ID: 973705945

View in Genome Browser
Species Human (GRCh38)
Location 4:53580458-53580480
Sequence GCTGTCTGGCAGTCACATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973705945 Original CRISPR GCTGTCTGGCAGTCACATCA AGG (reversed) Intronic
902367384 1:15985702-15985724 GCTTCCGGGAAGTCACATCATGG + Intergenic
905475793 1:38226906-38226928 GCTCTTTGGCCATCACATCATGG + Intergenic
910136462 1:83977564-83977586 GATGTCTGCCAGTCAACTCATGG - Intronic
910950246 1:92639040-92639062 GATGGCTGGCAGTCTCAGCAAGG + Intronic
915757139 1:158273181-158273203 GAACTCTGGCAGTCACCTCAGGG + Intergenic
916173070 1:162015822-162015844 GCTGTCTGCCACTCTCTTCAAGG - Intronic
917825835 1:178819388-178819410 GTTGTCTGGCAGTCTCTTGATGG + Intronic
921582853 1:216915130-216915152 AATCTCTGGCAGTCACACCAAGG - Intronic
922629949 1:227096625-227096647 GCTGTCTGGCTTTGACTTCAGGG + Intronic
1063737132 10:8770988-8771010 ACTTTCTGGAAATCACATCATGG - Intergenic
1063966303 10:11348985-11349007 GATGTCTGTCAGTCAGGTCAAGG + Intergenic
1069058063 10:63865399-63865421 GGTGTCTGGCAGAAACAGCAGGG + Intergenic
1070236980 10:74638736-74638758 GCTTTCTGGCAGTGTCATCCTGG + Intronic
1070477494 10:76844409-76844431 GCTTTCTGGCAGTCTCTTTATGG - Intergenic
1072676508 10:97470240-97470262 GTGGTGTGTCAGTCACATCAAGG + Intronic
1072736818 10:97884821-97884843 GGAGTCTGGCATTCAAATCATGG + Intronic
1074324600 10:112437057-112437079 ACAGTCAGGCAGTCACTTCAAGG + Intronic
1074379282 10:112965739-112965761 GCTATCTGGAAGTCTTATCAAGG - Intronic
1075707721 10:124511822-124511844 GCTTTCTGGAATTCACAGCATGG + Intronic
1076791802 10:132780765-132780787 GCTGACTGGCAGGAACATCAGGG - Intronic
1078135718 11:8650022-8650044 GCTGTCTGGGAGTAACATGCCGG + Intronic
1079266479 11:18938132-18938154 GCTGTCTTCCAGTCTCATCCAGG - Intronic
1079328349 11:19513415-19513437 GGAGTGTGGCAGCCACATCAGGG - Intronic
1081013287 11:37843201-37843223 GCTGTTTTGTAGGCACATCAAGG + Intergenic
1086205602 11:84254943-84254965 TCTCTTTGGCAGTCACACCAGGG - Intronic
1088654882 11:111989729-111989751 GCTGGCAGGCAGACACTTCATGG - Intronic
1089328158 11:117671568-117671590 ACTGTCTCAGAGTCACATCAGGG + Intronic
1095619935 12:44240409-44240431 AGTGTGTGGCAGTCACACCAAGG - Intronic
1099880076 12:88457053-88457075 GCTGTCAGGCATTAACACCACGG - Intergenic
1102343884 12:112145794-112145816 TCTGTATGCCACTCACATCATGG - Intronic
1105771657 13:23617838-23617860 TGAGTCTGGGAGTCACATCATGG + Intronic
1108503281 13:51087128-51087150 ACTGTCTGACAGTCGCATGATGG + Intergenic
1109927728 13:69168086-69168108 GCTCTCTGCCAGTCAGGTCATGG - Intergenic
1111467783 13:88640075-88640097 GAAGACTGGCAGTTACATCAGGG - Intergenic
1112074824 13:95900707-95900729 TGTGTGTGTCAGTCACATCAGGG + Intronic
1118692548 14:68353721-68353743 GTTGTCTGGCTGTCGCAGCAGGG + Intronic
1119881457 14:78103239-78103261 GATGCCTGGGAGTCACACCACGG - Intergenic
1120909258 14:89650912-89650934 GCTGACTGGTATTCACAACATGG - Intergenic
1121125701 14:91405326-91405348 GCTTTTTGGTAGACACATCAAGG - Intronic
1121567335 14:94919984-94920006 GCTGCCTGCCAGCCACATCTTGG - Intergenic
1122803777 14:104246585-104246607 GCTGTGTGTCAATCTCATCAGGG - Intergenic
1124795329 15:32772823-32772845 GCTGGCTGGCAGGCATATCCTGG + Exonic
1128899043 15:71402534-71402556 GCTGTGATGCAGTCACACCAAGG + Intronic
1129194213 15:73954593-73954615 TCTGTCTGGCTGTCACTGCATGG + Intergenic
1132728882 16:1350996-1351018 GCTGTCTGCCAGGGACAGCATGG + Exonic
1134469329 16:14509246-14509268 GGTGTCTGGATGCCACATCAGGG - Intronic
1135122441 16:19778090-19778112 GCAGTATGGCAGGCACATCTGGG + Intronic
1141606907 16:85158988-85159010 TCTTTCTGGAAGGCACATCAGGG + Intergenic
1142960215 17:3547858-3547880 TCTGGCTGGGAGTCACATCACGG - Intronic
1152277548 17:79367041-79367063 GCTGTGAGGCAGTCACAACACGG - Intronic
1152740748 17:82017287-82017309 GCTGTAGTGCAGACACATCAGGG - Exonic
1162011736 19:7820641-7820663 GCTGTCTGGGAGCCACCTGAAGG + Intergenic
1163209581 19:15830567-15830589 CCTGTCTGGTATTCCCATCAAGG - Intergenic
1166837986 19:45678843-45678865 GCTGTGTGGCCTTCACCTCAGGG + Intronic
1167300616 19:48675470-48675492 GCTGGCGGGCAGGCCCATCACGG - Intergenic
1168169658 19:54576921-54576943 GCTTTGGGGCAGTCACATCCAGG - Intronic
926115795 2:10212449-10212471 GCTGCCTAGAAGTCACACCATGG - Intergenic
927688676 2:25191683-25191705 AGTGACTGGCAGTCAGATCAGGG + Intergenic
929779409 2:44948285-44948307 GCAGCCTGGCAGTCATATCTAGG - Intergenic
930903030 2:56531491-56531513 GCGGTCTGGCATTCACATCTTGG - Intergenic
932242042 2:70164771-70164793 GCTGCCTGCCAGTCAAATCTAGG + Intronic
933760494 2:85668789-85668811 GCTGTCTGGGAGCCACTCCAGGG - Intergenic
941834403 2:170000295-170000317 GCTGTATGGAGGTTACATCATGG + Intronic
942912112 2:181256555-181256577 CCTGTCTGACAGTCACATGAAGG + Intergenic
944140234 2:196448340-196448362 CCTGTCTGGAAGTCAAATCTAGG - Intronic
945238534 2:207655140-207655162 GCTGTCTGGCAGTTCTGTCAAGG - Intergenic
948518333 2:238520110-238520132 TCTCTCTGGGAGTCACAGCAAGG - Intergenic
1169187829 20:3633483-3633505 GCTCTCTGCCAGTGTCATCAAGG - Intronic
1170959866 20:21015813-21015835 GCTGTGGGGCAATCACATGATGG + Intergenic
1175737270 20:61395985-61396007 GCTATCTGTCAGCCACATTAGGG - Intronic
1180040767 21:45278339-45278361 GCTGTCTGGCCTCCACACCACGG + Intronic
1181518340 22:23430891-23430913 GCTTCCTGGCAGTCACACCCTGG - Intergenic
950635385 3:14310847-14310869 GCTGTCTGGCAGTCACAGTCAGG + Intergenic
954139607 3:48598144-48598166 GCTGCCTGGCAGTCACAAGCAGG - Intergenic
955090613 3:55746827-55746849 GCTCTGTGGCAGGCACAACAAGG - Intronic
956528078 3:70186869-70186891 GCTGTCTGACAGACATGTCATGG - Intergenic
957534513 3:81484378-81484400 GCTGTCTGGTAGTAACAGTAAGG - Intergenic
960431884 3:117579589-117579611 ACTGTATGGCAGTGATATCAGGG - Intergenic
962698234 3:137972042-137972064 GCTGTCTGGTAGACATATTAGGG - Intergenic
964326371 3:155551086-155551108 GTTGTCCTGCAGTCACATCAGGG + Intronic
967306288 3:188062845-188062867 GGTGTCTGGGAATCACCTCAGGG + Intergenic
967601555 3:191396265-191396287 GCTGACTGTCAGTCACATAAAGG - Intronic
968442731 4:632654-632676 GCTGTCTGGGGGTCACATTGTGG + Intronic
972359110 4:38310972-38310994 GCTGTCTTCCTGTCAGATCAAGG - Intergenic
973705945 4:53580458-53580480 GCTGTCTGGCAGTCACATCAAGG - Intronic
975645697 4:76543581-76543603 GCTGCCCTGCAGACACATCATGG - Intronic
982145965 4:152392533-152392555 TCTGGGTGGCAGTCAGATCATGG - Intronic
982168544 4:152638833-152638855 GCTGTGTGGCATTCACAGGATGG - Intronic
984445293 4:179828962-179828984 GTTGTCTGCCAGTCAGATTAGGG + Intergenic
985933723 5:3079160-3079182 GCTGTCTGGAAGCCTCATCCAGG + Intergenic
985935022 5:3090867-3090889 GCTATCTGGCAGTCCCAGGAAGG - Intergenic
986451729 5:7871800-7871822 GCTGACTGGCAGTCTCCTCCAGG - Intronic
988442632 5:31249956-31249978 GTTCTCTGGGAGTCACATCAGGG - Intronic
988903374 5:35758517-35758539 GCTGACAGGGAGTCACAACAAGG + Intronic
990457045 5:55998111-55998133 GCTGTCAGGCTGTCACATTGAGG - Intergenic
991376499 5:65973529-65973551 GCACTCTGGCACTCACATCTAGG + Intronic
995483544 5:112616073-112616095 GCTGACTGGCAGTCACAGAATGG + Intergenic
996338630 5:122412054-122412076 CCTGCCTGCCAGTCACGTCAAGG + Intronic
996378959 5:122845213-122845235 GCTGTCTGGCAATCTCTTAATGG + Intronic
997660861 5:135588582-135588604 GCTGTAAGGCAGTCCCATCCAGG + Intergenic
1002681392 5:180968110-180968132 GCTGTCAGGCAGGTACATGATGG - Intergenic
1004447034 6:15710073-15710095 GCTATCTGGCATTCAAAACATGG - Intergenic
1004682877 6:17913674-17913696 GGTGTTTGTCAGTAACATCAGGG + Intronic
1005034349 6:21542140-21542162 CCTGTCAGGCAGTTACATTACGG - Intergenic
1006393134 6:33770659-33770681 GCGGTCTGGCAGGCACATGAGGG - Intergenic
1006987471 6:38185482-38185504 GCAGTCTGGCTGTAACATCGAGG - Intronic
1007745307 6:44039765-44039787 GCTCTCTGGCCCCCACATCATGG - Intergenic
1012047786 6:94300871-94300893 GCTGTTTGGGAGTTACATCCTGG - Intergenic
1016496077 6:144663226-144663248 GCTTGCTGGCAGGCACATCTTGG - Intronic
1016551662 6:145287097-145287119 GCTGCCTGCCATTCACTTCAGGG - Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1024115115 7:46185400-46185422 GATGTCTGGCAGTGCCATCTAGG - Intergenic
1029311562 7:99671793-99671815 GCTGTCCTACAGTCACAACATGG - Intronic
1031992954 7:128209749-128209771 GCTGTCTGGCTGTCACCTAGTGG - Intergenic
1035114998 7:156517014-156517036 GCTGTCTGGGAGGCATATGAGGG + Intergenic
1036520529 8:9487422-9487444 GCTGGCTGGCAGTACCATCCCGG - Intergenic
1039468992 8:37802182-37802204 GCTGGCTGGGACTCACTTCAGGG + Intronic
1039847125 8:41333467-41333489 GCTGTTTTGCAGTCACTGCATGG - Intergenic
1040590544 8:48788723-48788745 GCTGCCATGCAGTCACATTAAGG - Intergenic
1044386728 8:91597950-91597972 GCTGTCTGGATGTCACCCCACGG + Intergenic
1047252587 8:123191949-123191971 GATCTCTGACAGTCACCTCAAGG + Exonic
1050719059 9:8564104-8564126 GCTGACTGGCAGTTACAGCTTGG - Intronic
1050774061 9:9238071-9238093 GCGTTCTGGCAGCCACATGAAGG + Intronic
1052741680 9:32399096-32399118 GCTGTCTGTCATTCACGTAAAGG + Intronic
1056921874 9:90798012-90798034 GTTGTATTGCAGTGACATCAAGG - Intergenic
1058208632 9:102139253-102139275 GCTTTCTGGCTCTCAGATCAAGG + Intergenic
1059322796 9:113482499-113482521 GCTGTCCGCCAGCCACAGCACGG + Intronic
1060878481 9:127100698-127100720 GCTGTCCTGCAGGCACATCATGG + Intronic
1192538930 X:71951936-71951958 GCTGGCTGGCTATCACAGCAGGG - Intergenic
1197780577 X:130155532-130155554 TCCGTTTGGGAGTCACATCAGGG + Intronic
1199212054 X:145224048-145224070 GCTGTCTGCCAGGTAAATCAAGG - Intergenic
1199303995 X:146245536-146245558 GCTGTCTGGGAGTCAAAGCTTGG - Intergenic