ID: 973709081

View in Genome Browser
Species Human (GRCh38)
Location 4:53608958-53608980
Sequence GAGGGTGGAGAAAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8120
Summary {0: 2, 1: 28, 2: 354, 3: 1878, 4: 5858}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973709081 Original CRISPR GAGGGTGGAGAAAGGGAGGA GGG Intronic
Too many off-targets to display for this crispr