGGCAGCAGGGTGCGGG - Intronic
1067416898 10:46109410-46109432 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067445085 10:46337001-46337023 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067491394 10:46707386-46707408 CAAAGGAAACAGGAGGGTGGAGG - Intergenic
1067502300 10:46816293-46816315 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067592287 10:47523727-47523749 CAGGGGAGGCAGCAGGGTGCGGG - Intronic
1067603270 10:47632992-47633014 CAAAGGAAACAGGAGGGTGGAGG + Intergenic
1067639403 10:48031800-48031822 CAGGGGAGGCAGCAGGGTGCGGG - Intergenic
1067804300 10:49382467-49382489 CTGGGGATGCAGGAAGATGAGGG + Intronic
1067874091 10:49988505-49988527 CAGGGGAGGCAGCAGGGTGCGGG + Intronic
1067883506 10:50067762-50067784 CGGAGGAAGCTGGAGGATAGGGG - Intergenic
1068332953 10:55596948-55596970 CAAAGGAAACAGGAGGGTGGAGG + Intronic
1068860149 10:61839737-61839759 CAGGGGAGGCTGGAGAAAGGAGG - Intergenic
1068905412 10:62316774-62316796 CAGGAGACAAAGGAGGATGGGGG - Intergenic
1069755408 10:70771780-70771802 CAGGGGTGGCAGCAGGCTGGAGG - Intronic
1069776516 10:70930322-70930344 CAGGGGAGGCAGGAAGATGAAGG - Intergenic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1070136391 10:73697950-73697972 CAGGGGAGGCAGCAGGGTGTGGG - Exonic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070171695 10:73937855-73937877 CTGGGGAAGGAGGAGGATGTTGG + Intergenic
1070368277 10:75757290-75757312 CAGGGGAAGAAGGAGGATTTAGG + Intronic
1070545714 10:77450865-77450887 CAGGGGTAACAGAATGATGGGGG + Intronic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1070682273 10:78456947-78456969 CGGGGAAAGCAGGACGAAGGTGG - Intergenic
1070843649 10:79505200-79505222 CAGCGTGAGCAGGAGCATGGAGG - Intergenic
1070930017 10:80254400-80254422 CAGCGTGAGCAGGAGCATGGAGG + Intergenic
1071487634 10:86113298-86113320 GAGGGGAGGCAGCAGCATGGTGG - Intronic
1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG + Intergenic
1071820140 10:89271542-89271564 GAGGGTAAGGAGGAGTATGGTGG + Intronic
1072069136 10:91899738-91899760 CAGGGCAAGTAGGAGGAAGGAGG - Intergenic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1072905646 10:99450924-99450946 CGGGGGAGGCAGGAGGAGCGGGG - Intergenic
1073315725 10:102579408-102579430 CAGGGGAGGTGGGAGGCTGGCGG - Intronic
1073462933 10:103676913-103676935 CTGGGGGAGCTGGAGGGTGGGGG - Intronic
1073479803 10:103779371-103779393 CGGGGGTATCAGGAGGATGCTGG - Intronic
1073482032 10:103791992-103792014 CAGGAGAGGCAGGAGGAAGCTGG + Intronic
1074421079 10:113309344-113309366 GAGTGGAAGCCGGAGGGTGGGGG + Intergenic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074639056 10:115358073-115358095 CAAGAGAAGCAGGATCATGGAGG - Intronic
1074690767 10:116002158-116002180 CAGGGCCGGCAGGGGGATGGTGG + Intergenic
1075250092 10:120861045-120861067 AAGGGGATGCAGAAGAATGGGGG + Intronic
1075481931 10:122789620-122789642 CCTGGGAAGCAGGAGGCTGCAGG - Intergenic
1075668268 10:124245831-124245853 CAGGGACTGCAGGAGGATGCTGG + Intergenic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1075845776 10:125544207-125544229 AATGGGAACCAGGAGGCTGGGGG - Intergenic
1075887456 10:125913738-125913760 CAGGTGAAGCAGGAGGCTCAGGG - Intronic
1075979153 10:126722289-126722311 CAGGGCCAGCTGGGGGATGGAGG + Intergenic
1076068095 10:127464703-127464725 TAGGAGCAGGAGGAGGATGGGGG + Intergenic
1076202476 10:128569483-128569505 CTGGGGAAGGAGGAGGAGAGAGG + Intergenic
1076582164 10:131518948-131518970 CTGGGGAGGAAGGAGGATGCTGG + Intergenic
1076623914 10:131810167-131810189 GAGGAAAAGCAGGATGATGGAGG + Intergenic
1076639044 10:131901419-131901441 GAAGGCAGGCAGGAGGATGGGGG + Intronic
1076726263 10:132414928-132414950 CAGGGGGAGCAGGAGGCTCTCGG - Intronic
1076736449 10:132461283-132461305 GAAGGGGAGGAGGAGGATGGAGG - Intergenic
1076816735 10:132918793-132918815 CAGGGGATGCAGGAGGAGTTGGG - Intronic
1076863038 10:133150988-133151010 CTGGGGAGGCCGCAGGATGGCGG - Intergenic
1076942685 10:133620321-133620343 CAGTGGAAGCTGGAGGATGCCGG - Intergenic
1077204556 11:1336363-1336385 CAGGGGAGGTGGGAGGAGGGAGG - Intergenic
1077387096 11:2275194-2275216 GAGGAGCTGCAGGAGGATGGGGG - Intergenic
1077600562 11:3571764-3571786 CAGGGGTGGCAGGAGGAAAGGGG + Intergenic
1077843441 11:5999298-5999320 CAGGGGAAGCAGCAAGCTTGGGG + Intergenic
1077916551 11:6615394-6615416 CAGGGTAAGAGTGAGGATGGGGG - Intronic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078523980 11:12086663-12086685 GATGGGAAGCAGGAGGCAGGAGG - Intergenic
1078602850 11:12748857-12748879 CAGGGGAGGCAGGGGGACTGGGG + Intronic
1078738179 11:14041188-14041210 TTGGGGAAGAAGGAGGATGGGGG - Intronic
1079503990 11:21133444-21133466 CAGGGACAGCAGGTTGATGGTGG - Intronic
1079738620 11:24029648-24029670 CAGAGGAAGCAGGAGTATGTGGG - Intergenic
1081567759 11:44270381-44270403 CAGGAGAAGAAGGAGGGAGGAGG - Intronic
1081746231 11:45474276-45474298 CTGGGTAGGCAGGAGGCTGGTGG - Intergenic
1081794616 11:45810953-45810975 CAGGGGCAGGAAGAGGATGCAGG - Exonic
1081808634 11:45903195-45903217 AAGGGGAAGCAGTGGGGTGGGGG + Intronic
1082001512 11:47395736-47395758 CCAGGGAGGCAGGAGGAAGGAGG - Intergenic
1083052281 11:59788004-59788026 CGTGGGAAGCAGGAGGAGGATGG - Intronic
1083571782 11:63765135-63765157 CGGGGGCAGCAGGGGGCTGGGGG - Exonic
1083746964 11:64742222-64742244 CTGGGCAAGCAGGAGGTGGGCGG - Intronic
1083855380 11:65390615-65390637 CCGGGGCAGCAGGAAGAGGGTGG - Intronic
1084063193 11:66688860-66688882 CGGGGGTTGCAGGAAGATGGTGG + Intronic
1084717434 11:70882905-70882927 CAGGGCAGGCAGGAGGCAGGTGG + Intronic
1084816299 11:71648966-71648988 CAGGGGTGGCAGGAGGAAAGGGG - Intergenic
1084937020 11:72592317-72592339 CTGGGGAGGGAGGAGGAAGGAGG - Intronic
1084945108 11:72634161-72634183 AAGGGGCAGCAGGAGGAAGCGGG + Intronic
1085034617 11:73292606-73292628 CAGGGGAAAGAGGGGGATGGGGG - Intronic
1085807658 11:79651052-79651074 AAGGAGAAGAAGGAAGATGGAGG - Intergenic
1085923611 11:80988681-80988703 CAGGGGAAGGAGTGGGAGGGAGG + Intergenic
1086420211 11:86631068-86631090 CCTGGGAAACAGGAGGTTGGAGG + Intronic
1086720857 11:90119400-90119422 TAGAGGAAGAAGGAGGATGTTGG + Intergenic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087812516 11:102623516-102623538 CGTGGGAAGTAGGAGGCTGGAGG - Intronic
1087831057 11:102820212-102820234 GAGGGTAAGCAGGAGCAGGGTGG - Intergenic
1088731481 11:112687685-112687707 GAGGGGAAGCAGTAGGCTTGAGG + Intergenic
1088738261 11:112746304-112746326 CAGGGGAGCTAGGAGAATGGAGG + Intergenic
1088813490 11:113406739-113406761 CAGGGGAAGCAGGAAGCTGGTGG - Intergenic
1088899212 11:114102544-114102566 CAGGGGCAGCCGGGGGGTGGGGG - Intronic
1088945103 11:114504070-114504092 CAGGGGAAGCTGCAGTATAGGGG - Intergenic
1089281885 11:117380539-117380561 GAGAGCCAGCAGGAGGATGGAGG + Intronic
1089489130 11:118870736-118870758 CAGGGGACCCTGGAGGATCGTGG + Intergenic
1089615821 11:119694212-119694234 CAGGGGAAGCAGGAGCTGGCAGG + Intronic
1090473944 11:127003399-127003421 CGGGGGAGGGAGGAGGAGGGAGG + Intronic
1090725713 11:129525645-129525667 GAGGGGAAAGAGGAGGCTGGGGG + Intergenic
1091131609 11:133151403-133151425 CTGGAGATGCAGGAAGATGGGGG + Intronic
1091156966 11:133383075-133383097 CAGGGTGACCAGGAGGATGTTGG - Intronic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091297702 11:134485534-134485556 CAGGGGCAGCAGAAGGATGTGGG + Intergenic
1091397250 12:161607-161629 CAGGGTTAGCAGGAACATGGAGG + Intronic
1091454684 12:598339-598361 GAGGGCAAGGAGGAGGGTGGGGG - Intronic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1091652909 12:2323098-2323120 CAGGGAAGGAAGGAGGAAGGCGG - Intronic
1091684652 12:2553121-2553143 CAGGGCTAGCTGGAGGTTGGTGG - Intronic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092120544 12:6040713-6040735 CATGGGAATGAGGAGGATGGGGG - Intronic
1092166463 12:6345770-6345792 CAAGAGAAGCAGGAGCCTGGGGG + Intergenic
1092279549 12:7089205-7089227 CAGGGGATCCAGGAGGAAGTTGG + Intronic
1093530033 12:20149715-20149737 CAGGGGAAGGCTGAGCATGGTGG + Intergenic
1093692275 12:22121871-22121893 CAGAGAAAGAAGGAAGATGGGGG - Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094208911 12:27869849-27869871 CAGTGCCAGCAGGAGGATGGCGG + Intergenic
1094612890 12:32010618-32010640 CTGGGAAAGCTGGAAGATGGGGG + Intergenic
1095540125 12:43299919-43299941 AAGGGGAAGGAGGAGGAGGTGGG + Intergenic
1095613791 12:44164354-44164376 CAGGGGAAGGGGTGGGATGGTGG - Intronic
1096122433 12:49097034-49097056 AAGGGGAAGGAAAAGGATGGTGG + Exonic
1096216627 12:49801367-49801389 CAGGAGAAGCAGGAGGCTATTGG - Intronic
1096300827 12:50425899-50425921 CAGGGGAAGAAGGAGGAAATGGG - Intronic
1096311414 12:50524555-50524577 AGAGGGAAGCGGGAGGATGGAGG - Intronic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096550664 12:52369766-52369788 CAGGGGATTCAGGAGTCTGGGGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096828797 12:54299076-54299098 AAGGGGAGGCAGGAGTTTGGGGG + Intronic
1097027044 12:56064440-56064462 CTGAGGAAACAGGCGGATGGTGG + Intergenic
1097054697 12:56242609-56242631 CAGGGGCAGCTAGAGGATGAGGG - Exonic
1097263306 12:57731764-57731786 CATGGGGGACAGGAGGATGGGGG + Intronic
1097420202 12:59368338-59368360 AAAGGGCAGCAGGAGGAAGGTGG - Intergenic
1097638831 12:62154301-62154323 TGGGGGAAGCAGGAGAATAGGGG + Intronic
1098185360 12:67890681-67890703 GAGTGGACACAGGAGGATGGTGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098604737 12:72376254-72376276 TGGGGGAAGCAGGAAAATGGAGG - Intronic
1098896998 12:76074889-76074911 TAGGGGAAGCTGGAGGTTGGTGG - Intronic
1099133643 12:78865338-78865360 AAGAGGAAGCAAGAAGATGGGGG - Intronic
1100354313 12:93814668-93814690 CAGGCGAAGCTGGAGAATGCAGG - Intronic
1100385492 12:94101658-94101680 CGGGGAAAGTAGGAGGGTGGGGG + Intergenic
1100535491 12:95505009-95505031 CAGATGAGGGAGGAGGATGGTGG - Intronic
1101725884 12:107387902-107387924 GAGGGGAAGCAGGAAGATGAGGG - Intronic
1102383163 12:112484493-112484515 CAGGGGCAGGAGGAGGCAGGTGG + Intronic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102718216 12:114993038-114993060 CTGGGGGAGCAGGAGGGTTGTGG + Intergenic
1102916999 12:116761523-116761545 GAGGACATGCAGGAGGATGGTGG - Intronic
1102952042 12:117037522-117037544 CGGGGGAGGCTGGGGGATGGGGG + Intergenic
1103080912 12:118023395-118023417 AAGGGGGAGGAGGAGGAGGGGGG + Intronic
1103348086 12:120264758-120264780 CAGGGGAATGAGGTGGAAGGTGG - Intronic
1103367644 12:120394790-120394812 CAGAGGAAGCCGGAAGCTGGAGG - Intergenic
1103477902 12:121232236-121232258 CTGTGCAAGCAGGAGGATGCGGG - Intronic
1103977557 12:124713404-124713426 CAGGGAAGGCAGGAGGAACGGGG + Intergenic
1104078943 12:125413497-125413519 CTGGGGAAGAGTGAGGATGGGGG - Intronic
1104373299 12:128243174-128243196 CTGGGAAGACAGGAGGATGGTGG - Intergenic
1104715613 12:131014240-131014262 CAGGGAAATCAGGTGGCTGGTGG - Exonic
1105345475 13:19567324-19567346 CTGGGGAAACAGGTTGATGGAGG + Intergenic
1105614411 13:21999361-21999383 CAGGAGAGGCAGGAGAATGGTGG - Intergenic
1105891726 13:24686926-24686948 CAGGGAAGGCAGGAGGGTGGAGG + Intronic
1106175725 13:27329601-27329623 CAAGGGAAGCAGAAGGATCTAGG - Intergenic
1106208491 13:27620788-27620810 CAGGGGAATCAGGCGGGCGGCGG - Exonic
1106250292 13:27977546-27977568 CCGGGGAAGCCGCAGGAAGGAGG - Intergenic
1106346420 13:28883664-28883686 AAGGGGTAGCAGGAGGAGGCAGG + Intronic
1106856597 13:33860309-33860331 CAAGGGAAGGAGGAGGATGGAGG + Intronic
1107106089 13:36644373-36644395 CAGGGGAGGTGGGAGGGTGGGGG - Intergenic
1107421005 13:40246385-40246407 AAGAGGAATCAGGAGGAAGGAGG - Intergenic
1107588591 13:41880279-41880301 CAGGGGGAGTAGGAGGGAGGGGG - Intronic
1107688416 13:42927443-42927465 GAGGGCTAGCAGGAGGAGGGAGG - Intronic
1108045842 13:46383648-46383670 AAAGGGCAGCTGGAGGATGGGGG + Intronic
1108474590 13:50801291-50801313 CACTGGGAGCAGGTGGATGGAGG - Intronic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1108666001 13:52631260-52631282 CTGGGGAAACAGGCTGATGGAGG - Intergenic
1109705596 13:66087385-66087407 AAGTAGAAGCCGGAGGATGGAGG - Intergenic
1110028710 13:70576676-70576698 TAGGGGGAGCAGGAGGAGGTGGG - Intergenic
1111831735 13:93338855-93338877 CTGAGGGAGCAGGAAGATGGAGG - Intronic
1112003898 13:95237717-95237739 GTGGGGGAGCAGGAGCATGGAGG - Intronic
1112004341 13:95241514-95241536 CAGGGGGGGCAGGAGGAAGGAGG - Intronic
1112431421 13:99354060-99354082 CAGGGGATGCAGGCAGATCGTGG + Intronic
1112435890 13:99390884-99390906 CAGGGGAAGGCAGAGGATGGCGG - Intergenic
1112607534 13:100921712-100921734 CAGGAGGAGCAGGAGAATTGTGG - Intergenic
1113048699 13:106184901-106184923 CACTGCAACCAGGAGGATGGGGG - Intergenic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1113424707 13:110198494-110198516 CAGGGGAACCAGGAGGACCCGGG + Exonic
1113425154 13:110201396-110201418 GAGGGGGAGTAGGAGGAGGGGGG + Intronic
1113646313 13:111998946-111998968 CGGGGGATGCAGGAGGAGAGAGG + Intergenic
1113659520 13:112096123-112096145 AAGGGGAGGGAGGAGGAAGGGGG - Intergenic
1113843245 13:113371799-113371821 GAGGGGCCTCAGGAGGATGGAGG - Intergenic
1113909764 13:113836440-113836462 GAAGGGAAGGAGGAGGACGGAGG + Intronic
1113957718 13:114108157-114108179 CAGGGGATGACGGAGGATGATGG - Intronic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114567616 14:23644261-23644283 CCAGGGCAGCAGGAGGATGGTGG - Intronic
1115403871 14:32994110-32994132 CTGGGGGAGCTGGAGGAAGGGGG + Intronic
1115642361 14:35342684-35342706 GAGGAGAAACAGGATGATGGTGG - Intergenic
1116477385 14:45356829-45356851 AATGGGAAGCAAGAGGATAGAGG - Intergenic
1116660493 14:47704467-47704489 CAGGGGAGAAAAGAGGATGGGGG + Intergenic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117454522 14:55884070-55884092 CAGGGGTATCAGGAGGGAGGAGG + Intergenic
1117737777 14:58785007-58785029 TAGGGGAAGCATGAGGATGGTGG - Intergenic
1118727109 14:68636825-68636847 CTGGCAAAGCAGGAGGACGGCGG + Intronic
1119126009 14:72126961-72126983 CTGGGGAGGCATGAGGTTGGGGG + Intronic
1119204482 14:72783883-72783905 CAGGGGCAGCGGCAGGATGGGGG + Intronic
1119211645 14:72836439-72836461 CAGGGCAGGCAGGAGCAGGGAGG - Intronic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1120533574 14:85664311-85664333 CCGGGGAAGCAGAATGATGAGGG + Intergenic
1120914828 14:89701776-89701798 CAGGGGAAGTAGGTGAAGGGTGG - Intergenic
1121607722 14:95253514-95253536 CAGGGAATGCAGGGAGATGGAGG + Intronic
1121667843 14:95686295-95686317 GAGGGGGAGGAGGAGGAAGGGGG - Intergenic
1121811375 14:96894124-96894146 CTGGGGAAGACAGAGGATGGAGG + Intronic
1122016782 14:98803273-98803295 GAGGAGAAGGAGGAGGAAGGGGG - Intergenic
1122074722 14:99228750-99228772 AAGGGGAAGGAGGAGCAGGGAGG - Intronic
1122849027 14:104516705-104516727 CAGGGTAGGCAGGAGGCTGAGGG + Intronic
1202870677 14_GL000225v1_random:160346-160368 CAGGTGAAGCAGGAGGCTCAGGG + Intergenic
1123440798 15:20289719-20289741 CAGGGGCAGCAGGTGGAGAGCGG + Intergenic
1123539257 15:21271709-21271731 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1124121640 15:26893682-26893704 CAGGGGAAACAGGAGGATCTGGG + Intronic
1124173314 15:27397657-27397679 CAGCAGAAGCGGGAGGCTGGAGG - Intronic
1124232456 15:27957006-27957028 CAGAAGAAGCAGGAGCCTGGTGG - Intronic
1125024807 15:35019503-35019525 GAGGGGGAGGAGGAGGAGGGAGG - Intergenic
1125279748 15:38031123-38031145 AAGGGAAAGCAGAAAGATGGAGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125326116 15:38537545-38537567 CAAGGGAAGCAGGAGCAGTGGGG + Intronic
1125385940 15:39136504-39136526 CAGGGGAAGGGGGAGCATGCTGG - Intergenic
1125483882 15:40099022-40099044 CAGGGGAAGAATGAGGCTGGGGG - Intronic
1126696756 15:51332829-51332851 TAGGGGAAGAAGGATCATGGGGG - Intronic
1127103249 15:55588247-55588269 CAGGGGAAGCAGGAGGCTCGCGG + Intronic
1127392957 15:58521665-58521687 GAGGGGAAGAAAGAGGAAGGGGG + Intronic
1127782029 15:62325439-62325461 GAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1128016074 15:64348390-64348412 TAGGGGAAACTGGGGGATGGAGG + Intronic
1128038447 15:64547871-64547893 GAGGCAAAGCAGGAGGACGGGGG + Intronic
1128156286 15:65393945-65393967 CAGGGGAAGGGTGAGGAAGGAGG - Intronic
1128226050 15:66001956-66001978 CAGGGCTGGCAGGGGGATGGGGG + Intronic
1128248498 15:66149071-66149093 AAGGGCGAGCAGGAGGCTGGAGG - Intronic
1128251383 15:66166406-66166428 GAGGGGAAGCAGGAGGCCAGTGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128389791 15:67175113-67175135 GAGGGGAAGGAGGAGGCAGGTGG + Intronic
1128585431 15:68845367-68845389 CACGGGATGCAGGTGGAGGGAGG - Intronic
1129232253 15:74203315-74203337 CAGGAGGAGCAGGAGGCAGGCGG - Intronic
1129467088 15:75730301-75730323 GAAGGGGAGAAGGAGGATGGAGG + Intergenic
1129658824 15:77541903-77541925 GAAGGGAAGGAGGAGGAAGGAGG - Intergenic
1129718945 15:77867174-77867196 GAGGGGCAGCAGGAGGGTGAAGG - Intergenic
1129720139 15:77873419-77873441 GAAGGGGAGAAGGAGGATGGAGG - Intergenic
1129980729 15:79867074-79867096 TAGGGGAGGCTGGAGAATGGGGG - Intronic
1130064639 15:80593771-80593793 CAGGGCAAGCAGGGCGAGGGTGG - Exonic
1130109758 15:80954474-80954496 CAGGGAAAGGAGTAGGATGTGGG + Intronic
1130459986 15:84153679-84153701 GAGGGGCAGCAGGAGGGTGAAGG + Intergenic
1130679608 15:85984952-85984974 TAGGGGAGGCTGGAGGCTGGCGG + Intergenic
1130890696 15:88131538-88131560 CTGGGGCAGGGGGAGGATGGAGG + Intronic
1130989979 15:88870358-88870380 CAGGGGAAGAAGGAAGAAGGGGG + Intronic
1132078647 15:98845528-98845550 GAGGGGGAGGAGGAGGAAGGAGG - Intronic
1132656608 16:1044241-1044263 CAGGGGTCCCAGGAGGAGGGCGG - Intergenic
1132845684 16:1999876-1999898 CAGGAGGAGGAGGAGGACGGCGG - Exonic
1132868145 16:2103959-2103981 AAGGGGGAGCCGGAGGGTGGGGG + Intronic
1132908769 16:2297931-2297953 CAGGGGACGCAGGGAGATGCAGG + Intronic
1132920293 16:2386072-2386094 CAGGGGACGCAGGGAGATGCAGG - Intergenic
1133103747 16:3494134-3494156 CAGGGGAGGGAGGAGGTTGAGGG + Intronic
1133258699 16:4534644-4534666 CTGGGGAAGCAGGAGGAAATGGG - Intronic
1133288136 16:4700575-4700597 CACAGAAAGGAGGAGGATGGTGG + Intronic
1133299968 16:4776439-4776461 CAGGGGAATGAGGAAGGTGGGGG + Intergenic
1133371561 16:5249290-5249312 CAGGGGTGGCAGGAGGAAAGGGG - Intergenic
1133929135 16:10217996-10218018 CAGTGGGAGCAGGAGGCTGGTGG + Intergenic
1134000518 16:10779422-10779444 GCTGGGGAGCAGGAGGATGGAGG - Intronic
1134041716 16:11073705-11073727 CACGTGGAGCAGGAGGAAGGAGG - Intronic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134122801 16:11596696-11596718 CAGGGGGAGAGGGAGGAGGGGGG + Intronic
1134549269 16:15131771-15131793 AAGGGGGAGCCGGAGGGTGGGGG + Intronic
1134719074 16:16370952-16370974 AAGGGGGAGCTGGAGGGTGGGGG - Intergenic
1134948353 16:18340933-18340955 AAGGGGGAGCCGGAGGGTGGGGG + Intergenic
1135075097 16:19386424-19386446 CAGGAGAAGGAGGAGGAGAGAGG - Intergenic
1135231441 16:20711856-20711878 ACTAGGAAGCAGGAGGATGGAGG - Intronic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1135425100 16:22328515-22328537 CCGGGGAAGCAGCAGTCTGGGGG - Exonic
1135472569 16:22744490-22744512 CAGAGAAAGGAAGAGGATGGAGG + Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1135999941 16:27284760-27284782 CAGGGGAAGAAAGAGGCTGGGGG + Intronic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136474881 16:30506678-30506700 CAGGGAAAGATGGAGGAGGGAGG - Intronic
1136513115 16:30751317-30751339 CAGGGCCAGCAGGAGGTGGGGGG - Intronic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1136656211 16:31710851-31710873 CTGGGGTCCCAGGAGGATGGTGG - Intergenic
1136726057 16:32358671-32358693 CAGGGGCAGCAGGTGGAGAGTGG - Intergenic
1137253442 16:46756975-46756997 GAGGGGCAGGAGGAGGAAGGGGG + Intronic
1137587194 16:49670661-49670683 CAGGGGGAGCCGGAGCATGTGGG - Intronic
1138229127 16:55324825-55324847 CAGGGGAAGGAAGAAGATGCGGG - Exonic
1138587735 16:57982066-57982088 CAACTGAAGCAGGAGGAAGGTGG - Intronic
1139504429 16:67391962-67391984 TTGGGGGAGCAGGAGGTTGGGGG + Intronic
1139946331 16:70644912-70644934 GAGGAGAAGGAGGAGGAAGGAGG + Intronic
1140189347 16:72801878-72801900 GAGGGGGAGCACGAGGTTGGGGG + Intronic
1140643484 16:77003964-77003986 CAGTGGAAGCAAGAGAATTGAGG - Intergenic
1140890880 16:79284205-79284227 CTGGGGTAGAAGGCGGATGGAGG - Intergenic
1140961213 16:79914911-79914933 CAGGGGAAGAAGGAGAAATGAGG + Intergenic
1141032198 16:80598787-80598809 CAGGGGGAGCATGAGGTTGGTGG + Exonic
1141393322 16:83682644-83682666 CAGAGGAAGGAGGAGGAGTGAGG - Intronic
1141427141 16:83951884-83951906 CAGGGAGAGAAGGAGGAAGGAGG - Intronic
1141516637 16:84549229-84549251 GAGGAGAGGCAGGAGGATGGAGG + Intronic
1141750941 16:85957448-85957470 CAGGGGCATCAGGAGAATGCAGG - Intergenic
1141775760 16:86121753-86121775 CAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1141775785 16:86121837-86121859 CGGGACAAGCAGGAGGAGGGAGG - Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1141992447 16:87618299-87618321 AAGAGGAGGCAGGAGGAGGGAGG + Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142387348 16:89774315-89774337 CAGGGGAAGGAGGATCCTGGGGG + Intronic
1203000374 16_KI270728v1_random:159085-159107 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
1203131976 16_KI270728v1_random:1695488-1695510 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
1203154556 16_KI270728v1_random:1865015-1865037 CAGGGGCAGCAGGTGGAGAGTGG - Intergenic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142902069 17:3018303-3018325 CAGGGCAAGCTGGATGATGGTGG + Intronic
1142981744 17:3676404-3676426 CTGGGGAACCGGGAGGACGGAGG + Intronic
1143417029 17:6757834-6757856 CATGGGAAGGAGCAGGAGGGAGG - Intronic
1143478913 17:7217629-7217651 GAGAGGAAGCAGGGGGAGGGAGG + Intronic
1143585701 17:7849157-7849179 CAGGCCAAGGAGGAGGCTGGCGG + Exonic
1143794696 17:9327240-9327262 CAGAGGAGGAAGGAGGAAGGAGG + Intronic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144208233 17:12994134-12994156 CAGGGGAAGGCGGGGGCTGGGGG - Intronic
1144627916 17:16854452-16854474 TAAGGGAAGCAGGAAGGTGGGGG - Intergenic
1144763048 17:17718127-17718149 CAGGGGAAGCAGGGGGAGAGGGG - Intronic
1144767263 17:17739637-17739659 CAGGGGAAGCAGGCAGGTGCTGG - Intronic
1144767606 17:17741191-17741213 GAGGGGACTCAGGAGGGTGGTGG - Intronic
1144961543 17:19046967-19046989 CAGAGGAAGCAGGAAGCTGTCGG - Exonic
1144973617 17:19127557-19127579 CAGAGGAAGCAGGAAGCTGTCGG + Exonic
1145018940 17:19415378-19415400 CAGGGGAGGCAGGGAGGTGGGGG + Intronic
1145103878 17:20098737-20098759 CAGCAGGAGGAGGAGGATGGAGG - Intronic
1145159505 17:20565033-20565055 TAAGGGAAGCAGGAAGGTGGGGG - Intergenic
1145751942 17:27361509-27361531 AAGGAGAGGCAGCAGGATGGAGG - Intergenic
1145905269 17:28512790-28512812 CCAGGGAGGCAGGAGGGTGGAGG + Intronic
1145940091 17:28738771-28738793 AAGGGGAAGTCGGGGGATGGCGG + Intronic
1146178124 17:30679636-30679658 CAGAGGAGGGAGGAGGATGGAGG + Intergenic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146901570 17:36592413-36592435 AAGGGGAAGCCGGAGGTCGGGGG + Intronic
1146936110 17:36813574-36813596 CAGAGGAAGAAGGAGGAATGAGG + Intergenic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147312070 17:39601349-39601371 CAGGGGAGGGAGGAGGAAAGGGG - Intergenic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147341761 17:39756530-39756552 GAGGGGAAGAAGGAGGGTGCAGG + Intergenic
1147395729 17:40140946-40140968 CAAGGGAAGAAGAAGGATTGGGG + Intronic
1147523460 17:41197271-41197293 CAGGGGAAGGAGTGTGATGGGGG - Intronic
1147567767 17:41548100-41548122 CGGGGCACGTAGGAGGATGGTGG - Intergenic
1147632343 17:41940210-41940232 CAGGGGAAGCAGCAGGACTCAGG - Intronic
1147860206 17:43516052-43516074 CAGTGGAGGTAGTAGGATGGTGG - Intronic
1147882413 17:43662708-43662730 AAAGGGAAGCAGGTGGGTGGAGG - Intergenic
1148326075 17:46784188-46784210 CATGAGAAACAGGAGGAAGGAGG + Intronic
1148694033 17:49548492-49548514 AAGGGGGAGCATGAGGCTGGAGG - Intergenic
1148746130 17:49919577-49919599 CAGAGGAAGCAGGTGGAGCGTGG - Intergenic
1148763446 17:50021734-50021756 CAGTGGAATGAAGAGGATGGGGG - Intergenic
1149107080 17:52982588-52982610 GAGGGGGAGAAGGAGGAAGGGGG - Intergenic
1149435906 17:56633178-56633200 AAGGGGAGGCAGAAGAATGGTGG - Intergenic
1149492185 17:57092952-57092974 GGGGGGAAGCAGGAGGAGAGCGG - Intronic
1149576402 17:57716365-57716387 AAGGGGAAGCAGGAGAAGAGCGG + Intergenic
1149633701 17:58148885-58148907 CAGGAGAAGGGGGAAGATGGAGG - Intergenic
1150143720 17:62750934-62750956 CGGGGGCAGCTGGAGGATTGAGG - Intronic
1150480309 17:65503996-65504018 CAGGGAAAGCCTGGGGATGGAGG + Intergenic
1150580912 17:66473101-66473123 CAGGAGAAGAAGGAGGAATGGGG - Intronic
1151045015 17:70909619-70909641 CAGGTGAAGCAGGAGGATTTAGG + Intergenic
1151386852 17:73760258-73760280 CTGGGGAGGCAGGTGGATGCTGG + Intergenic
1151558199 17:74857673-74857695 CAGGGGTAGTAGGAGGTTTGGGG - Intronic
1151565033 17:74893104-74893126 GAGGGGGCGCAGGAGGGTGGTGG - Intronic
1151719170 17:75845898-75845920 AAGGGGAAGAAGCAGGCTGGGGG + Exonic
1151733031 17:75922146-75922168 TGGTGGAAGCAGGAGGAAGGGGG - Intronic
1151752259 17:76046278-76046300 CAGAGGAAGCAGGGGGCGGGTGG + Intronic
1152007369 17:77691067-77691089 CATGGGATGCAGGCGGATGGGGG + Intergenic
1152103114 17:78314271-78314293 CAGGGTGAGCGGGAGGAGGGAGG + Intergenic
1152315952 17:79580276-79580298 GAGGAGGAGGAGGAGGATGGGGG - Intergenic
1152415976 17:80162206-80162228 CAGCGGAAGCAGGAGTGGGGCGG + Intergenic
1152580446 17:81163411-81163433 CAGGAAAAGCAGGGTGATGGGGG - Intronic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1152696539 17:81800505-81800527 GAAGGGAAACAGGAGGGTGGTGG - Intergenic
1152778468 17:82216091-82216113 CAGGAGAAGCCGCATGATGGTGG - Intergenic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1203171336 17_GL000205v2_random:149785-149807 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1153812300 18:8762786-8762808 CAGGAAAAGCAGGAGGACTGAGG + Intronic
1153813519 18:8773234-8773256 CAGGGGGTGCAGGGGGATGGTGG - Intronic
1154253724 18:12765616-12765638 CAGAGCAGGCAGGAGGAGGGCGG + Intergenic
1155066509 18:22273700-22273722 GAGGGGGAGGAGGAGGAGGGAGG - Intergenic
1155066523 18:22273734-22273756 AGGGGGAGGGAGGAGGATGGAGG - Intergenic
1155066550 18:22273801-22273823 AGGAGGAAGGAGGAGGATGGAGG - Intergenic
1155404999 18:25478119-25478141 CAGGGGAAGGAGGAGGTTTACGG - Intergenic
1156369582 18:36460868-36460890 AAGGGGGAGCAGGAGCATGTAGG - Intronic
1156592662 18:38509227-38509249 CTGACCAAGCAGGAGGATGGGGG + Intergenic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1157001999 18:43537970-43537992 CAACAGAAGCAGGAGGTTGGAGG + Intergenic
1157551227 18:48583053-48583075 GAGGGGAGGGAGGAGGATGATGG + Intronic
1157768664 18:50325135-50325157 AAGGAGAAGGAGGAGGAAGGAGG - Intergenic
1158442184 18:57486153-57486175 CAAGTGAAGCATGAGGCTGGGGG - Exonic
1158644536 18:59232803-59232825 CAGGGAAAGCAGGAGCCTGGTGG + Intergenic
1159118262 18:64139942-64139964 GAGGGCAAGAGGGAGGATGGAGG - Intergenic
1159198703 18:65153782-65153804 AAGGAGGAGGAGGAGGATGGGGG - Intergenic
1159740949 18:72169443-72169465 CAGGAGCAGGAGGAAGATGGAGG - Intergenic
1159996262 18:74968377-74968399 CAAGAGAAGCAGAAGTATGGGGG - Intronic
1160408589 18:78659777-78659799 CAGGGACAGCTGGGGGATGGTGG - Intergenic
1160429025 18:78798943-78798965 AAGGCGATGCAGGAGGACGGCGG + Intergenic
1160527965 18:79548281-79548303 CAGGGCCAGCAGGTGGAAGGCGG - Intergenic
1160572289 18:79826295-79826317 CAGGGAAAGCAGGTGTGTGGAGG + Intergenic
1160783881 19:890934-890956 GAGGGGAAGCAGGTGGGAGGGGG + Intronic
1160845623 19:1164806-1164828 GAGGAGGAGCAGGAGGAGGGAGG + Intronic
1161085440 19:2332963-2332985 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085461 19:2333024-2333046 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085499 19:2333145-2333167 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161143493 19:2663348-2663370 CTGGGGAAGAAAGAGGAGGGGGG - Intronic
1161150295 19:2704031-2704053 GAGGGCAAGCAGGGAGATGGAGG - Intergenic
1161370600 19:3908840-3908862 GAGGAGAAGGAGGAGGAAGGGGG - Intronic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1161455384 19:4367188-4367210 CAGGGGGAGGGGGAGGGTGGGGG + Intronic
1161487991 19:4546142-4546164 GAGGGGAGGGAGGAGGCTGGAGG - Intronic
1161865220 19:6828308-6828330 CAGGGTCAGCAGTACGATGGAGG + Intronic
1161993218 19:7697149-7697171 CTGGGGAACCACGAGGCTGGGGG - Intronic
1162540699 19:11294237-11294259 AAGGGAAAGCAGGAAAATGGGGG - Intergenic
1162549660 19:11351485-11351507 CAGGGGAGACAGGTGGCTGGTGG + Intronic
1162926449 19:13932736-13932758 CAGGGCAGGCAGGGGGATGGAGG + Exonic
1162968430 19:14166532-14166554 CAGGGGAAGGAGGAAGAGAGAGG + Intronic
1162972701 19:14190608-14190630 CAGGGGAAGGCGGGGGATGTAGG - Intronic
1162985830 19:14268983-14269005 CAGGGGAAAAAGTAGGGTGGGGG - Intergenic
1163127279 19:15251154-15251176 CACAGGCAGGAGGAGGATGGCGG - Intronic
1163500706 19:17674532-17674554 CAGGGGAAGAGGGAGGACAGAGG + Intronic
1163501031 19:17676363-17676385 CAGGGGATGCAGGGAGAGGGAGG - Intronic
1163668445 19:18613813-18613835 GAGGGGCAGGAGGAGGGTGGGGG - Intronic
1163721339 19:18899585-18899607 GAGGGGATGCAGGTGGATGCCGG + Exonic
1164578459 19:29419558-29419580 GAGTGGAAGCAGAAGGGTGGGGG - Intergenic
1164632419 19:29770234-29770256 CAGCAGAAGCTGGAGGCTGGAGG - Intergenic
1164743578 19:30594731-30594753 CAGGGGAAACAGGAGAAGAGTGG - Intronic
1164798401 19:31055071-31055093 CAGGGCAAGCAGGGAGAGGGAGG + Intergenic
1164803594 19:31098698-31098720 CATGGGAACCAGGAGGAAGCAGG - Intergenic
1164806302 19:31119751-31119773 CTTGGGAAGCAGGTAGATGGTGG + Intergenic
1165094492 19:33402866-33402888 CTGCTGAGGCAGGAGGATGGTGG + Intronic
1165115662 19:33527012-33527034 CACGGGAAGGAAGAGGCTGGAGG - Intergenic
1165245753 19:34497616-34497638 CAGGAGAACCAGGAGGCTGCCGG + Intronic
1165468764 19:35990802-35990824 TAGGAGAAGGAGGAGGAAGGAGG + Intergenic
1165477449 19:36039542-36039564 CAGGGGGGTCAGGAGCATGGTGG + Exonic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1165781642 19:38438077-38438099 CAGGAGATGGAGCAGGATGGTGG - Intronic
1165940761 19:39413687-39413709 CAGGGGAGGGCGGAGGCTGGGGG - Intronic
1166060291 19:40321552-40321574 CAGGGGAAGAAGGGGAATGTAGG + Exonic
1166228570 19:41412272-41412294 GTGGGCAAGCAGGTGGATGGTGG - Intronic
1166524916 19:43504764-43504786 CAGGGGAAGAGGGAGGAGAGAGG + Exonic
1166758796 19:45212026-45212048 CAGGAGAGGAAGGAGGTTGGGGG - Intronic
1166864967 19:45830307-45830329 GAGAGGCAGCAGGGGGATGGGGG - Intronic
1166895237 19:46018491-46018513 CAGGGGCAGCAGGAGGGACGGGG - Exonic
1166976978 19:46610481-46610503 GAGGGGAAGCAGGGGGTGGGGGG - Exonic
1167090572 19:47341131-47341153 CATGGTCAGCAGGATGATGGAGG - Exonic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167268472 19:48494730-48494752 CAGGGGCAAGAGGAGGGTGGAGG + Intronic
1167502840 19:49857249-49857271 CAGGGGAGCCCGGAGGATGCCGG + Intronic
1167522124 19:49961218-49961240 CAGGGGAAGCAGCAGGGCAGAGG + Intergenic
1167523257 19:49969507-49969529 CAGGGGAAGCAGCAGGGCAGAGG - Intergenic
1167557186 19:50203723-50203745 CAGGGGAAGCTGGAGCCTGGGGG + Intronic
1167608171 19:50492805-50492827 AAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1167608200 19:50492902-50492924 GAGGGAAAGGAGGAGGAAGGAGG + Intergenic
1167646519 19:50708593-50708615 CATGGAAAGGATGAGGATGGAGG + Intronic
1168063289 19:53906157-53906179 CAGGGGAAACAGGCAAATGGAGG - Intronic
1168107020 19:54171972-54171994 GAGGAGGAGGAGGAGGATGGAGG - Exonic
1168147254 19:54426681-54426703 CAGGAGCAGCAGGAGGACGTAGG - Exonic
1168307498 19:55443314-55443336 CAGGGGAGGCAGCTGGAGGGAGG + Intergenic
1168357722 19:55712865-55712887 GAGGGGGAGGAGGAGGAGGGGGG + Intronic
1168413971 19:56157263-56157285 CAGCTGAGGCATGAGGATGGGGG - Intronic
1168579693 19:57544509-57544531 GAGAGGATGCAGGAGGGTGGGGG + Exonic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925271213 2:2608819-2608841 CTGGGGACCCAGGAGAATGGCGG + Intergenic
925286187 2:2717128-2717150 CAGGAGAAGAGGGAGGATGCCGG + Intergenic
925627946 2:5860864-5860886 GAGGGCAAGCAGGAGCAGGGTGG - Intergenic
925862600 2:8194475-8194497 GAGAGGAGGGAGGAGGATGGTGG - Intergenic
926085389 2:10016580-10016602 CAGGGTGAGTAGGAGGAGGGAGG + Intergenic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
926248331 2:11137785-11137807 CAGTGGGAGCAGGAGGATATGGG + Intronic
926394848 2:12430406-12430428 AAGGAGAAGAAGGAGGAAGGAGG + Intergenic
926801495 2:16664614-16664636 CTGGGGCAGCAGGAGGAGAGTGG - Intronic
927783488 2:25956736-25956758 CAGGGCTAGGAGGAGGATGGGGG + Intronic
927812469 2:26187667-26187689 GAGGGGGCGCAGGAGGAGGGGGG - Exonic
927881690 2:26693595-26693617 CTGGGGAGGCATGAGGATGTCGG + Intronic
927889317 2:26738543-26738565 CAGAGGGAGCAGCAGGTTGGTGG + Intergenic
927943787 2:27122576-27122598 CAGGGGAAGAAGGAGGAACATGG - Intergenic
929408407 2:41669177-41669199 TAGGGAAAGGAGGAGGAAGGAGG - Intergenic
929504826 2:42520392-42520414 CAACTGAAGCAGGTGGATGGTGG - Intronic
929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG + Intergenic
929759917 2:44798337-44798359 CATGGGGAGGAGGAGGATGGTGG - Intergenic
929780758 2:44955484-44955506 GCGGGGAGGCAGGAGTATGGTGG + Intergenic
930301277 2:49618968-49618990 TGGGGGAAACAGGAGGTTGGGGG + Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931235935 2:60412748-60412770 CATGGGTTGCAGGAGGTTGGCGG + Intergenic
931330081 2:61271692-61271714 GAGGGGAAGAAGGGGGAAGGAGG + Intronic
931340744 2:61398506-61398528 CAGGGGAAGGAGGCGGAAGCGGG + Intronic
931402619 2:61944869-61944891 AAGGGGAAGTAGGAGTAAGGTGG + Intronic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931651626 2:64473674-64473696 CAGGGGGATGAGGAGGTTGGTGG - Intergenic
932446350 2:71784071-71784093 CAGGGGAAGGTGGAGGACAGGGG - Intergenic
932510397 2:72281646-72281668 CAGTGGAAGATGGAGAATGGGGG + Intronic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
932910875 2:75805037-75805059 AAGAGGAAGCAGAAGGTTGGTGG + Intergenic
933254832 2:80069071-80069093 CAGGGGAAGCCTAAGGCTGGGGG + Intronic
934117503 2:88811078-88811100 GAGGGGAAGTGGGAGGGTGGTGG + Intergenic
934319830 2:91961910-91961932 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
934987757 2:98900001-98900023 GAGGGGAGGCAGGAGGACAGAGG + Intronic
934987864 2:98900370-98900392 GAGGGGAGGCAGGGGGATGGAGG + Intronic
934987874 2:98900401-98900423 GAGGGGAGGCAGGAGGATGGAGG + Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935294239 2:101634951-101634973 CTGGGGAAGGAGGAGGCAGGTGG - Intergenic
935403406 2:102683730-102683752 AAAGAGAAACAGGAGGATGGAGG - Intronic
936095823 2:109529413-109529435 CCGGGGAGGCCGGAGGGTGGGGG + Intergenic
936161105 2:110084814-110084836 GAGGGGAAGTGGGAGGGTGGTGG + Exonic
936183558 2:110286540-110286562 GAGGGGAAGTGGGAGGGTGGTGG - Intergenic
936269351 2:111036873-111036895 CAGCAGAAGTAGGAGCATGGAGG + Intronic
936409083 2:112238091-112238113 TAGAGGGAGCTGGAGGATGGAGG - Intronic
937225913 2:120368570-120368592 GAGGGGAAGAGGGAGGAGGGTGG + Intergenic
937258910 2:120573027-120573049 CGTGGGAAGCAGCAGGCTGGGGG + Intergenic
937376334 2:121338355-121338377 CAGGGGAGGCAGCAGCTTGGAGG + Exonic
937856911 2:126678848-126678870 CAGGGGCGGCAGGAGGCAGGAGG - Intronic
938095116 2:128456516-128456538 AAGGGGAGGCAGGGGGATGAGGG - Intergenic
938163625 2:129008190-129008212 CAGCAGGAGCAGGAGCATGGTGG - Intergenic
938970219 2:136424707-136424729 CAGGGGAGGCAGCAGGACGAAGG + Intergenic
939025186 2:137004253-137004275 CACGGGAAGGAGGATGAAGGTGG - Intronic
940133494 2:150410262-150410284 TAAGGGAAGTAGGAGAATGGGGG + Intergenic
940255531 2:151724301-151724323 CAGGGGCATCAGGAGGAAGCAGG + Exonic
940439136 2:153693632-153693654 AAGGGCAAGCAGGAGGATAAGGG + Intergenic
941360086 2:164540665-164540687 GAGGGAAAGCAGGAGGAAAGAGG - Intronic
942449734 2:176101288-176101310 CAGGGCAGACAGGAGGGTGGAGG - Intergenic
942514410 2:176737098-176737120 CAAGGGAAGCTTGAGGCTGGTGG + Intergenic
942816700 2:180060867-180060889 TAGGGGTTGCAGGAGGATGAAGG - Intergenic
942940745 2:181613148-181613170 GAGGGGAAGCAAGGGGATGATGG - Intronic
943129887 2:183841720-183841742 CTGGGGAAGCAGAAGCAGGGTGG + Intergenic
944128156 2:196317579-196317601 CAGGGGAAGCTGCAGGAGCGGGG - Intronic
944162501 2:196679320-196679342 CAGGGGAAGGAGGTGGAAGAAGG - Intronic
944501068 2:200360634-200360656 GAGGGGAAGCAGGTGGCAGGTGG + Intronic
944856746 2:203775490-203775512 CAGAGCAAGCTGGAGGATGGGGG - Intergenic
946026238 2:216673443-216673465 CAGGGCAGGCTGGAGGAAGGAGG + Exonic
946061122 2:216942417-216942439 CAGGGGCAGCAGAAGGCCGGGGG - Intergenic
946085041 2:217162433-217162455 AAAGGGAAGCAGGAGGATGAAGG + Intergenic
946087300 2:217186906-217186928 CTGGGGAAGCTGGAGGAAGCAGG - Intergenic
946431980 2:219631014-219631036 CAGCAGTAGCAGCAGGATGGGGG + Intronic
946458402 2:219848412-219848434 GAGGGGATGGAGCAGGATGGTGG + Intergenic
946764735 2:223030085-223030107 CAGAGAAAGCAGGAGGTAGGGGG + Intergenic
947855259 2:233319637-233319659 CAGGGCACCCAGGAGGAAGGTGG - Intronic
947943035 2:234075586-234075608 CAGGGGCAGCAGGAAGAAGCCGG - Intronic
948570869 2:238916429-238916451 GAGGGAAAGAAGGAGGAGGGAGG + Intergenic
948577651 2:238965004-238965026 AGGGGGAAGCAGGAGGGAGGAGG - Intergenic
948588263 2:239034818-239034840 CAGAGGAGGCAGGAGGCTGGGGG - Intergenic
948603471 2:239120573-239120595 CAAGGGGAGAAGGAGGAAGGTGG + Intronic
948847104 2:240688318-240688340 CAGGGGAACCAGGAGCCTGTGGG + Intergenic
949000566 2:241610582-241610604 CTGGGGAAGCAGGAGTGGGGAGG - Intronic
1168739234 20:174071-174093 GAGGGAAAGAAGGAGGATGTGGG - Intergenic
1168900312 20:1358306-1358328 CATGGGAAGAAGGAGGAGGGAGG + Intronic
1168926762 20:1588038-1588060 CAGGGGAGGGAGGATCATGGGGG + Intronic
1168930472 20:1619336-1619358 CAGGGGAGGGAGGAGCATGGGGG + Intronic
1168965614 20:1896208-1896230 CGGGGAAGGCAGGAGGAAGGGGG - Intronic
1169064401 20:2686182-2686204 CTGGGGAGGTAGGAGGAGGGTGG - Intergenic
1169210868 20:3765707-3765729 AGGGGGAGGCAGGAGGAGGGAGG - Intronic
1169803606 20:9536455-9536477 CTCGTGAAGCTGGAGGATGGGGG - Intergenic
1170791211 20:19511051-19511073 CAGGGTCAGCAGCAGGGTGGGGG - Intronic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1172180607 20:33001184-33001206 CAGGGAAGGCAGGGGGAGGGTGG - Intronic
1172498978 20:35411660-35411682 GAGGGGAAGCAGGTACATGGGGG + Intronic
1172525323 20:35597499-35597521 CAGGGGAAGGAGGATGATGGTGG - Intergenic
1172699269 20:36843018-36843040 CAGTGGCAGCATGAGGAGGGAGG - Intronic
1172778607 20:37422768-37422790 CAGAGGAGGAAGGAGGAGGGAGG - Intergenic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1172824241 20:37766989-37767011 CAGGGGAAGCACGAAGCTGTGGG - Intronic
1172873938 20:38152859-38152881 GAGGCCAAGCAGGAGGAAGGGGG + Intronic
1172931492 20:38589336-38589358 CAGAGGCTGCAGGATGATGGGGG + Intergenic
1172948040 20:38703634-38703656 CAGGGCATGCAGCAGGGTGGTGG - Intergenic
1173106974 20:40146100-40146122 CAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1173249939 20:41358970-41358992 AAGGGGAAGGAGGAGGCTGCAGG + Exonic
1173437623 20:43047073-43047095 GAGGGGAAGAGGGAGGAGGGAGG - Intronic
1173521436 20:43703133-43703155 CAGGAGGAGAAGGAGGATGCTGG + Intronic
1173546380 20:43901408-43901430 TATGTGAAGCAGGGGGATGGTGG + Intergenic
1173937665 20:46881396-46881418 CTGGGGAGGCAGGGAGATGGTGG - Intergenic
1174265129 20:49325767-49325789 GAGGGCAAGAAGGAGGAGGGAGG - Intergenic
1174572074 20:51509022-51509044 CAGGGGAAGGGGAAGGATAGGGG - Intronic
1175179538 20:57135778-57135800 CAGGGGAGGCAGGTGCAAGGTGG + Intergenic
1175742686 20:61431139-61431161 CAGGGGAAGCACGTGGGTAGAGG + Intronic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175891484 20:62317933-62317955 TGAGGGAAGGAGGAGGATGGAGG + Intronic
1175904353 20:62372250-62372272 CAGGGGAAACAGGCGGAATGGGG + Intergenic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176268590 20:64223633-64223655 CAGGAGAGGCTGGAGGGTGGGGG - Intronic
1176327320 21:5511613-5511635 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176400437 21:6309338-6309360 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1176436720 21:6679766-6679788 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176460982 21:7006836-7006858 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176484543 21:7388614-7388636 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178286688 21:31331413-31331435 CAGGGGAAAAATGAGGAAGGAGG + Intronic
1178392683 21:32212307-32212329 CACGAGAAGTAGGAGGACGGAGG - Intergenic
1178691869 21:34756477-34756499 TATGGGAAGCAGCAGGATGAAGG - Intergenic
1178820036 21:35966668-35966690 CTGGGGAAGCAGGAGTATGAGGG + Intronic
1178884377 21:36473769-36473791 CAGGGGAGGGATGAGGATAGAGG + Intronic
1179346626 21:40564470-40564492 TAGAGGAAGGAGGAGGGTGGTGG - Intronic
1179403091 21:41102415-41102437 CTGGGGAAGCAGGACGAAGCTGG + Intergenic
1179581650 21:42348098-42348120 CAGGGAAACCAGGCAGATGGTGG - Intronic
1179828346 21:43981089-43981111 GAGGGGAGACAGGAGAATGGTGG - Exonic
1179984824 21:44914368-44914390 CAGGGGAAGCAGGGGGCTGAGGG + Intronic
1180308080 22:11145954-11145976 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
1180546556 22:16507767-16507789 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
1181019626 22:20092547-20092569 GAGGGGCAGCAGGAGGCTGGGGG - Intronic
1181048173 22:20226443-20226465 ATGGGGAAGAAGGAGGTTGGAGG + Intergenic
1181142115 22:20813491-20813513 TCGGGCAAGCAGGAGGCTGGTGG + Exonic
1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG + Exonic
1181933879 22:26426246-26426268 CAGCGAGAGCAGGAGGATGCAGG + Intergenic
1182023631 22:27100868-27100890 CGAGTGAGGCAGGAGGATGGAGG + Intergenic
1182051831 22:27318157-27318179 GAGGAGAAGCAGGAGGCGGGTGG + Intergenic
1182083516 22:27545506-27545528 CACGGGAGACAGGAGGTTGGAGG - Intergenic
1182212627 22:28689587-28689609 CAGGGGCAGCAGGTGGAGAGTGG - Intronic
1182566910 22:31206862-31206884 CAAGGGTGGCAGGAGGAGGGTGG - Exonic
1182598049 22:31437455-31437477 TAGAGGAAGCGGGAGGGTGGGGG - Intronic
1182786427 22:32911547-32911569 GGGGGGCAGCAGGAGCATGGAGG + Intronic
1183199024 22:36373232-36373254 CAGGGGCAGGGGGAGGATAGTGG - Intronic
1183241143 22:36659183-36659205 AAGGGAAAGCGGGAGGGTGGGGG + Intronic
1183250427 22:36726266-36726288 CCTGGGAAGCAGGGTGATGGTGG + Intergenic
1183284490 22:36953534-36953556 CAAGGGGAGCAGGAGGAGGGTGG + Intergenic
1183319449 22:37156152-37156174 CAGAGGGAACAGGAGGCTGGAGG - Intronic
1183355843 22:37358956-37358978 CATAGGAAGCAGGAGGACTGGGG + Intergenic
1183366508 22:37409803-37409825 CAGGGGCCGCAGGAGGGTGCAGG + Intronic
1183482858 22:38074649-38074671 CAGGGAACGCAGGAGGCTGCAGG - Intronic
1183524199 22:38314173-38314195 CAGAGGAAGCAGGAACATGAGGG + Intronic
1183598203 22:38824870-38824892 GAGGGGGAGGAGGAGGAGGGAGG - Intronic
1183620095 22:38967130-38967152 CAGGGGAATCAGCAGGACAGGGG + Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1184265117 22:43342610-43342632 CCGGGGAAGGAGGAGGAGGCCGG - Intronic
1184455693 22:44608464-44608486 CCCGGGAAACAGGCGGATGGAGG - Intergenic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184678103 22:46054293-46054315 CCCGCGAAGCAGGAGGAGGGGGG - Intronic
1184758271 22:46529457-46529479 AGGGGGTAGCAGGAGGAAGGTGG + Intronic
1184803191 22:46774842-46774864 CATGAGAAGGAAGAGGATGGCGG - Intronic
1184877068 22:47282725-47282747 CAGAGTAAGCTGGAGGCTGGGGG - Intergenic
1185015279 22:48339236-48339258 AAGGGGAAGGAGGAGGAGAGAGG + Intergenic
1185181380 22:49365459-49365481 CTGGAGGAGCAGGAGGATGGTGG - Intergenic
1185199379 22:49492206-49492228 CTGGGGAGGTAGGAGGAGGGCGG - Intronic
1185201149 22:49506251-49506273 CAGTGGAAGAAGCAGCATGGTGG - Intronic
1185421181 22:50735253-50735275 CAGGGGAAGCAGGTGCCTCGGGG - Intergenic
949229375 3:1732439-1732461 AAGGGAAAACAGGAAGATGGAGG - Intergenic
949535706 3:4994969-4994991 CAGGGGAAGCAGGGGCCAGGTGG - Intergenic
949589346 3:5477122-5477144 CAGGGATAGAAGGAGGTTGGTGG + Intergenic
950167799 3:10814875-10814897 GAGGGGAAACGGGAAGATGGTGG + Intergenic
950192509 3:10987414-10987436 CAGGAGAAGAGGGAGGATGAGGG + Intergenic
950221912 3:11202547-11202569 TAGGGGATGGAGGAGGGTGGGGG - Intronic
950525914 3:13523184-13523206 CACGGGAAGCAGGGGGAAGCTGG - Intergenic
950932406 3:16803606-16803628 CAGAGGAAGCTTGAGGATGAGGG + Intronic
951140144 3:19148565-19148587 CAGGGGAAGTGGAAGGATGGAGG - Exonic
951149964 3:19277197-19277219 AAGGGGAGGCAGGGGGATGAAGG + Intronic
951243451 3:20313796-20313818 CGGGGGAAGAAGCAGGATGGAGG - Intergenic
951691817 3:25404644-25404666 TAGTGGAAGCAGGGGCATGGCGG + Intronic
952013680 3:28931947-28931969 CAGGGGAAGCAGGATGGTCCTGG - Intergenic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952107584 3:30087733-30087755 GAGGAGAAGGAGGAGGAGGGAGG - Intergenic
952199335 3:31110271-31110293 CAGGGTAAGCAGGGGTATGCTGG + Intergenic
952384463 3:32830028-32830050 CCGGGGAGGCAGGAGAATGCTGG - Intronic
952934307 3:38383681-38383703 CAGGGGTGGCAGGAGGCCGGGGG + Intronic
953228970 3:41046404-41046426 CTGGGGAAACTGGAGGAAGGGGG - Intergenic
953365436 3:42340485-42340507 GAGGGGAAGGGGGAGGAGGGGGG + Intergenic
953385882 3:42505426-42505448 CAGGGGCAGCAGGATGCCGGTGG - Intronic
953389293 3:42525383-42525405 GAGGGGGAGCAGGAGTGTGGGGG - Intronic
953795530 3:45982929-45982951 CTGAGGAGGCAGGAGGGTGGAGG - Intronic
953871291 3:46629695-46629717 CAGGGAGAGGAGGAGAATGGAGG + Intergenic
954413641 3:50382257-50382279 CATGGGAAGAAAGAGGGTGGGGG - Intronic
954452116 3:50577280-50577302 GAGGGGAAGCAGCTGGATGAGGG + Intronic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
954539501 3:51384464-51384486 CCGGGGAGGCAGGAGGAGGCTGG + Intergenic
954808969 3:53236299-53236321 CAGGGGCAGCAGGAAGAGGCTGG + Intronic
954852754 3:53617310-53617332 GAGGGGAGGCAGGAGGAGGTAGG + Intronic
955143013 3:56288316-56288338 AAGGTAAAGCAGGAGGATGAGGG + Intronic
955459191 3:59161751-59161773 CAGTGGTAGGAGGAGAATGGTGG + Intergenic
955510977 3:59679935-59679957 CAGGGGCAGCAGGGGCAGGGAGG - Intergenic
956750826 3:72342572-72342594 CAAGGGAAGCAAGAGGTTGGAGG - Intergenic
956781394 3:72606093-72606115 CGGGGGAGGCAGGGGGTTGGGGG - Intergenic
956846548 3:73188870-73188892 CAGGAGAAGGAGGAGGAAAGAGG - Intergenic
957042303 3:75345305-75345327 TAGGGAAAGGAGGAGGCTGGTGG - Intergenic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
957993338 3:87654169-87654191 GAGGGCAAGCAGAAGCATGGTGG - Intergenic
958711624 3:97723673-97723695 AAGGGGAAAAAAGAGGATGGAGG + Intronic
958957853 3:100480506-100480528 CAGGAAAAGCAAGAGGTTGGGGG - Intergenic
959695184 3:109241534-109241556 CAGGGGAAGAAGAAGGGTGGGGG + Intergenic
961047031 3:123716155-123716177 TAGGGAAAGGAGGAGGCTGGTGG - Intronic
961101450 3:124202598-124202620 CAGGAGGAGGAGGAGGAGGGAGG - Intronic
961346041 3:126263974-126263996 CTGGGGAAGCGGTAGGATGTTGG + Intergenic
961452161 3:127007127-127007149 CAGGAGAAGCAGGGTGGTGGGGG + Intronic
961567546 3:127774351-127774373 CAGGGGAGGCAAGAGGCAGGAGG - Intronic
962308781 3:134311648-134311670 CAGGGGAAGTAGGGGCAGGGAGG - Intergenic
962379496 3:134886136-134886158 CAGCAGAAGCAGGAGGATGTGGG + Intronic
963043287 3:141084478-141084500 CAGGGCAGGCAGGGGGAGGGGGG - Intronic
963600952 3:147378434-147378456 GAGGAGGAGGAGGAGGATGGGGG + Intergenic
963896049 3:150686104-150686126 CTGGGCAAGGAGGATGATGGTGG - Intronic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
965721686 3:171668937-171668959 CATGGGTAGCAGGAGGAAGTGGG - Intronic
966059803 3:175741061-175741083 TAGGGGAAGCACAAGGATTGAGG + Intronic
966291108 3:178360956-178360978 GAGGGCAAGCAGAAGCATGGTGG + Intergenic
966644381 3:182227063-182227085 GAGGGGTAGTAGGAAGATGGAGG - Intergenic
966724673 3:183099065-183099087 GAGGGGAGCCTGGAGGATGGCGG + Intronic
966785442 3:183619034-183619056 CCAGGGAGGCAGGAGCATGGTGG - Intergenic
966818564 3:183908120-183908142 CAGGGTAAGTAGCAGGCTGGCGG - Intergenic
966905994 3:184526051-184526073 CAGGTGGAGCAAGAGGAGGGCGG + Intronic
966906552 3:184530367-184530389 TAGGGGGAGGAGGAAGATGGAGG + Intronic
967301925 3:188022609-188022631 CAGGGGAAAAGGCAGGATGGAGG - Intergenic
968009222 3:195262323-195262345 CAGGGGAGACAGGAGGACGGAGG + Intronic
968288170 3:197520160-197520182 GAGGGGAAGCAGGGAGAGGGAGG + Intronic
968517689 4:1021751-1021773 CAAGGGCAGTAGGGGGATGGGGG - Intronic
968517863 4:1022385-1022407 CAGGTGGAGCGGGAGGATGCCGG + Exonic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968639412 4:1704622-1704644 CAGGGGAAGCACGAGGTTGCTGG - Intronic
968684367 4:1947067-1947089 CAGTGGAAGCAGGTGTATTGTGG + Intronic
968728327 4:2258485-2258507 CAGGGAAGGCAGGTGGCTGGTGG - Intronic
968921418 4:3524010-3524032 CAGGGGCAGCAGTTGGGTGGAGG + Intronic
969014989 4:4098058-4098080 CAGGGGTGGCAGGAGGAAAGGGG + Intergenic
969125550 4:4945287-4945309 CAGGGCAGGCAGGAGGCTGGAGG + Intergenic
969141565 4:5078688-5078710 CTTGGGAAGCAGGTAGATGGAGG - Intronic
969160739 4:5256487-5256509 CAGGGGAAGCAGTGGGAGAGTGG - Intronic
969275237 4:6130198-6130220 CAGGGGAAGAAGGAGGGAGCGGG + Intronic
969364224 4:6684761-6684783 CAAGGGAAGGAGGAGGCAGGGGG + Intergenic
969738939 4:9010218-9010240 CAGGGGTGGCAGGAGGAAAGGGG - Intergenic
969798139 4:9541840-9541862 CAGGGGTGGCAGGAGGAAAGGGG - Intergenic
970166394 4:13242745-13242767 CAGGGTTAGGAGGAGGATGTAGG - Intergenic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
971321866 4:25612181-25612203 CAGTGGAAGCAGCAGAAGGGTGG + Intergenic
971375246 4:26050907-26050929 CAGTGGAAGCATGAGGAAGCTGG - Intergenic
971449155 4:26784033-26784055 CAGGGCTTCCAGGAGGATGGAGG - Intergenic
971570946 4:28210010-28210032 GAGGGGAAGGAGGAGGAAGAGGG - Intergenic
972697285 4:41459860-41459882 CAGGGAAAGCTAGAGCATGGAGG + Intronic
973136644 4:46716356-46716378 AAGGGGAAGCAGGAACATGATGG + Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973964678 4:56149235-56149257 CTGGCCTAGCAGGAGGATGGGGG - Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974604904 4:64139632-64139654 CAGGGGCAGTTGGGGGATGGGGG - Intergenic
976015093 4:80542891-80542913 CAGGGGCAGCAGGGGCATGCAGG - Intronic
976405711 4:84658869-84658891 CAGAAGAAGCAGGAGAATGTGGG - Intergenic
976789248 4:88859291-88859313 CAGGAGAGGGAGGAGGAAGGAGG + Intronic
976803849 4:89023565-89023587 CAGTGGAATCAGGAGGCTTGAGG - Intronic
978072819 4:104492326-104492348 CAGGGAAAGAAGGAAGACGGGGG + Intronic
978342009 4:107728923-107728945 CAGGGTGAACAGGATGATGGTGG + Intergenic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978618995 4:110621330-110621352 CAGGGGAAGAATGAGGACGTGGG - Exonic
979558251 4:122075542-122075564 CAAGGGTGGCAGGAGGAGGGTGG + Intergenic
980205245 4:129711039-129711061 CAGGGGAAGTAGGTTGATTGAGG - Intergenic
981119267 4:141030090-141030112 GAGGCGAGGCAGGAGAATGGTGG + Intronic
981938224 4:150256184-150256206 CCGGGGCAGCGGGAGGAGGGTGG - Exonic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
983759211 4:171384744-171384766 AAGGTGAAGGAGGAGGAGGGGGG - Intergenic
984220401 4:176967568-176967590 CAGGGGAAGCATGAGGGGGTGGG + Intergenic
985278012 4:188257700-188257722 CAGTGAAAGCATGAGGATGGGGG - Intergenic
985348060 4:189027938-189027960 CAGGGCTAGCAGGTGGAGGGTGG - Intergenic
985573987 5:665300-665322 CAAGAGGAGCAGGAGGAAGGGGG + Intronic
985614279 5:910281-910303 CCGGGGAGACAGGAGAATGGAGG - Intronic
985783975 5:1884816-1884838 GAGGGGAGGAAGGAGGGTGGGGG - Intronic
985829328 5:2216546-2216568 CATGGGAAGCACCTGGATGGAGG - Intergenic
985985304 5:3510752-3510774 CAGGGCTGGCAGCAGGATGGGGG + Intergenic
986082078 5:4405473-4405495 CAGGGGAAGCTTGAGTAGGGAGG + Intergenic
986221994 5:5776354-5776376 CCTGGGATGCAGGAGGAGGGAGG + Intergenic
986249791 5:6045460-6045482 CAGGGGACACAGGAGGCCGGAGG - Intergenic
986266634 5:6196706-6196728 TAGAGGCAGCAAGAGGATGGCGG + Intergenic
986280094 5:6315700-6315722 CAGCAGGAGCAGGAGGAAGGTGG - Intergenic
986773501 5:10994339-10994361 CCGGGGAAGGAGGAGGGGGGCGG + Intronic
987353218 5:17039917-17039939 GAGGAGAAGGAGGAGGATGGGGG - Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
989261416 5:39423712-39423734 CAGGCAAAGCAGGGGCATGGGGG - Intronic
990260998 5:54022329-54022351 CAGGGGCAGCAGGGGACTGGAGG - Intronic
990488731 5:56283528-56283550 CAGGTGCAGTAGGAGGATTGTGG + Intergenic
990526483 5:56633170-56633192 AAGGAGGAGCAGGAGGAGGGAGG + Intergenic
990719617 5:58679174-58679196 AAGGAGAAGCAGCAGGGTGGGGG + Intronic
990994491 5:61717906-61717928 AAGGAGAAGCAGGTGGAAGGTGG - Intronic
991185098 5:63797080-63797102 GAGGAGGAGGAGGAGGATGGTGG + Intergenic
991499623 5:67264059-67264081 CCTGGGAGGCAGGAGGCTGGAGG - Intergenic
991605440 5:68396138-68396160 CAGTGGAAGAATGAGGAAGGGGG + Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992149011 5:73882700-73882722 CAGGGGAAGAAGAAGGGAGGTGG + Intronic
992769716 5:80035557-80035579 CAGGTGCAGCAGGAGGACGGCGG - Exonic
993442794 5:87977637-87977659 TAGTGGGAGCAGGAGGAAGGGGG - Intergenic
993466279 5:88250609-88250631 CAGGAGAAGGAAGAGGATGTTGG + Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994458861 5:100049016-100049038 AAGGGATAGGAGGAGGATGGGGG + Intergenic
995301833 5:110594151-110594173 GAGGGCAAGCAGAAGCATGGTGG + Intronic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995508799 5:112887204-112887226 CATGGGTAACAGGAGGGTGGAGG + Intronic
996118211 5:119642547-119642569 GAGGAGAGGCAGAAGGATGGAGG - Intergenic
996344173 5:122471810-122471832 CAGGGGGAGTAGAAGGATGAGGG - Intergenic
996400978 5:123062117-123062139 GAGGTGAAGCAGATGGATGGTGG + Intergenic
997668335 5:135649991-135650013 CAGGAGAAGCGGGTGGATGTAGG - Intergenic
997721408 5:136080813-136080835 GAGGGGAGGCAGGAGGGTGCGGG + Intergenic
997881309 5:137593217-137593239 CAAGGGAAGCCTGAGCATGGTGG + Intronic
998154203 5:139775222-139775244 CAGGGGACGCAGGAGTGTTGGGG + Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998394689 5:141811317-141811339 CATGGGATGCAGGAAGAAGGTGG - Intergenic
999182669 5:149681103-149681125 CAGGGGAGGGAGGAGGGAGGAGG - Intergenic
999231488 5:150064744-150064766 GAGGGGATCAAGGAGGATGGAGG + Intronic
999369872 5:151048179-151048201 CCGGGGAAGGAGGAAGAGGGTGG + Intronic
999641231 5:153675170-153675192 CAAGGGAAGCTGGAAAATGGTGG + Intronic
999776156 5:154814478-154814500 GAGGGGGAGCAGGAGGTTAGGGG - Exonic
1000302115 5:159965661-159965683 CAGAGGAAGAAGGAGGAAGGAGG + Intronic
1001412440 5:171520698-171520720 CAGGGCACGCAGGAGTCTGGGGG - Intergenic
1001543710 5:172557110-172557132 GAGCAGAAGCAGGAGGAGGGAGG - Intergenic
1001653514 5:173331089-173331111 CAGGGGTAGAAGTGGGATGGGGG + Intergenic
1002366486 5:178716595-178716617 CTGGGGAAGGAGGGGGATGAAGG + Intronic
1002447036 5:179296102-179296124 ATGGTGAAGCAGGAGGATGGGGG + Intronic
1002597268 5:180332246-180332268 CGGGGGGAGCAGGGGGATGCGGG + Intronic
1002639028 5:180621952-180621974 CCGGGGCGGCAGGTGGATGGGGG - Intronic
1002844887 6:937361-937383 AAGGAGGAGGAGGAGGATGGAGG - Intergenic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1003415129 6:5900205-5900227 CTAGGGAAGCAGGAGGAAGGAGG + Intergenic
1003550453 6:7098325-7098347 CAGGGAAAGCAGGAGGGGTGAGG - Intergenic
1003599374 6:7503218-7503240 CATGGGATGCAGGAGAAGGGAGG - Intergenic
1004167565 6:13270390-13270412 GCTGGGAAGCAGGAGGGTGGGGG - Intronic
1004252806 6:14035655-14035677 AAGGGGAAGAAGGAGCATGTCGG - Intergenic
1004266649 6:14153890-14153912 CAGGTGATGGATGAGGATGGTGG - Intergenic
1004525056 6:16399779-16399801 TTGGGGAAGCAGGGAGATGGAGG - Intronic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005816087 6:29553908-29553930 CAGCGGAGGCCGGAGGAGGGCGG + Intergenic
1005826064 6:29632581-29632603 CGAGGGAGGCAGGAGGAGGGTGG - Intronic
1005870726 6:29972616-29972638 CTGGGAGGGCAGGAGGATGGAGG + Intergenic
1006177054 6:32128765-32128787 CAGGGGAAGAACCAGGATGCAGG - Exonic
1006387485 6:33739413-33739435 AAGGGGCAGAAGGAGGAGGGAGG + Intronic
1006939776 6:37744075-37744097 CGAGGGAAGAAGGAGGAGGGTGG - Intergenic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007237561 6:40401779-40401801 GAGGGGAGGCTGGAGGCTGGAGG - Intronic
1007373891 6:41443501-41443523 GAGGGGAAGCGGGAGGGTGGGGG + Intergenic
1007398474 6:41590353-41590375 CAGGGCAGGTAGGAGGAGGGTGG + Intronic
1007656649 6:43454994-43455016 TGGGGGTAGCGGGAGGATGGGGG + Intronic
1007994843 6:46295834-46295856 TTGGGGAAGCAGCAGGAGGGAGG + Intronic
1008523069 6:52381037-52381059 CAGTGGGAGGAGGAGGGTGGGGG - Intronic
1009936482 6:70240695-70240717 AAGGTGAAGCAGGAGAAAGGGGG - Exonic
1009961957 6:70534074-70534096 CTGGGGAAGATGGGGGATGGTGG + Intronic
1010602544 6:77848391-77848413 CATGGGAAGCAGAAGGAAAGAGG + Intronic
1011215925 6:85005568-85005590 AAGAGGAAGCAGGAGGATCAGGG + Intergenic
1012319075 6:97820077-97820099 CAAGGATTGCAGGAGGATGGGGG - Intergenic
1012648159 6:101716023-101716045 AAGGGGAAGCAGGTAGAAGGTGG - Intronic
1012946811 6:105475057-105475079 CAGTGGAAGCCAGATGATGGCGG - Intergenic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013229112 6:108145360-108145382 CAGGGGAAGAAGGTGTAGGGGGG - Intronic
1013279572 6:108622977-108622999 CAGTGGAAGCAACAGGAGGGTGG + Intronic
1013479777 6:110543737-110543759 TGGAGGAAGCAGGAGCATGGAGG + Intergenic
1014177111 6:118342838-118342860 GAGGGCAAGCAGAAGCATGGTGG - Intergenic
1014528050 6:122524131-122524153 GAGGGGGAGGAGGAGGAAGGAGG - Intronic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1014837754 6:126179080-126179102 CAGTGGAGGCAGGTGGGTGGGGG - Intergenic
1014994525 6:128125373-128125395 CAGGAGCAGGAGCAGGATGGGGG - Intronic
1015185896 6:130415159-130415181 CAAGGGAAGCAGAAGGAAAGGGG + Intronic
1015293555 6:131564751-131564773 GAAGGGTAGTAGGAGGATGGGGG - Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016613648 6:146023316-146023338 CATGGGAGGCAGGAAGATGTGGG + Intergenic
1016794726 6:148105756-148105778 GAGGAGAAGGAGGAAGATGGGGG + Intergenic
1017094748 6:150794747-150794769 ATGGGGAAGCAGGGGAATGGGGG + Intronic
1017113020 6:150950273-150950295 TAGGGCTGGCAGGAGGATGGAGG - Intronic
1017190831 6:151650993-151651015 GAGGAGAAGGAGGAGGTTGGAGG - Intergenic
1017577232 6:155818459-155818481 CAGAGAAAGCAAGAGGAAGGAGG + Intergenic
1017750504 6:157486882-157486904 GAGGAGACGCAGGAGGATGCAGG + Intronic
1017751808 6:157495632-157495654 AAGGCAGAGCAGGAGGATGGTGG + Intronic
1018180434 6:161218228-161218250 CAGGGGAGGCAGTAGGTGGGAGG + Intronic
1018197594 6:161368665-161368687 CAGGGGAAGCAGGCAAGTGGAGG - Intronic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1018681620 6:166270192-166270214 CAGGGAGGACAGGAGGATGGAGG + Intergenic
1018996638 6:168715247-168715269 GGGGGGATGGAGGAGGATGGTGG + Intergenic
1019014169 6:168867649-168867671 CAGGGGTAGCATGGGGACGGAGG + Intergenic
1019217830 6:170455008-170455030 CAGGTGATGCAGGCGGACGGAGG + Intergenic
1019635762 7:2074820-2074842 GAGGGGAAACCGGAGGCTGGGGG + Intronic
1019898245 7:3999679-3999701 CAGGAGAAGCTGGAGGCTGGAGG + Intronic
1019902267 7:4030130-4030152 CAGGGGAAGCAGGAAAATTCAGG + Intronic
1020011513 7:4808084-4808106 GAGAGGAAGAAGGAGGAGGGAGG - Intronic
1020461357 7:8433538-8433560 AAGGGGGAGGAGGAGGACGGGGG - Intergenic
1021239027 7:18178034-18178056 AAGGGGAGGTAGGGGGATGGAGG - Intronic
1021479461 7:21100096-21100118 CAGGGGAAAGAGTAGGATTGTGG - Intergenic
1021588542 7:22236555-22236577 CAGGGGAAGGAGGACCATGAAGG - Intronic
1022363514 7:29685609-29685631 CCGTGGGAGCCGGAGGATGGCGG - Intergenic
1022427775 7:30284916-30284938 CCGTGGGAGCCGGAGGATGGCGG + Exonic
1022597039 7:31722655-31722677 CAGGTGAAGAAGCAGGATGGTGG + Intergenic
1022697859 7:32728135-32728157 CCGTGGGAGCCGGAGGATGGCGG + Intergenic
1022943258 7:35258700-35258722 GAGGGGAAGGAGGAGAAAGGAGG - Intergenic
1023316469 7:38942886-38942908 GAGGGGACCCAGGAAGATGGAGG + Intergenic
1023412171 7:39899040-39899062 GAGGAGAAGTAGGAGGAGGGTGG - Intergenic
1023861039 7:44217885-44217907 CAGGGCAAGCCCGAGCATGGTGG - Exonic
1023881562 7:44324291-44324313 GAAGGGACGGAGGAGGATGGGGG + Intronic
1023976702 7:45035618-45035640 CAGGTGAAGAAGGCGGATGCAGG + Intronic
1024200756 7:47103687-47103709 CATGGGGAGCATGAGGATGAGGG - Intergenic
1024937194 7:54722431-54722453 CAGGGTAAGAAGGAGAGTGGAGG - Intergenic
1024972712 7:55085387-55085409 CATGGGGAGCAGGATGCTGGTGG + Intronic
1024999561 7:55303694-55303716 GAGGGGAAGGAAGAGGAGGGAGG + Intergenic
1025198743 7:56949553-56949575 AAGGGGAGGGAGGAGGAGGGGGG - Intergenic
1025769921 7:64495073-64495095 CAGGGGAAGGAGGAGGGGCGGGG - Intergenic
1025818604 7:64942979-64943001 CAGGGGAATGAGGAGGAGCGGGG + Intergenic
1026191906 7:68136493-68136515 GAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1026191915 7:68136515-68136537 GAGGGGAAGGAGGAGGGAGGAGG + Intergenic
1026191923 7:68136534-68136556 GAGGGGAAGGAGGAGGGAGGAGG + Intergenic
1026191930 7:68136553-68136575 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
1026389731 7:69888351-69888373 GAGAGGAAACAAGAGGATGGGGG + Intronic
1026548081 7:71341931-71341953 CTGTGGATGCAGGAGGATGCAGG + Intronic
1026573903 7:71555789-71555811 CCGGTGAAGCCAGAGGATGGCGG - Intronic
1026913694 7:74107238-74107260 CTGGGAAGGAAGGAGGATGGAGG - Intronic
1027051836 7:75025596-75025618 CAGAGGAGGGAGGAGGACGGCGG - Intergenic
1027289140 7:76683854-76683876 TGGGGGTAGCAAGAGGATGGCGG - Intergenic
1027572762 7:79891461-79891483 GAGGAGAAGGAGGAGGAAGGGGG + Intergenic
1027788924 7:82614791-82614813 GAGTTGAAGCAGGAAGATGGAGG + Intergenic
1028357080 7:89923523-89923545 CAGGTACAGCAAGAGGATGGTGG - Intergenic
1029015622 7:97312879-97312901 CAGCTGAGGCAGGAGAATGGCGG - Intergenic
1029073662 7:97919707-97919729 CAGGGGTGGCAGGAGGAAAGGGG + Intergenic
1029090014 7:98040694-98040716 CAAGGAAAGGAGGATGATGGAGG + Intergenic
1029103373 7:98153051-98153073 CAGGAGAGGCAGGAGGAAGTCGG + Intronic
1029361074 7:100089032-100089054 CGGAGGAAGCAGCGGGATGGAGG + Exonic
1029443789 7:100602096-100602118 CAGGGGCGGGGGGAGGATGGGGG + Intergenic
1029488708 7:100858729-100858751 CAGGGGAGGCAAGAGGACCGTGG + Intronic
1029525231 7:101089784-101089806 CAGAGGAGGCAGGTGGGTGGAGG + Exonic
1029552929 7:101247571-101247593 CAGGGGACACAGGAAGATGAAGG + Intronic
1029906500 7:104098633-104098655 CACAGGAAGCAGGTGGAAGGCGG + Intergenic
1030473911 7:110003582-110003604 GAAGGGAAGGAGGAGGATGAAGG + Intergenic
1031798793 7:126214811-126214833 CAGCAGGAGCAAGAGGATGGAGG - Intergenic
1032016617 7:128384118-128384140 AAGGGGAGGGAGGAGGTTGGTGG + Intergenic
1032189761 7:129757884-129757906 CAGGGCATGCAGAAGCATGGAGG - Intergenic
1032192155 7:129771498-129771520 CAGGGGAGGCATGGGGATGCAGG - Intergenic
1032794660 7:135268190-135268212 CAGTGGACCCAGGAGGAAGGAGG - Intergenic
1033041713 7:137925197-137925219 GAGGGGAAGCAGGAGGCAGAGGG + Intronic
1034313129 7:150107689-150107711 CCGGGGAAGGAGGAGGTAGGGGG + Intergenic
1034348659 7:150402766-150402788 CAGGAGGAGCTGGAGGATGCGGG + Intronic
1034534908 7:151720662-151720684 GAGGGGATGGAGGGGGATGGAGG + Intronic
1034793733 7:153992978-153993000 CCGGGGAAGGAGGAGGTAGGGGG - Intronic
1034868155 7:154658270-154658292 CAGGGGAAGAAGGAGGATATGGG + Intronic
1034932381 7:155172805-155172827 CAGGGGAAGCAGATGTGTGGAGG - Intergenic
1034935333 7:155196107-155196129 AATAGGAAGCAGGAAGATGGTGG - Intergenic
1034958799 7:155351585-155351607 CTGGGGAGGCATGAGGAAGGCGG + Intergenic
1034978910 7:155463435-155463457 AAGGAGGAGCAGGAGGAAGGAGG - Exonic
1034997020 7:155584062-155584084 CAGAAGAGGGAGGAGGATGGGGG - Intergenic
1035479067 7:159167560-159167582 CAGGGGAAGGAGGGAGAGGGTGG - Intergenic
1035720314 8:1786216-1786238 GAGGGGCTGCAGGAGGAGGGGGG + Exonic
1036229884 8:6990682-6990704 TAGGAGAAGGAGGAGGACGGTGG - Intergenic
1036232335 8:7009785-7009807 TAGGAGAAGGAGGAGGACGGTGG - Intronic
1036244034 8:7101559-7101581 CAGGGGTAGCAGGAGGAAAGGGG - Intergenic
1036256764 8:7212486-7212508 CAGGGGTGGCAGGAGGAAAGGGG + Intergenic
1036308814 8:7671088-7671110 CAGGGGTGGCAGGAGGAAAGGGG + Intergenic
1036360727 8:8075023-8075045 CAGGGGTGGCAGGAGGAAAGGGG - Intergenic
1036460348 8:8947107-8947129 CAGGGGAAGCGGGTGGGAGGAGG - Intergenic
1036653774 8:10662577-10662599 CAGGGGAAGCGGGAGGGTGATGG - Intronic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1036890242 8:12591949-12591971 CAGGGGTGGCAGGAGGAAAGGGG + Intergenic
1036897809 8:12649868-12649890 CAGGGGTAGCAGGAGGAAAGGGG + Intergenic
1037234829 8:16705848-16705870 CAGAAGAAACAGGAGGCTGGAGG + Intergenic
1037568861 8:20141618-20141640 GAGGGGGAGGAGGAGGAGGGGGG + Intergenic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1037916641 8:22777191-22777213 GAGGGGAAGCAGAAGGAAAGAGG - Intronic
1038024337 8:23575616-23575638 CAGGGCAAGCAGATTGATGGTGG + Intergenic
1038085911 8:24195928-24195950 CAGGGGTAGAAGGAGGATGTGGG + Intergenic
1039042986 8:33425592-33425614 CAGAGGAAGGGGGAGGGTGGAGG + Intronic
1039338279 8:36619049-36619071 GAGGGGAAGGGGAAGGATGGGGG + Intergenic
1039634399 8:39147623-39147645 CAGAGGAAGAAGGTGGATGCTGG - Intronic
1039691291 8:39867636-39867658 GAGGGGGAGGAGGAGGAAGGCGG - Intergenic
1039834795 8:41247889-41247911 CAGGGGAAGCCGCAGGGTTGGGG - Intergenic
1040589251 8:48774236-48774258 CAGCTGAAGCAGGAGGAAGCAGG - Intergenic
1041383695 8:57278369-57278391 GAGGGGAAGCGGGAAGTTGGAGG - Intergenic
1041456631 8:58067459-58067481 CAGTGGATGGAGGAGGAAGGAGG - Intronic
1042144543 8:65714391-65714413 CACAGGAACCAGGAAGATGGAGG + Intronic
1042291436 8:67172902-67172924 GAGGAGAAGCAGGAGAATGTAGG + Intronic
1042312075 8:67388795-67388817 CAGGAGCAGGAGGAGGAGGGAGG - Intergenic
1042751699 8:72164338-72164360 CATGGCCAGCAGGAGGGTGGGGG - Intergenic
1043865169 8:85366145-85366167 AAGGGGAAGAAAGAGCATGGTGG - Intronic
1044313882 8:90727060-90727082 CAGCGGCAGCAGCAGCATGGTGG - Intronic
1046757749 8:117989247-117989269 CAGGTGAGGCAGTGGGATGGGGG - Intronic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1047767666 8:128002636-128002658 GAGAGGACACAGGAGGATGGAGG - Intergenic
1048106222 8:131413201-131413223 AAAGGGAAGCAGGAGGCAGGAGG + Intergenic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1048224488 8:132571541-132571563 GAGGGGAAGAAGGAGCAGGGAGG + Intergenic
1048417598 8:134243795-134243817 GAGGAGAAGGAGGAGGAAGGAGG + Intergenic
1048547988 8:135404859-135404881 CATGGGCAGCAGGTTGATGGTGG - Intergenic
1048874550 8:138826899-138826921 CAGGCCAAGAAGGTGGATGGTGG - Intronic
1048993367 8:139774311-139774333 CAGGAGAAACCGGAGGATGGAGG + Intronic
1049025075 8:139982892-139982914 CAGGGGGAGCAGCATGGTGGAGG - Intronic
1049109817 8:140635695-140635717 CGGGGGAGGAAGGAGGAGGGAGG + Intergenic
1049402618 8:142436333-142436355 AAAGGGGAGCAGGAGGAGGGTGG - Intergenic
1049409242 8:142465045-142465067 CAGGGGAGGCGGGCGGATGGGGG + Intronic
1049499243 8:142952700-142952722 GAGGGGAACCTGGGGGATGGTGG - Intergenic
1049533931 8:143169361-143169383 GAGGGTAAGCAGTAGGATGATGG - Intergenic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1049558182 8:143294084-143294106 GAGGGGCAGCAGGAGGAGGGGGG - Intronic
1049664453 8:143836793-143836815 CAGGGCAGGCAGCAGGATGCAGG + Intronic
1050043414 9:1519280-1519302 GAGAGGGAGCAGGAGGATGCTGG + Intergenic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1051984829 9:23071289-23071311 CAGTGGAAGCAGAATTATGGAGG - Intergenic
1053003332 9:34589756-34589778 CGAGGGAGGGAGGAGGATGGGGG - Intronic
1053003723 9:34591296-34591318 CACGGGAAGCAGGAGGCCGGCGG - Intergenic
1053165542 9:35841444-35841466 CAAGGGAAGCACTAGGAAGGAGG - Intronic
1053283204 9:36834937-36834959 CAGGTGAAACAGCAGGGTGGGGG - Exonic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1053543592 9:38999486-38999508 CTGGGTAAGCAGCAGGATAGGGG - Intergenic
1053566088 9:39253660-39253682 CCAGGGAAGCAGGAGGAAGGTGG - Intronic
1053808022 9:41822991-41823013 CTGGGTAAGCAGCAGGATAGGGG - Intergenic
1053831855 9:42091475-42091497 CCAGGGAAGCAGGAGGAAGGTGG - Intronic
1054131060 9:61365380-61365402 CCAGGGAAGCAGGAGGAAGGTGG + Intergenic
1054447666 9:65385470-65385492 CAGCGGCAGCAGGAGCATCGCGG + Intergenic
1054598689 9:67095951-67095973 CCAGGGAAGCAGGAGGAAGGTGG + Intergenic
1054622570 9:67364437-67364459 CTGGGTAAGCAGCAGGATAGGGG + Intergenic
1054728422 9:68676289-68676311 GAGAGGAAGCAGGTGGATGGAGG - Intergenic
1055078010 9:72237106-72237128 CAGGTGGAGCAGGAGCATGAGGG - Intronic
1055524023 9:77111719-77111741 CAGGGGAAAGAGGAAAATGGAGG - Intergenic
1055575936 9:77660331-77660353 CAAGGGAAGGAAGAGGGTGGAGG - Intergenic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1056121398 9:83492532-83492554 CAGGGCAGGCAGGAGGAACGGGG + Intronic
1056457998 9:86781880-86781902 TAGGGCAAGCAGCAAGATGGAGG - Intergenic
1056578473 9:87873156-87873178 AAGGGGAAGGAGGAGGAGAGAGG + Intergenic
1056703907 9:88935243-88935265 CAGTGGAATTAGGAGGAAGGAGG - Intergenic
1056850511 9:90080012-90080034 CAGAGGAAGGAGGAGAATAGGGG - Intergenic
1057096824 9:92318194-92318216 GTGGGCAAGCACGAGGATGGTGG - Intronic
1057147511 9:92768212-92768234 CAGGAGAAGCAGCTGGATGTCGG - Intergenic
1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG + Intronic
1057758124 9:97853204-97853226 GAGGGGAAGCCGGCGGAGGGAGG + Intergenic
1058026324 9:100144855-100144877 GAGGGAAAGAAGGAGGATTGGGG + Intronic
1058144969 9:101400420-101400442 ATGGGGAAGGAGGAGGATGTGGG - Intronic
1058620629 9:106879200-106879222 CTGGGCAAGCAGCAGCATGGGGG + Intronic
1059219887 9:112605378-112605400 CAGTGGAAGCAGGAGGTCAGAGG - Intronic
1059826712 9:118038025-118038047 AAGAGGATGCAGGAGGATGGGGG + Intergenic
1060035084 9:120248294-120248316 CAGGGGGTGCAGGAAGAAGGAGG + Intergenic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060617752 9:125034193-125034215 AAGGGTCAGCAGGAGGTTGGAGG - Intronic
1060696096 9:125710421-125710443 GAAGGAAAGCAGAAGGATGGAGG + Intergenic
1060913391 9:127368992-127369014 CAGGGGAAGCAGCAGATTTGAGG - Intronic
1060978146 9:127777404-127777426 CTGGGGCGGCAGGGGGATGGGGG - Intronic
1060978166 9:127777454-127777476 CTGGGGCGGCAGGGGGATGGGGG - Intronic
1060978186 9:127777504-127777526 CTGGGGCAGCAGGGGGATGGGGG - Intronic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061120218 9:128637302-128637324 CAGGGGCTGCAGCAGGAAGGTGG + Intronic
1061188775 9:129070102-129070124 CAGAGGAAGCAGTGGGAGGGAGG + Intronic
1061271365 9:129545389-129545411 CAGGGGACTGGGGAGGATGGGGG - Intergenic
1061283506 9:129610181-129610203 CAGGGGAGGGGGGAGGAGGGGGG + Intronic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1061884321 9:133583991-133584013 GAGGGGAGGCAGGAGGGTGGAGG - Intronic
1061924897 9:133801173-133801195 AAGAGGATGCAGGAGGTTGGGGG + Intronic
1061958171 9:133974356-133974378 AAGGGGAGGCTGGAGGTTGGAGG - Intronic
1062002731 9:134224990-134225012 CAGGGGAAGCCCCTGGATGGCGG + Intergenic
1062050502 9:134444396-134444418 GAGGGGAAGGAGGAGGGAGGGGG - Intergenic
1062194136 9:135263891-135263913 GAGGGGAAGGAGGAGGAGAGGGG - Intergenic
1062212185 9:135371150-135371172 CAGGGGGAGCTGGAGGCAGGAGG - Intergenic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1062478170 9:136739795-136739817 CAGGGGCGGCAGGAGGTGGGAGG + Intronic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1062558232 9:137126826-137126848 CAGCTGAGGCAGGAGGATTGTGG - Intergenic
1062590335 9:137271799-137271821 CAGGGACAGGAGGAGGGTGGAGG - Intronic
1062698491 9:137887355-137887377 CAGGGGCAGGAGGGAGATGGAGG + Intronic
1203434793 Un_GL000195v1:128893-128915 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1203733780 Un_GL000216v2:116245-116267 CAGGTGAAGCAGGAGGCTCAGGG - Intergenic
1185680013 X:1880809-1880831 GGAGGGAAGGAGGAGGATGGGGG + Intergenic
1185969119 X:4642136-4642158 AAGATGAGGCAGGAGGATGGAGG + Intergenic
1186045571 X:5532888-5532910 CAGAGGAAGAAGGAGGGAGGGGG + Intergenic
1186195805 X:7109405-7109427 GAGGGCAGGCAGGACGATGGAGG + Intronic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1187073676 X:15913372-15913394 CAGGGCAAGCATGTGGATGGAGG - Intergenic
1187200592 X:17130310-17130332 CAGGAGAAGCAGGAGTGAGGGGG - Intronic
1187265706 X:17731068-17731090 CAGAGAAAGCAAGTGGATGGAGG - Intronic
1187447668 X:19373130-19373152 CAGGGGAAGGAGGAAGAGAGAGG + Intronic
1188201118 X:27293679-27293701 CAGGGAAAGAAGGAGGATTTGGG + Intergenic
1189266951 X:39724493-39724515 CAGAGGAAGCAGGGGCGTGGGGG - Intergenic
1189288097 X:39866409-39866431 CAGGAGAGGCAGGAGGTGGGAGG + Intergenic
1189341513 X:40207951-40207973 CTGGGGAAGAAGGAGGGGGGTGG + Intergenic
1190058121 X:47193941-47193963 GAGGAGAAGGAGGAGGGTGGCGG + Exonic
1190108482 X:47574669-47574691 CAGGGTAAGCGAGAGGCTGGCGG - Exonic
1190332833 X:49246694-49246716 CGGGGGAAGCAGGAAGGTGTAGG - Intronic
1190485879 X:50924510-50924532 CAGATGAACCTGGAGGATGGAGG - Intergenic
1190501447 X:51082672-51082694 CTGGGGAAGCAACATGATGGTGG - Intergenic
1191595727 X:62942156-62942178 AAGGGGAAGAAGGAGTAAGGTGG - Intergenic
1191606165 X:63065475-63065497 GAGGGGAAGCAGAAGCAGGGTGG + Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1192007468 X:67232658-67232680 GAGGAGAAGGAGGAGGATGGAGG - Intergenic
1192165166 X:68823502-68823524 GAGGGGCAGCTGGAGGGTGGTGG + Intergenic
1192214175 X:69146703-69146725 CAAGGGAAGCAGGAAGCGGGAGG + Intergenic
1192550718 X:72051570-72051592 TAGGAGAAGCAAGAGGAAGGAGG - Intergenic
1192576255 X:72245600-72245622 CAGGGGAAGCAGGAAGGAGGAGG + Intronic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193174806 X:78380163-78380185 CAGGGGAAGAAGGGGGCTGAAGG - Intergenic
1194267367 X:91771462-91771484 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1195137117 X:101919756-101919778 CAGGGGAGGCAAGAGTATGAAGG + Intronic
1195954070 X:110310286-110310308 CTGGGGAACCATGAGGATGGTGG - Intronic
1196663549 X:118293640-118293662 TAGGGGTTGCAGAAGGATGGAGG + Intergenic
1196731085 X:118942220-118942242 AAAGGGAAGAAGGAGGAAGGAGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197753369 X:129980308-129980330 CGGGCGAAGCGGGAGGAGGGAGG - Intergenic
1197761099 X:130028910-130028932 CAGAGGAGGCAGGAGGGGGGTGG + Intronic
1197774867 X:130112036-130112058 CAGGAGAAGCAGGCCGATGCTGG - Intergenic
1198522913 X:137470980-137471002 CATTGGAGGCAGGAGGAAGGGGG - Intergenic
1198574290 X:137992935-137992957 CAGGGGAAGGTGGTGAATGGGGG + Intergenic
1199616683 X:149661342-149661364 CATACGAAGCAGGGGGATGGGGG + Intergenic
1199625958 X:149741906-149741928 CATACGAAGCAGGGGGATGGGGG - Intergenic
1199665824 X:150095659-150095681 CAGAGTCAGGAGGAGGATGGTGG - Intergenic
1199853037 X:151738890-151738912 AAGGGGAAGCAGCAGGGTAGTGG - Intronic
1199988323 X:152968583-152968605 CTGGGCCAGCAGCAGGATGGTGG + Intronic
1200125711 X:153813431-153813453 CAGGAGGACCAGGAGGATGTGGG + Intronic
1200584572 Y:4992399-4992421 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1201000384 Y:9466826-9466848 CAGGGAAGGCAGGGGGGTGGGGG + Intergenic
1201304819 Y:12541545-12541567 GAGGGGAAGCGGGAGGAAGGGGG - Intergenic
1202270967 Y:23073655-23073677 AAAGGGAAGAAGGGGGATGGTGG + Intergenic
1202295059 Y:23347027-23347049 AAAGGGAAGAAGGGGGATGGTGG - Intergenic
1202423962 Y:24707399-24707421 AAAGGGAAGAAGGGGGATGGTGG + Intergenic
1202446827 Y:24962686-24962708 AAAGGGAAGAAGGGGGATGGTGG - Intergenic
1202594133 Y:26519504-26519526 CAGGAGAAGGAGAAAGATGGGGG - Intergenic
1202627233 Y:56872176-56872198 CAGGTGAAGCAGGAGGCTCAGGG + Intergenic