ID: 973705553

View in Genome Browser
Species Human (GRCh38)
Location 4:53576474-53576496
Sequence CCCTGCCCTTCCCATGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 2, 1: 0, 2: 4, 3: 39, 4: 412}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973705547_973705553 7 Left 973705547 4:53576444-53576466 CCAAAGTGCAGCTGACTCTTCCC 0: 2
1: 0
2: 5
3: 22
4: 206
Right 973705553 4:53576474-53576496 CCCTGCCCTTCCCATGAGGCAGG 0: 2
1: 0
2: 4
3: 39
4: 412
973705546_973705553 19 Left 973705546 4:53576432-53576454 CCTCAGATGGTGCCAAAGTGCAG 0: 1
1: 1
2: 4
3: 50
4: 343
Right 973705553 4:53576474-53576496 CCCTGCCCTTCCCATGAGGCAGG 0: 2
1: 0
2: 4
3: 39
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973705553 Original CRISPR CCCTGCCCTTCCCATGAGGC AGG Intronic
900101269 1:963094-963116 ACCTGCCCTCCCCAGGCGGCGGG + Exonic
900418083 1:2544129-2544151 CCCTGCCCTACCCCTGATGCAGG + Intergenic
900436108 1:2632050-2632072 CCCTCCCCTTACCCTCAGGCAGG + Intronic
900617166 1:3570702-3570724 CCCTGCCCTGCCCCTGTGCCAGG + Intronic
900698027 1:4024398-4024420 CCCTGCCCTCCCCACCAGCCAGG - Intergenic
900777497 1:4595804-4595826 CATTGCACTTCCCATGACGCTGG + Intergenic
901095530 1:6676238-6676260 CCTTGCCCTTCAGATGGGGCTGG - Intronic
901217105 1:7561064-7561086 CTGGGCGCTTCCCATGAGGCAGG + Intronic
902184555 1:14715328-14715350 CCCAGCCCCTCCCATCAGGCTGG - Intronic
902384808 1:16070401-16070423 CGCTGCCTTTCCCATGAGGCAGG + Intronic
902477922 1:16697931-16697953 CCCTGCCCTTTCCTCAAGGCTGG + Intergenic
902606006 1:17569733-17569755 CCCAGCCTTTCCCACGGGGCAGG - Intronic
902710232 1:18234279-18234301 CCCTGGCCTTCCAAAGAGCCAGG + Intronic
902798949 1:18817755-18817777 CGCTGCACTCCCCATGAGGCTGG - Intergenic
903102172 1:21040170-21040192 CCCTCTCCTTCCCCTGAGGTTGG - Intronic
903124539 1:21238656-21238678 TCCTGCTCTTCCCAGGAGGCAGG - Intronic
903217125 1:21849375-21849397 CCCTGTCCTTCACATGGGGAAGG + Intronic
903217364 1:21850613-21850635 CCCTGTCCTTCACATGGGGAAGG + Intronic
903734799 1:25523304-25523326 CCACATCCTTCCCATGAGGCGGG + Intergenic
904078850 1:27859234-27859256 GCCTGCCCTGCCCCTGTGGCTGG + Intergenic
904679092 1:32216315-32216337 GCCTGCCCCACCCATGAGGTAGG - Exonic
904890778 1:33777980-33778002 TGCTGCCTTTCACATGAGGCTGG + Intronic
904936154 1:34131179-34131201 TCCTGACTATCCCATGAGGCAGG + Intronic
905212680 1:36385546-36385568 CTCTGCCCTTCCCCGGCGGCAGG - Intronic
905286841 1:36886195-36886217 TCCTTCCCTCCACATGAGGCCGG - Intronic
905832770 1:41086559-41086581 CCCTGCCCTGCCCCTGGAGCTGG + Intronic
905867253 1:41382819-41382841 CCCTCCCCTTCCCCGGCGGCCGG - Exonic
905890590 1:41516293-41516315 CCCGGCCCTGCCCATGGTGCTGG - Intronic
906546066 1:46620238-46620260 CCCCTCCCTGCCCAGGAGGCAGG + Intergenic
906687422 1:47771674-47771696 CCCTGCCCTTCCCCCAAGCCTGG + Intronic
906874929 1:49527247-49527269 CCCTGACCTTACCAAGTGGCAGG + Intronic
907290540 1:53409747-53409769 CGCTGCCCTTCTCACCAGGCTGG + Intergenic
907309279 1:53530046-53530068 CCCTGCCCCTCCCATCCTGCTGG + Intronic
908785885 1:67734155-67734177 CTCTGCCCTGCCCTTGAGTCAGG - Intronic
909013903 1:70363264-70363286 CTCCTCCCTTGCCATGAGGCAGG + Intronic
909386806 1:75067605-75067627 CCCTGCTCATCCCCAGAGGCTGG + Intergenic
909761148 1:79288965-79288987 CCCTGACCTTACCCTGAAGCAGG + Intergenic
916096014 1:161350917-161350939 CTTTGCCCCTCCCAAGAGGCAGG - Intronic
917546079 1:175969384-175969406 CTCTGCCCTTCCACTGAAGCAGG + Intronic
918249057 1:182685400-182685422 ACCTGCCATGCACATGAGGCAGG + Intergenic
919539102 1:198827349-198827371 CTCTGTCCTTCCAATAAGGCAGG - Intergenic
920286535 1:204883743-204883765 CCCTGCCAATCCCATGCTGCTGG - Intronic
921253376 1:213317968-213317990 CCCTGCTTGCCCCATGAGGCAGG - Intergenic
922145603 1:222940709-222940731 TCCTGCCCTTTCCATCAGGAGGG - Intronic
922204841 1:223437187-223437209 CCCACCCCTTCCCAGGAGGCTGG + Intergenic
922217900 1:223535567-223535589 CAATGCCCTTCCCCTGAGCCTGG + Intergenic
923144243 1:231186762-231186784 CGTCGCCCTTCCCCTGAGGCTGG + Intronic
923188963 1:231601777-231601799 CCATACCTTTCCCATTAGGCTGG - Intronic
924118664 1:240773899-240773921 CTCTGGCCTTCCCTTGAAGCAGG + Intergenic
924641209 1:245835406-245835428 CCGTGCCCGGCCCCTGAGGCAGG + Intronic
924707659 1:246512313-246512335 CCCCAGTCTTCCCATGAGGCTGG + Intergenic
1063879614 10:10517644-10517666 GCCTACCCTTCCCATGCTGCAGG - Intergenic
1064227751 10:13502713-13502735 CACAGCCCTCCCCATCAGGCCGG + Intronic
1064251550 10:13710132-13710154 CCCAGGCCTGCCCATTAGGCTGG - Intronic
1067098716 10:43319429-43319451 CCATGCACTTCCCATGAGCGGGG - Intergenic
1067548830 10:47219026-47219048 CCCTGCCCCTGCCCTGAGTCTGG + Intergenic
1069900204 10:71702534-71702556 CCCTGGTCTTCCCAGGTGGCAGG + Intronic
1069978871 10:72238287-72238309 GCCTCAGCTTCCCATGAGGCTGG - Intergenic
1070130315 10:73651276-73651298 CCCCTCCCTTCCCATAATGCTGG - Intronic
1070307898 10:75250776-75250798 CCCTGCCTTCCCCATGAATCTGG - Intergenic
1070967239 10:80536939-80536961 CCCTTCCTTGCCCATGAGGGTGG - Intergenic
1071427266 10:85571524-85571546 CTCTGCACTTCCCATGGAGCTGG + Intergenic
1071600276 10:86955615-86955637 GCCTCCCCTTCCCATGCTGCAGG + Intronic
1071751160 10:88477716-88477738 CCATGACCTTCCTATGAGGTGGG + Intronic
1071753103 10:88503769-88503791 CCCTCCCCTTCCCTTGAGTATGG + Intronic
1072627026 10:97119211-97119233 CCCTGACCTTCCTGTGAGGGTGG - Intronic
1073029061 10:100510274-100510296 CCATGCCTCTCCCATGTGGCTGG + Intronic
1074709428 10:116164804-116164826 CCCTGCCATCCCCCTGAAGCCGG + Intronic
1075625594 10:123962462-123962484 CCCTGCCCATCCCAGGAATCTGG - Intergenic
1075655717 10:124159811-124159833 CCCTGCCCTCCCACTGGGGCTGG - Intergenic
1075679313 10:124321209-124321231 ACGTGACCTTCCCAGGAGGCAGG + Intergenic
1075873663 10:125789233-125789255 CCCTGCCCCTCACCTGAGCCTGG - Intronic
1075923062 10:126229144-126229166 GCCTCCCCTTCCCAGGAGGCGGG + Intronic
1076468751 10:130704023-130704045 CACTGCACTTCCCATCAGCCTGG - Intergenic
1077019000 11:409247-409269 CCCGGCCCCTCCTATGAGACAGG - Intronic
1077114363 11:876650-876672 CCCTGCTGTACCCTTGAGGCAGG + Intronic
1077223135 11:1426146-1426168 CCCTGCCCGTCCCATGCAGCTGG - Intronic
1077288694 11:1778979-1779001 TCCCGCCCTGCCCATGAGGATGG - Intergenic
1077464143 11:2725616-2725638 ACGTACCCTTTCCATGAGGCTGG + Intronic
1077471111 11:2761001-2761023 CTCTGCCCTTGCCGTAAGGCAGG - Intronic
1081668039 11:44927949-44927971 CCCAGCCCAGCCCATGAGCCTGG + Intronic
1083263163 11:61533977-61533999 CCATGCCGTTCCCAGGATGCTGG + Intronic
1083333527 11:61910192-61910214 ACCTGCCCTTCCCCTGCAGCGGG - Intronic
1083335223 11:61917956-61917978 CCCTCCCCTTCCCAGCAGGCAGG - Intronic
1083661721 11:64254546-64254568 CCCTGCCCTGCCCGTGGGGGTGG + Intronic
1083743753 11:64723893-64723915 CTCTGGGATTCCCATGAGGCAGG - Intergenic
1083996162 11:66273823-66273845 CTTTGCCCTTCCCGTGAGACCGG - Intronic
1084170541 11:67398899-67398921 CCCTCCCCTTCCCCTGCCGCAGG + Intronic
1084302538 11:68260978-68261000 TCCTGCCCTGCTCATGAGGTGGG - Intergenic
1084956590 11:72694885-72694907 CCCTACCCTGCACATGAGGATGG - Intronic
1085151182 11:74253917-74253939 CATTGTCCATCCCATGAGGCAGG - Exonic
1086410191 11:86537490-86537512 CCATGCCCTGCCCGTGGGGCAGG + Intronic
1086863865 11:91956807-91956829 CCCTGCCCTTCACAACAGCCAGG + Intergenic
1089173800 11:116534298-116534320 CCCTGGCCTTCAAAAGAGGCAGG + Intergenic
1089214422 11:116827227-116827249 CCATGCCCTTCCCACCAGGCTGG - Intergenic
1089339096 11:117745478-117745500 CTCTGCCCTTCCCATGCAGGTGG + Intronic
1090387271 11:126364410-126364432 CCCTCCCCTCCCCAGGAAGCAGG - Intronic
1090389835 11:126381608-126381630 CCCTCCCCTCCCCAGGAAGCAGG - Intronic
1091274733 11:134342553-134342575 GCCTGCCCTTCCCCTGCCGCGGG + Intronic
1091585005 12:1811097-1811119 CCCTGCCCTTGCCCAGAGTCAGG + Intronic
1096086908 12:48871502-48871524 CCCTTCCCTTCATATGACGCAGG + Intergenic
1096208699 12:49745168-49745190 CCCTGCCACTCCCAGGAGGTAGG - Intronic
1096789526 12:54036175-54036197 CCCAGCCCATCCCAGGAGCCTGG - Intronic
1096801042 12:54110656-54110678 CCCTACCCTTCCAATGTGGGAGG - Intergenic
1098831764 12:75373000-75373022 CACTGCCCTTTCCATGACGGAGG + Intronic
1099171161 12:79366443-79366465 CCCTGACCTTGCCAAGAGGCAGG + Intronic
1099838689 12:87939078-87939100 TCCTGCCCTTCCCATCATCCAGG + Intergenic
1101821485 12:108187727-108187749 TCCTACCTTTCCAATGAGGCAGG + Intronic
1102255505 12:111412424-111412446 CCGAGCCCAGCCCATGAGGCAGG + Intronic
1102693191 12:114777840-114777862 CCCAGCTCTTCCAATGAGGAAGG + Intergenic
1103212515 12:119177182-119177204 TCCTGCTCTTCCCATGCAGCTGG - Intergenic
1103326353 12:120123707-120123729 CACTCCCCTTCCCCTGGGGCAGG + Intergenic
1103513528 12:121491301-121491323 CTTTACCCTTCCCATGAGGCTGG - Intronic
1104230296 12:126877942-126877964 TCCTGCCCTTCCTATAAGGATGG - Intergenic
1105444374 13:20439980-20440002 TTCTGCCCTTCCCATGAAGCAGG + Intronic
1105929922 13:25042628-25042650 ACCTGCCCTTCCCATGGTGAGGG - Intergenic
1106246598 13:27954735-27954757 CCCGCCCCTTCCCCTGCGGCCGG - Intergenic
1106249456 13:27972523-27972545 CCCTGCCCTTGCCACCAGCCAGG - Intergenic
1106465879 13:30014125-30014147 CCATGCCCATTCCAGGAGGCTGG - Intergenic
1106471958 13:30064111-30064133 TTCTGACCTTCCCCTGAGGCAGG - Intergenic
1106949453 13:34866878-34866900 TTCTGACCTTCCCATGAAGCAGG + Intergenic
1107332507 13:39316950-39316972 TCCAGCCCTTCCCAGGAGGTAGG - Intergenic
1110458088 13:75712334-75712356 CCCTGCCCTCCCCTTGAGCTGGG + Intronic
1111355965 13:87102987-87103009 CACTGCCCTTGCGATAAGGCAGG + Intergenic
1111662943 13:91234225-91234247 CCCTGGCCTTCCTATCAGGTAGG - Intergenic
1111945529 13:94661180-94661202 CCCTGCCCTTATCATGTAGCGGG + Intergenic
1112443214 13:99440241-99440263 CCCTGACTTTCCCCTGAAGCAGG + Intergenic
1112814114 13:103252013-103252035 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
1113195826 13:107804370-107804392 CACTTCCCTTTCCTTGAGGCTGG + Intronic
1113297899 13:108982229-108982251 ACCTGCTCTTGCCATGAGGCAGG + Intronic
1113541684 13:111114757-111114779 CCCTGCCCTGCCGGTGAGGTCGG + Intronic
1116964521 14:51000468-51000490 CCCTACCCTTCTTATGAGACAGG - Intronic
1117452481 14:55865164-55865186 CCCTGCCCTCTCCACCAGGCAGG - Intergenic
1117484331 14:56178735-56178757 CCCAGCCCTCCCCAGGAGACGGG - Intronic
1118607387 14:67514352-67514374 CCCTGCCCTTGCCAGGAACCGGG + Intronic
1121454543 14:94029931-94029953 CTCTGCCTTTCCCAAGATGCAGG - Intronic
1121500618 14:94434028-94434050 CCCCTCTCCTCCCATGAGGCTGG - Intergenic
1122114896 14:99522730-99522752 CCCTGCCCATCCGATGGGGGAGG - Intronic
1122720673 14:103720501-103720523 GCCTGCCCTCCCTTTGAGGCTGG - Intronic
1123008435 14:105335545-105335567 GCCAGCCCTGCCCATGAGGGAGG - Intronic
1202836006 14_GL000009v2_random:77545-77567 CCCTGCCCATCCCATCCTGCTGG - Intergenic
1125628227 15:41126640-41126662 TCCTGCCCTTACCAGGAAGCTGG + Intergenic
1125725554 15:41866563-41866585 CCCAGCCATTCCCAGGAGGCTGG + Intronic
1125760840 15:42094486-42094508 CCCAGCCCTTGCCAAGATGCTGG + Exonic
1128762535 15:70227197-70227219 CTCTGCCCTTGACAGGAGGCAGG - Intergenic
1128763893 15:70239111-70239133 ACATGGCCTCCCCATGAGGCTGG + Intergenic
1130169555 15:81497494-81497516 CCCTGGGCTTTCCAGGAGGCTGG + Intergenic
1131050684 15:89345982-89346004 CCCAGCCCTTGACATGAGTCTGG + Intergenic
1131983980 15:98023075-98023097 CCTTTCCCCTCCCAAGAGGCTGG + Intergenic
1132933818 16:2471364-2471386 CACGGCCCTTCCCGGGAGGCCGG + Intergenic
1134810932 16:17166481-17166503 CTGAGCCCTTCCCATGGGGCAGG - Intronic
1135982933 16:27162706-27162728 CCCTCCCATTCCCAGCAGGCAGG + Intergenic
1136655369 16:31706199-31706221 CACTCCCCTTCCCCTGACGCAGG - Intergenic
1137227853 16:46532304-46532326 CCCCTCCCTTCCCATGAGATTGG + Intergenic
1137270913 16:46901775-46901797 CCCTGCCCTCCCTTTGAGTCTGG + Intronic
1137271062 16:46902415-46902437 CCCTGCCCATTCCAGGGGGCAGG + Intronic
1138128307 16:54456851-54456873 CCCTGCCCTTGCGATAAGGCAGG - Intergenic
1138257569 16:55580069-55580091 CCCAGTCTTTCCCCTGAGGCTGG + Intronic
1138496013 16:57409885-57409907 TCCTGCCCTGCCCAGGGGGCTGG - Intronic
1139229228 16:65266680-65266702 CCTTGCCCTTCCCAAAATGCTGG - Intergenic
1139649262 16:68354045-68354067 CCCTGCCCCTCTCATGTGGATGG - Intronic
1139937184 16:70579883-70579905 CCCCGCCCTTCTCATCAGACGGG + Exonic
1139958407 16:70704284-70704306 CCCTTCTGTTACCATGAGGCAGG - Intronic
1140774714 16:78239307-78239329 CTTTGCCCTTCCCAGGAGGAAGG - Intronic
1141762939 16:86040535-86040557 CGCTGTCCCTCCCTTGAGGCTGG + Intergenic
1141762946 16:86040565-86040587 CGCTGTCCCTCCCTTGAGGCTGG + Intergenic
1141762953 16:86040595-86040617 CGCTGTCCCTCCCTTGAGGCTGG + Intergenic
1141821763 16:86451062-86451084 CCCTGCTGTGCCCATGAGCCTGG + Intergenic
1141859072 16:86704282-86704304 GCATGCCCTTTCCAGGAGGCAGG - Intergenic
1142380819 16:89730927-89730949 CCCTGGCCTTCCCCTCTGGCGGG - Intronic
1142406654 16:89893957-89893979 TCCTGCCCTTCCCAACAGGAAGG + Intronic
1142664562 17:1455579-1455601 CCCTGCCCTACCCTTGCGCCTGG + Intronic
1142899798 17:3004763-3004785 CCCTACCCTTCCGATTCGGCAGG + Intronic
1142959455 17:3543379-3543401 CCCTCACCAACCCATGAGGCTGG - Intronic
1143516625 17:7422464-7422486 TCCTCCCCCTCCCCTGAGGCAGG + Intergenic
1143732382 17:8888421-8888443 CACGGCCCTGCCCCTGAGGCGGG - Exonic
1144025676 17:11274153-11274175 CCCTGCCCCTCCCATCAAGGAGG + Intronic
1144674637 17:17153948-17153970 TTCTGCCCTTCCCCCGAGGCTGG + Intronic
1144769819 17:17753196-17753218 CCCTGCCTTCCTCCTGAGGCAGG - Intronic
1145019072 17:19415946-19415968 CCCTGCCAGGCCCATGAGCCCGG - Exonic
1145976066 17:28985150-28985172 GTCTGCCCCTCCCATGAGGCAGG - Intronic
1146000696 17:29128590-29128612 CCCTGCCCATCCCATGCAGAGGG + Intronic
1146008521 17:29177428-29177450 CCCTGCCCTTCTTTTGAGGTAGG - Intronic
1146138474 17:30344147-30344169 TCCTGCCCTTTCCACAAGGCAGG + Intergenic
1146667543 17:34715174-34715196 CCCTGACCTGCCCCAGAGGCTGG + Intergenic
1147533118 17:41298723-41298745 CTCTGTCCTTGCCATAAGGCAGG + Intergenic
1148124045 17:45227948-45227970 CCCTGCCCCCCTCAGGAGGCAGG + Intronic
1148195329 17:45708934-45708956 CTGTGCCCTTGCCTTGAGGCTGG - Intergenic
1148621589 17:49038598-49038620 CCCTCCCTTTCCCAGGAGGCTGG - Intronic
1148735028 17:49860486-49860508 CCCCGCCCTTCCCCTGATGGTGG - Intergenic
1150220600 17:63493791-63493813 CCCAGACCATCCCAGGAGGCAGG + Intronic
1150816082 17:68392906-68392928 CACTGCCTTTTCCATTAGGCGGG - Intronic
1151441454 17:74132003-74132025 CTCTGCCCTTCCTCTGAAGCAGG - Intergenic
1151450124 17:74193687-74193709 CTCTGCCCTCCCCAGGAGCCTGG + Intergenic
1151569221 17:74917767-74917789 CCCTGCCCTCCCTCTGGGGCAGG + Exonic
1152213941 17:79021318-79021340 CCCTCCTCTTCCCAAGAGGATGG + Intergenic
1152278699 17:79372665-79372687 CCCTGCCCTGCCCCTGTGGGTGG - Intronic
1152290288 17:79436457-79436479 CCCTGTCCCGCCCATGGGGCTGG - Intronic
1152319047 17:79597716-79597738 TCCTGCCTTTCCCAGGAGGGAGG + Intergenic
1152708622 17:81859112-81859134 CCCTGCCCTTCCAAGTCGGCAGG + Intronic
1152792988 17:82292411-82292433 CCCAGTCCTTCCCCTGCGGCTGG + Intergenic
1152802809 17:82339785-82339807 CCCTCCTCTCCCCATGAGGCTGG - Intergenic
1157265653 18:46218512-46218534 ACCTGCCATTCCCATAAGACAGG + Intronic
1157408353 18:47442629-47442651 CCAGGCCCTTCCCTTGAGTCTGG + Intergenic
1157473539 18:48007684-48007706 TCCTCCCCTGCCCATGAGGAGGG + Intergenic
1157839663 18:50944900-50944922 CACTGCCCCTCACATCAGGCAGG + Intronic
1160167317 18:76525608-76525630 CCCAGCCCCTCCCGGGAGGCTGG - Intergenic
1160886101 19:1349054-1349076 CCTTGCCCTTCCCAAAATGCTGG + Intergenic
1160892568 19:1387069-1387091 CTCTGCGCTTCCTTTGAGGCTGG + Intronic
1161291230 19:3494352-3494374 CCCGGCCCGTACCATGAGACAGG + Intronic
1161294530 19:3513039-3513061 CCTTGCCTTTCACATGAGGAGGG + Intronic
1161493469 19:4575329-4575351 CTCTGCCCCTCCCAAGAGGCTGG + Intergenic
1161514553 19:4689402-4689424 CCCTGCCCTACCCAGGAGGCAGG + Intronic
1161807320 19:6452229-6452251 CCTTCCCCTTCCCCTGGGGCTGG - Intronic
1162955862 19:14097540-14097562 CCCTCCCCTTCCCCTGAGGCCGG - Intronic
1163615197 19:18323006-18323028 CCCTGCCCTCACCATGGTGCCGG + Exonic
1165100582 19:33436344-33436366 CCATGCCCTGCCTAAGAGGCAGG + Intronic
1165256066 19:34577820-34577842 CCCAGCCCCTCCCATGGTGCTGG + Intergenic
1166214732 19:41327683-41327705 CCCTGCCCTGCCCCTGCGGTCGG + Intronic
1166218537 19:41351744-41351766 CCCAGCACTTCCCCTGCGGCTGG + Intronic
1167074762 19:47241298-47241320 CCCAGCCCTTCCCCGGGGGCGGG - Intergenic
1167173408 19:47848902-47848924 CCCTGCCATTCTGCTGAGGCTGG - Intergenic
1168105517 19:54163698-54163720 CCCAGCCATCCCCGTGAGGCTGG + Intronic
1168164090 19:54534574-54534596 CCCTGCCCATCCTATAAAGCAGG + Intronic
1168185239 19:54696261-54696283 AACTGCCCTCCCCAGGAGGCTGG - Intronic
1202636632 1_KI270706v1_random:49817-49839 CCCTGCCCATCCCATCCTGCTGG + Intergenic
1202711942 1_KI270714v1_random:23758-23780 CCCTGCCCTTTCCTCAAGGCTGG + Intergenic
925210641 2:2042891-2042913 CCCTGCTCTTCCCTGCAGGCAGG + Intronic
925382141 2:3436055-3436077 GCCTGCCCTCCACAAGAGGCTGG - Intronic
926144221 2:10386928-10386950 CTCTGGCCTCCACATGAGGCAGG + Intronic
927729947 2:25462366-25462388 CCCTGACCTTGTCCTGAGGCTGG + Intronic
927946348 2:27137405-27137427 CCCTGGCCTGGCCCTGAGGCAGG + Exonic
927975790 2:27337138-27337160 TCCTGTCCTTCCCCTGATGCTGG - Intronic
928722638 2:34138181-34138203 CCCTTGCCTTCCTAGGAGGCAGG - Intergenic
929938578 2:46313288-46313310 CTCAGCCCCACCCATGAGGCTGG + Intronic
932053199 2:68419177-68419199 AGATGCGCTTCCCATGAGGCAGG - Intergenic
933688494 2:85161512-85161534 CCATCCCCATCCCAGGAGGCAGG - Intronic
933724507 2:85418913-85418935 CCCTGCCCTCCCTACGAGGTTGG + Intronic
934969844 2:98754488-98754510 GTCTGTCCTTCCCTTGAGGCAGG - Intergenic
935319569 2:101872660-101872682 CCCTCCCTGTCCCATGAGTCAGG - Intronic
936064089 2:109317461-109317483 CCCTGCTCTTCCCCTGGGTCTGG + Intronic
937036142 2:118784151-118784173 CCCTGGCCTTCCCTTTAGCCAGG - Intergenic
937278388 2:120701211-120701233 CCCTGCTCTCCCCACCAGGCTGG - Intergenic
937309798 2:120895043-120895065 CCCTCCCCTCCCCATCAGCCAGG - Intronic
937820739 2:126307951-126307973 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
937871902 2:126792189-126792211 CCATGCCCTTCCCATGAGCCAGG + Intergenic
938030261 2:127986142-127986164 CTCTGTCCTTGCCATAAGGCAGG + Intronic
938051385 2:128175747-128175769 CCCTCCCCTTCCCAGGAGCATGG + Intronic
938644695 2:133318776-133318798 CGCTGCCCTTCACATGATGGTGG + Intronic
940195832 2:151093061-151093083 CCCTGACCTTTTCATGAGGATGG + Intergenic
942076207 2:172359190-172359212 TCCTGCCCTTCCCAAGATGGAGG + Intergenic
943834735 2:192504972-192504994 CCCTGCCCCTCCTACGATGCAGG + Intergenic
946426794 2:219602865-219602887 CCTTGCTCTTGCCATGAGGGTGG + Intronic
947976449 2:234370556-234370578 CTCTGACCTTCCCCTGAAGCAGG - Intergenic
947981999 2:234418561-234418583 CCCTCCCCTTCCCACAAGTCTGG + Intergenic
948588378 2:239035250-239035272 CCCTGCGCTTCCCAGGGGGGTGG + Intergenic
948653974 2:239465381-239465403 CTGTGCCCTTCCCATGGAGCTGG + Intergenic
948708945 2:239813406-239813428 CCCTGCCATTCCCAGGAGGAGGG + Intergenic
948758367 2:240172758-240172780 CCCTGAACTTCCCATTTGGCAGG - Intergenic
1169538987 20:6579780-6579802 CCCTTCCCCTCCCTTGAGCCAGG + Intergenic
1170637275 20:18118388-18118410 CCCTCCCCTCCCCATGACTCTGG + Intergenic
1170781398 20:19428803-19428825 ACCTGCCCTGCCCAGGAGGTGGG + Intronic
1170844406 20:19950100-19950122 CCCTGCCCTTCCAAAGTGGATGG + Intronic
1171531729 20:25857676-25857698 CTCTGCCTTTGTCATGAGGCCGG - Intronic
1171795615 20:29564014-29564036 CCCTGCCCTTCCAATGTGGGAGG + Intergenic
1171852814 20:30320447-30320469 CCCTACCCTTCCAATGTGGGAGG - Intergenic
1171882767 20:30630748-30630770 CCCTGCCCATCCCATCCTGCTGG + Intergenic
1172035832 20:32010311-32010333 CCCTGCCCTCCCCATCAGATGGG + Intergenic
1172126318 20:32627134-32627156 CCCACCCCTTCCCCGGAGGCCGG - Intergenic
1172129853 20:32648277-32648299 CCCTGCCCTTCCCATCATTCAGG + Intergenic
1172144011 20:32743595-32743617 CCCTGCCCCTCCCCGGAGCCCGG - Exonic
1172886125 20:38232022-38232044 CCCTTTCCTCCCCATGAGGATGG - Intronic
1173138891 20:40464708-40464730 CTCAACCCTTCCCATGAGTCAGG + Intergenic
1174064697 20:47856064-47856086 CCCTGCCCTTCTCATGATTTTGG + Intergenic
1175517072 20:59576748-59576770 CACAGCCCTGCCCTTGAGGCAGG - Intergenic
1175540363 20:59744181-59744203 CCCATCCCTTCCGATGGGGCAGG - Intronic
1175811360 20:61860041-61860063 ACCTTCCCCGCCCATGAGGCAGG - Intronic
1175835111 20:61988834-61988856 CCCGGCCCTTCTCATGAGTGAGG + Intronic
1175909378 20:62397339-62397361 CCCTGCCCCATCCATGGGGCCGG - Intronic
1175926413 20:62473650-62473672 CCCTCCCCTCCCCAGGAGCCTGG + Intronic
1175994923 20:62807768-62807790 CCCTGCCCTTCCCCTCTCGCGGG + Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176426858 21:6553438-6553460 CCATGCCCTCCCCAGGTGGCAGG + Intergenic
1177610825 21:23445671-23445693 CACTGCCCTTGCCAAGAGGAAGG + Intergenic
1179024815 21:37671211-37671233 CCCTTCCCTTCCCTGGAGGTTGG - Intronic
1179462739 21:41548602-41548624 TCCTCCCCATCCCATAAGGCAGG + Intergenic
1179517466 21:41918555-41918577 CCCTGCCCCACCCAAGATGCAGG - Intronic
1179655941 21:42844849-42844871 CCCCGCCCCCACCATGAGGCTGG + Intronic
1179681339 21:43023348-43023370 CCCTGCCCATCACATGGGGACGG - Intronic
1179702349 21:43161760-43161782 CCATGCCCTCCCCAGGTGGCAGG + Intronic
1179711174 21:43264069-43264091 CCCTCCCCTTCCCCTGGGGAGGG + Intergenic
1179826184 21:43967887-43967909 CCCTGACCATCCCAGGAGGAGGG + Intronic
1179900523 21:44391120-44391142 CCCAGCCCTTCCCTTGAGGGTGG + Intronic
1179994715 21:44968581-44968603 CTCTGCCCTTCCCCTGTGGCTGG + Intronic
1180364238 22:11924496-11924518 CCCTGCCCATCCCATCCTGCTGG - Intergenic
1181030435 22:20146852-20146874 CCCTGCCCCTGGCATGTGGCAGG - Intronic
1181275761 22:21686705-21686727 CCCTGCCAGCCCCATGAGGCTGG + Intronic
1181340029 22:22171517-22171539 CCCTGCCATTCCCAGAGGGCTGG + Intergenic
1182621562 22:31621329-31621351 ACCTGCCCTTCCCACCAGGTGGG - Exonic
1183344961 22:37302442-37302464 CCATGCCCATCCTATGAGGCAGG - Intronic
1183479769 22:38057161-38057183 CCCTGCCCTTCCCAAGATGGCGG + Intronic
1184225924 22:43128863-43128885 CCCTGCCCTGGCCAGGAGACGGG - Intronic
1184412626 22:44333610-44333632 CTCTGCCCCTCCCATGAGCAGGG - Intergenic
1184757738 22:46526423-46526445 CCCTGCCTTCCCTCTGAGGCTGG + Intronic
1184981363 22:48097839-48097861 CCCTGCCCTCCCCACCTGGCGGG - Intergenic
1185059279 22:48597607-48597629 CCCTGCCGTTCCCCTCTGGCTGG + Intronic
1185155625 22:49191830-49191852 CCCTGCCCTTCCTGTGAGGTGGG - Intergenic
950436408 3:12983111-12983133 ACCTGCCCCTCCTATGAGACAGG + Intronic
950681248 3:14586501-14586523 CCCTGCCCTCCCCCGGAGGCTGG + Intergenic
950689481 3:14644152-14644174 CCCTGCCTCTCCCAGGAGACAGG - Intergenic
950704252 3:14770119-14770141 CCCTGCCATTCTCAGGGGGCAGG - Intronic
950873043 3:16245686-16245708 CCCTGCCCTTCCCATGGATTGGG - Intergenic
951549409 3:23861922-23861944 CTCTGTCCTTGCCATAAGGCAGG + Intronic
952298760 3:32085509-32085531 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
954388173 3:50255241-50255263 CCCTGCCATGCCCTGGAGGCTGG - Intronic
954434684 3:50489790-50489812 CCCTGCCATTCCCATGGCCCTGG - Intronic
956705656 3:71996702-71996724 CTCTGACCTTTCCCTGAGGCAGG + Intergenic
957345219 3:78951651-78951673 CCCTGCGCTTTCCCTGATGCTGG - Intronic
961324812 3:126103743-126103765 CCCTGCCCCTCCCTCGTGGCTGG - Exonic
961625326 3:128258323-128258345 CCCTGTCCTTCCCACGGTGCTGG - Intronic
962959087 3:140293401-140293423 CCATGGCCTACCCATGAGGAAGG - Intronic
963047963 3:141117229-141117251 CCCAGCACTCCCCACGAGGCAGG + Intronic
965520195 3:169662941-169662963 CCCTCCCCTTCCCCCCAGGCGGG - Intronic
967978160 3:195046800-195046822 CTGTGCCTTTCCCAGGAGGCAGG - Intergenic
968528158 4:1075154-1075176 CACAGCCCCTCCCATGTGGCAGG - Intronic
968654888 4:1774150-1774172 CCCCATCCTTCCCATGAGCCAGG - Intergenic
968729965 4:2264984-2265006 CCCTGCCCTTCCCCAGAGCCAGG + Intergenic
968775127 4:2535983-2536005 CCCCGCCCAGCCCACGAGGCAGG + Intronic
968962151 4:3751095-3751117 GCGTGCCCATCCCATGGGGCGGG + Intergenic
969849579 4:9945662-9945684 CCTGGCCCTTCCCCTGAGTCTGG - Intronic
973366445 4:49213187-49213209 CCCTGCCCATCCCATCCTGCTGG + Intergenic
973705553 4:53576474-53576496 CCCTGCCCTTCCCATGAGGCAGG + Intronic
974746788 4:66087959-66087981 CTCTGCCCTTTCCATGATGGAGG + Intergenic
974850257 4:67395772-67395794 CTCTGACCTTCCCATGAAGCAGG + Intergenic
977908219 4:102501434-102501456 CCCTGCCCTTCCCGTCGGTCGGG + Exonic
978503258 4:109432049-109432071 CTCTGACCTTCCCATGAAGCAGG - Intergenic
979460913 4:120982215-120982237 CTCTGACCTTCCCCTGAAGCAGG - Intergenic
980893718 4:138840988-138841010 TCCTCCACTTCCCAGGAGGCTGG + Intergenic
985367831 4:189251917-189251939 CCATCCTCTTCCCATGAGGATGG + Intergenic
1202763948 4_GL000008v2_random:135689-135711 CCCTGCCCATCCCATCCTGCTGG + Intergenic
985660357 5:1153951-1153973 CCCTGTCCTTCTCCTGAGCCTGG - Intergenic
985840178 5:2300093-2300115 CCATGCCCATCTCATGAGGAGGG - Intergenic
986198719 5:5561605-5561627 CCCTGCCATTCCCAGAGGGCAGG - Intergenic
986352466 5:6893339-6893361 CCCTGCCCTCCCCATGATGTTGG - Intergenic
986741975 5:10712482-10712504 TCCTGCCCTTCCTATGTGGAGGG - Intronic
987277689 5:16378930-16378952 CCTTGCCCTTTTGATGAGGCTGG - Intergenic
990728944 5:58787148-58787170 CCCGGGGCTTCCCATGGGGCAGG - Intronic
991561278 5:67956070-67956092 TCCTGCCCTGCCCATGGGTCTGG - Intergenic
997460954 5:134052052-134052074 CTCTGACCTTCCCCTGAAGCAGG + Intergenic
997614873 5:135239398-135239420 CAAGCCCCTTCCCATGAGGCTGG - Intronic
997719049 5:136063583-136063605 GCCAGGACTTCCCATGAGGCTGG - Exonic
998374828 5:141683269-141683291 CCCTCTTCTTCCCCTGAGGCAGG - Intergenic
998386660 5:141760967-141760989 CCCTTCCCTTCCGAGGGGGCGGG + Intergenic
999445326 5:151634141-151634163 CCCTGCCCTGCCCAGGCTGCTGG + Intergenic
1000041420 5:157487705-157487727 CCTTGCCCATCCCAAGGGGCAGG - Intronic
1001408919 5:171496458-171496480 CCCTGCTCTTGCCTTTAGGCTGG - Intergenic
1002427487 5:179184885-179184907 CCCTGCCTTTCCCTCGAGGCCGG - Intronic
1003043706 6:2713659-2713681 CACTCCCCATCCCATGAGTCAGG + Intronic
1003525206 6:6891484-6891506 CCCAGCCCTTCCCCCGAGGCGGG + Intergenic
1004706424 6:18128211-18128233 CCTTGCCCTGCCTATGAAGCAGG - Intergenic
1004845278 6:19634918-19634940 ACCTGCAGTTCCCTTGAGGCTGG + Intergenic
1005755920 6:28924648-28924670 ACCTGGCCTCCCCAAGAGGCTGG + Intergenic
1005972847 6:30774966-30774988 GCTTACCCCTCCCATGAGGCAGG + Intergenic
1006750491 6:36373655-36373677 GCCAGCCCTTGCCCTGAGGCAGG - Intronic
1007085704 6:39143285-39143307 CCCTGCCCTTCCTAGGTGGAAGG + Intergenic
1007103686 6:39268737-39268759 CCCTGCCCTAACCATTAGGGTGG + Intergenic
1007412765 6:41674473-41674495 CCCAGCCCATCCCACCAGGCGGG + Intergenic
1007888798 6:45264641-45264663 CCCTGCACTTCTTGTGAGGCAGG + Intronic
1012542046 6:100372576-100372598 TCCAGCCCTCCCCAGGAGGCTGG - Intergenic
1013365346 6:109433511-109433533 CCATGCTGTTCACATGAGGCAGG - Intronic
1014252300 6:119127374-119127396 CCCTGCCCTTCCACTGTGGTAGG - Intronic
1015683334 6:135832376-135832398 CCATGCCCTTTTTATGAGGCAGG - Intergenic
1015729637 6:136334877-136334899 CTCTGTCCTTGCCATAAGGCAGG + Intergenic
1015912748 6:138185084-138185106 CCCTGTGCTTCCAAGGAGGCTGG + Intronic
1016902694 6:149117840-149117862 CCCTGCCCCACCCTTGATGCGGG - Intergenic
1017049222 6:150374856-150374878 TCCTGACCCTCCCCTGAGGCAGG - Intronic
1017389795 6:153925660-153925682 CCCTGCCCTACACATCAAGCTGG + Intergenic
1017694889 6:157004691-157004713 ACTTGCGCTTCCCTTGAGGCTGG + Intronic
1018486805 6:164248974-164248996 CCCTGGCTGTGCCATGAGGCTGG + Intergenic
1018793562 6:167168986-167169008 CCCTCCCCTCTCCATGGGGCAGG - Intronic
1018823153 6:167389392-167389414 CCCTCCCCTCTCCATGGGGCAGG + Intergenic
1019113719 6:169739295-169739317 CCCTGGCCTTCCCATGTGCTGGG + Intergenic
1019711159 7:2518913-2518935 CCCGGCCCTTCCCACGGGCCCGG - Intronic
1019915062 7:4127911-4127933 CCCAGCCCTTCACATGAGCAAGG - Intronic
1020016785 7:4836027-4836049 CCATGCCCTTCCCCAGAGCCAGG + Intronic
1020036190 7:4964556-4964578 TCCTGCCCTCCCCTGGAGGCTGG + Intergenic
1022245195 7:28552453-28552475 CCATGCCCATCCCCTGAGGAGGG + Intronic
1022385361 7:29893765-29893787 TCCTTTCCTTCCCCTGAGGCAGG + Intronic
1022813122 7:33888317-33888339 CCCTGCCTTTCCCATTGGGATGG + Intergenic
1022827348 7:34029396-34029418 CCATGCTCTTCTGATGAGGCAGG - Intronic
1023703293 7:42913175-42913197 CTCTGCCCCTCCCATAATGCAGG + Intronic
1024656847 7:51458231-51458253 CTCTGGCCTTCCCCTGAAGCAGG + Intergenic
1024673878 7:51620887-51620909 ACCTGCCTCTCCCTTGAGGCTGG - Intergenic
1024933768 7:54691179-54691201 GCCTGCCCTTCCCATGCAGTGGG + Intergenic
1026016828 7:66678213-66678235 CCCTGCCCCTCCCATCCTGCTGG + Intronic
1027154387 7:75756268-75756290 CCCTGCTCCTCCCAGGAGGGTGG + Intergenic
1029479030 7:100801979-100802001 CCCTCCCCTTTCCAAGAGGCAGG + Intergenic
1030088818 7:105839665-105839687 CTCTGCCCTGCATATGAGGCTGG - Intronic
1031690524 7:124782467-124782489 CCCTTCCCTTCCCCCAAGGCAGG + Intronic
1032087843 7:128893070-128893092 CCCTGTCCTTCCCAGGACACAGG + Intronic
1034077050 7:148242353-148242375 CGCTGCCCTTCCACTCAGGCAGG + Intronic
1034193131 7:149225986-149226008 CCCTGCCCTTGCCGTGGGTCCGG + Exonic
1034331811 7:150289330-150289352 CTCTCCCCTTCCCATGAGTGTGG - Intronic
1034415561 7:150962755-150962777 CCCAGCCCCTGCCATCAGGCAGG - Intronic
1035912694 8:3585070-3585092 CCCTCCCCTTCCGGTGGGGCGGG + Intronic
1037706915 8:21323094-21323116 TCCTGCCCATCCCAGGAAGCAGG + Intergenic
1037828514 8:22174575-22174597 CCCTCCCCTTCCCAAAGGGCAGG + Intronic
1037985563 8:23288660-23288682 CCCTGCCCTTCCCAGCAAGGCGG - Intronic
1038543972 8:28411884-28411906 CCCGGCCCTGCCCTCGAGGCGGG + Intronic
1041079995 8:54207073-54207095 GACTGCCCTCTCCATGAGGCTGG + Intergenic
1041611706 8:59857669-59857691 CCCAGCCCATTCTATGAGGCTGG + Intergenic
1044820583 8:96153475-96153497 GCCTGCCCTTCCCCTGGGGCCGG + Intronic
1045429366 8:102098716-102098738 CCCTGCCTTCCCTATGAGGAGGG + Intronic
1045507524 8:102789136-102789158 CCCTGACCTTCCCTTCAGGCTGG - Intergenic
1046547147 8:115667620-115667642 CCCTGTCCGTACCATGTGGCAGG - Intronic
1047515666 8:125552672-125552694 GTCTTCCCTTCCCATCAGGCTGG - Intergenic
1048493974 8:134920208-134920230 ACCTTCCCTTCCCTAGAGGCTGG - Intergenic
1049373437 8:142278362-142278384 CCCTGCCTGTCCTGTGAGGCTGG + Intronic
1049425350 8:142535647-142535669 CCCTCGTCTGCCCATGAGGCTGG + Intronic
1049854038 8:144850555-144850577 CCCTGCCCTTCCCATGAGGCAGG - Exonic
1049955523 9:689408-689430 CCCTGCCTTCCACATGAGGAGGG - Intronic
1052024069 9:23555812-23555834 CTCTCCCCTTCCCAGGAGGGAGG - Intergenic
1053523923 9:38809832-38809854 CCCAGCCCTTAACATTAGGCAGG - Intergenic
1053790609 9:41683727-41683749 CCCTGCCCTTCTAATGTGGGAGG - Intergenic
1054178954 9:61895426-61895448 CCCTGCCCTTCTAATGTGGGAGG - Intergenic
1054196156 9:62034244-62034266 CCCAGCCCTTAACATTAGGCAGG - Intergenic
1054642249 9:67554445-67554467 CCCAGCCCTTAACATTAGGCAGG + Intergenic
1054658583 9:67685405-67685427 CCCTGCCCTTCTAATGTGGGAGG + Intergenic
1056935417 9:90912202-90912224 CCCTCCCATAGCCATGAGGCAGG + Intergenic
1057143047 9:92738995-92739017 GCCCGCCGTTCCCAGGAGGCTGG - Intronic
1057912935 9:99034201-99034223 CCCCACCCTTCCCATGACGGAGG - Intronic
1058766388 9:108186508-108186530 CTCTGCCCATCTCATGAGGCAGG - Intergenic
1060477238 9:123995933-123995955 CTCTGCCCAGCCCAGGAGGCAGG + Intergenic
1060891681 9:127193187-127193209 CACTGGCCTTCCCACCAGGCCGG - Intronic
1061035849 9:128114051-128114073 CCCTCCCCTGCCCAGGAGTCTGG - Intergenic
1061388686 9:130305318-130305340 CCCTGCCCTACCTATTGGGCAGG - Intronic
1062431500 9:136528637-136528659 CCCTTCCCTTCCCAGGGAGCCGG - Intronic
1062634195 9:137481344-137481366 CCCTGCCCTGCACACGTGGCAGG - Intronic
1203544696 Un_KI270743v1:120562-120584 CCCTGCCCATCCCATCCTGCTGG + Intergenic
1185894233 X:3843765-3843787 CCGTGCCCGCCCCACGAGGCCGG - Exonic
1185899352 X:3882189-3882211 CCGTGCCCGCCCCACGAGGCCGG - Intergenic
1185904469 X:3920618-3920640 CCGTGCCCGCCCCACGAGGCCGG - Intergenic
1185960404 X:4542032-4542054 CCCTTCCCTACACATCAGGCTGG - Intergenic
1186286204 X:8046578-8046600 CTCTGCCCTTGCAATAAGGCAGG - Intergenic
1186478970 X:9881148-9881170 ACCTGCCCTGTCCATGACGCTGG - Intronic
1186840481 X:13479959-13479981 CCCTGGCCTTCCCATGATCACGG - Intergenic
1189765703 X:44369960-44369982 CTCTGACCTTCCCCTGAAGCAGG + Intergenic
1190282228 X:48938757-48938779 CCCTCCTCTTCCCAGAAGGCTGG + Intronic
1192748475 X:73963661-73963683 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
1196555295 X:117078256-117078278 GTCTGTCCTTCCCTTGAGGCGGG + Intergenic
1196869163 X:120096478-120096500 CTCTGCCCTTGCGATAAGGCAGG + Intergenic
1196975438 X:121153469-121153491 GTTTGCCCTTCCCTTGAGGCAGG - Intergenic
1198949894 X:142058446-142058468 CTCTCCCCTTCCCATGACGAAGG - Intergenic
1199691818 X:150314279-150314301 CCCTGCCCACCCCAGGAAGCAGG + Intergenic
1199979572 X:152913509-152913531 CCCTGCTCTACCCCTGAGCCCGG - Intergenic
1200065499 X:153502530-153502552 CCCTGCCCTGCCCTGGAGGAAGG + Intronic
1200827771 Y:7661045-7661067 CCATTCCCTTGCCATGAGGGAGG - Intergenic