ID: 973712634

View in Genome Browser
Species Human (GRCh38)
Location 4:53644697-53644719
Sequence AGGTTACCCCAGCACCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973712626_973712634 14 Left 973712626 4:53644660-53644682 CCATGTCAGGTGACTTGGATAGT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 973712634 4:53644697-53644719 AGGTTACCCCAGCACCAGCAGGG 0: 1
1: 0
2: 1
3: 15
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973712634 Original CRISPR AGGTTACCCCAGCACCAGCA GGG Intronic
900383856 1:2400199-2400221 AGGTTCCCCCAGAACGAGGAGGG - Intronic
901467122 1:9429326-9429348 AGGTTATCCCGGCACCAGTCTGG - Intergenic
901490303 1:9593282-9593304 AGGTCCCCCAGGCACCAGCACGG - Intronic
903323987 1:22559232-22559254 AGGGAACCCCAGCAGCAGCCCGG + Intergenic
903603283 1:24557149-24557171 TTGTATCCCCAGCACCAGCACGG + Intronic
904107639 1:28099304-28099326 AAGATAATCCAGCACCAGCAGGG - Intergenic
905289716 1:36913006-36913028 CCGCTACCCCAGCTCCAGCAGGG + Intronic
905672269 1:39799574-39799596 AGGTCACCCCAGCACCTGGGGGG - Intergenic
905674691 1:39817234-39817256 AGGTCACCCCAGCACCTGGGGGG + Intergenic
906151662 1:43591308-43591330 AGGCTCCCACTGCACCAGCATGG - Exonic
907519803 1:55015730-55015752 AGGTTCCCCCAAGACAAGCATGG - Intergenic
907571324 1:55486633-55486655 AGGTTTCCCCTGCCCCAGCCTGG - Intergenic
909445563 1:75744635-75744657 AGGTTACCCTAACAGCAGGAAGG - Intronic
910619357 1:89236091-89236113 CAGTCTCCCCAGCACCAGCAGGG + Intergenic
912655355 1:111481782-111481804 AGGTGGCCACAGCACCACCAGGG + Intergenic
916381275 1:164214597-164214619 AGTTTACCCTCTCACCAGCAGGG - Intergenic
916404821 1:164487752-164487774 AGGTTGTCCCAGCACCAAGAGGG + Intergenic
916741161 1:167648559-167648581 TGGTTCCCCCTCCACCAGCAGGG + Intronic
920101304 1:203518604-203518626 CGGTCACCCCAGGCCCAGCAGGG - Intergenic
920650077 1:207831148-207831170 AGTGAACCCCAGCACCAACAGGG + Intergenic
921262014 1:213393108-213393130 GGGTTACACCAGCTACAGCAGGG - Intergenic
1063133178 10:3195737-3195759 AGGTTCCCCAAACACCACCAGGG - Intergenic
1063780096 10:9312566-9312588 ATGTCTCCCCAGCACCAGCAAGG - Intergenic
1066316863 10:34256389-34256411 AGGTTACCACAGCCGGAGCAGGG + Intronic
1067234457 10:44436289-44436311 AGATCACCCTAGCAGCAGCAGGG - Intergenic
1069370921 10:67746935-67746957 CAGTTTCCCCAGCACCAGCAGGG - Intergenic
1074182589 10:111077327-111077349 AGTGTGCCCCAGCCCCAGCAGGG + Exonic
1076080857 10:127579127-127579149 AGGTGACCCCAGCACCACTGTGG + Intergenic
1076336016 10:129706812-129706834 AGGATTCCCCATCTCCAGCAGGG - Intronic
1077194326 11:1271919-1271941 AGGGACCCGCAGCACCAGCAGGG - Intergenic
1077212112 11:1375853-1375875 AGGTTACACAAGCAGCAGCCTGG + Intergenic
1077614929 11:3667724-3667746 AGGTTCCGCCAGCACCAACGTGG - Exonic
1080067508 11:28035635-28035657 AGAATACCCCAGGACAAGCAAGG - Intronic
1081444426 11:43116812-43116834 AGGTCACACCAGCAATAGCATGG + Intergenic
1082880014 11:58028100-58028122 AGGTTTCTCCAGCATCACCATGG - Intronic
1083429874 11:62608771-62608793 AGGCTACCCGAACACCATCAGGG + Exonic
1084748489 11:71188668-71188690 AGGGCACTCTAGCACCAGCACGG - Intronic
1088881470 11:113976455-113976477 AGGATCCCCAAGCACCAGAAAGG - Intronic
1090313972 11:125768682-125768704 AGGTTATACCAGCATCAGGATGG - Intergenic
1091309011 11:134559787-134559809 AACTTACCACAGCAGCAGCACGG - Intergenic
1091994955 12:4986262-4986284 AGGTTACCCAACCACCAAAATGG - Intergenic
1095360062 12:41326583-41326605 AAGATACCCCAGCCTCAGCAAGG + Intronic
1096182942 12:49560471-49560493 TGGAGAGCCCAGCACCAGCAAGG + Intronic
1096549049 12:52360318-52360340 AGGTTAGCCCAGAAGCAGGAAGG + Exonic
1096978995 12:55717724-55717746 AGATGACCCCAGCCCCTGCATGG - Intronic
1099732873 12:86526851-86526873 AGGAGACCCCTGCACCACCATGG - Intronic
1100981445 12:100165855-100165877 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1101399490 12:104375254-104375276 AGAGTGCCCCAGCACCACCAAGG + Intergenic
1104981671 12:132575776-132575798 AGAGTACCCCAGCATCATCATGG + Intronic
1107727798 13:43317359-43317381 CTGTTACCCCATCACCAGCCAGG - Intronic
1110242318 13:73282867-73282889 ATTTTAACCCAGCACCAGAAGGG + Intergenic
1116495286 14:45552855-45552877 AGGTGACCCAAGCACCCTCATGG + Intergenic
1116679601 14:47949126-47949148 AGGTTACCACAGGAACAGGAGGG + Intergenic
1117751018 14:58924065-58924087 AAGTCTCCCCAGCACCAGCATGG - Intergenic
1118731511 14:68670212-68670234 GGGTGACCTCAGCAACAGCAGGG - Intronic
1119469486 14:74885608-74885630 AGGTTACCCTAACAGCAGGAAGG + Exonic
1121142389 14:91554946-91554968 CAGTCTCCCCAGCACCAGCAGGG - Intergenic
1122042821 14:99001357-99001379 AGTTTCCCCGAGCACCATCAGGG - Intergenic
1122201159 14:100123600-100123622 AAGGTAACCCAGCACCCGCAGGG + Exonic
1122276068 14:100591396-100591418 AGGGCACCACAGCAGCAGCAGGG - Intergenic
1122317470 14:100834682-100834704 AGGGTGTCCCAGCACCAGCCTGG + Intergenic
1122583567 14:102787782-102787804 AAGTGACCACAGCAACAGCATGG - Intronic
1123473167 15:20569516-20569538 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1123644839 15:22430837-22430859 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1123733468 15:23164527-23164549 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1123751598 15:23361902-23361924 AGGTGACCCCAGCACCCTCCAGG + Intronic
1124283971 15:28385827-28385849 AGGTGACCCCAGCACCCTCCAGG + Intronic
1124298726 15:28525787-28525809 AGGTGACCCCAGCACCCTCCAGG - Intronic
1124564055 15:30798887-30798909 TGGTGACCCCAGCACCATCCAGG + Intergenic
1125833477 15:42731792-42731814 CGGTGCCCCCAGCACCACCAGGG + Exonic
1127615412 15:60680079-60680101 AACTTCCCCCAGCAGCAGCAGGG + Intronic
1128734537 15:70045601-70045623 AGGTGGCCCCAACCCCAGCATGG - Intergenic
1129839613 15:78735569-78735591 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1130259451 15:82344128-82344150 AGGTGACCCCAGCACCCTCCGGG - Intronic
1130269227 15:82435040-82435062 AGGTGACCCCAGCACCCTCCGGG + Intronic
1130281815 15:82525057-82525079 AGGTGACCCCAGCACCCTCCGGG + Intergenic
1130473182 15:84241220-84241242 AGGTGACCCCAGCACCCTCCGGG + Intronic
1130480597 15:84355285-84355307 AGGTGACCCCAGCACCCTCCGGG + Intergenic
1130484792 15:84392721-84392743 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1130491115 15:84432474-84432496 AGGTGACCCCAGCACCCTCCGGG - Intergenic
1130502699 15:84511274-84511296 AGGTGACCCCAGCACCCTCCGGG - Intergenic
1130595467 15:85245810-85245832 AGGTGACCCCAGCACCCTCCGGG + Intergenic
1131188103 15:90292572-90292594 AGGTGACCCCAGCACCCTCCAGG + Intronic
1131282682 15:91033893-91033915 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1132204777 15:99978705-99978727 AGGTGCCCCCAACACCAGCAGGG - Intronic
1134071426 16:11262302-11262324 AGGTAACCCAGGCACCAGCTTGG + Intronic
1136775960 16:32872109-32872131 AGGTTCCCTCCGCACCCGCAGGG - Intergenic
1136894655 16:33989403-33989425 AGGTTCCCTCCGCACCCGCAGGG + Intergenic
1137393898 16:48103653-48103675 AGCTCACCCCAGGAACAGCAGGG + Intronic
1140136188 16:72207589-72207611 AGGTAACTCCAGCATCAACAAGG + Intergenic
1141794444 16:86260954-86260976 AGGTGACTCCAACACCACCACGG + Intergenic
1203078376 16_KI270728v1_random:1134218-1134240 AGGTTCCCTCCGCACCCGCAGGG - Intergenic
1148048561 17:44758597-44758619 AGGCTGCCCCAGCCCCAGCTTGG - Intergenic
1148186561 17:45648822-45648844 AGGGAAGCCCTGCACCAGCAAGG - Intergenic
1152181645 17:78825802-78825824 CGGTGTCCCCAGCACCTGCAGGG - Intronic
1152291829 17:79444211-79444233 AGGTTTGCCCAGCACCCTCAGGG + Intronic
1153259906 18:3214318-3214340 AGGTTACTTTAGCAGCAGCAGGG - Intronic
1155057387 18:22196905-22196927 AAGTTACCCCATCACCAGGCAGG - Intronic
1155084167 18:22440386-22440408 AGGTTACAACTGCACCAGCCAGG + Intergenic
1155865019 18:30954138-30954160 AGGTTACCCCAAGACCAGAGAGG - Intergenic
1156463133 18:37332799-37332821 ACGTCAGCCCAGCAGCAGCATGG - Intronic
1160018859 18:75165074-75165096 AGGGTACCCCAGCTCCTACAGGG - Intergenic
1160147581 18:76377535-76377557 AGGTGACCCCAGCACCCACTGGG + Intronic
1160910499 19:1471729-1471751 AGGAAACCCCAGCCCCACCACGG + Exonic
1161932533 19:7350244-7350266 AGGTGGCCCCAGAACCAGGAGGG + Intronic
1164877180 19:31699725-31699747 AGGCCACTCCAGCCCCAGCATGG + Intergenic
1166234837 19:41447954-41447976 AAGTTACCCCAGCAGCCGCTTGG + Intergenic
1168339368 19:55614614-55614636 GGGGCACCCCAACACCAGCAGGG - Exonic
1168375887 19:55878949-55878971 AGCTCACCCGAGCACCTGCAGGG - Exonic
927937039 2:27082004-27082026 TGCTCACCCCAGCTCCAGCAAGG - Intronic
929239430 2:39638924-39638946 ATGTTACCTCAAAACCAGCAGGG + Intergenic
930273261 2:49281210-49281232 AAGTCACCCAAGAACCAGCATGG - Intergenic
932213458 2:69950286-69950308 CGGTTACCCCAGCAGCAGGGTGG - Intergenic
932343173 2:70979187-70979209 CGCTGACCCCAGCCCCAGCAAGG + Exonic
934558025 2:95297606-95297628 AGGACACCCCAGCGCCAGCCAGG - Intronic
934558041 2:95297666-95297688 AGGACACCCCAACACCAGCCAGG - Intronic
938072414 2:128315699-128315721 AGCTTAGCCCAGCTCCAGCCTGG + Intronic
944439419 2:199727241-199727263 CAGTCCCCCCAGCACCAGCAGGG + Intergenic
946838491 2:223796490-223796512 AGTTTATCCCAGAAACAGCAGGG + Intronic
947743278 2:232494698-232494720 AGGTTCCCCCAACTCCAGCACGG + Intergenic
1169610336 20:7372716-7372738 AGGTTCCCCCGGCACCTACATGG + Intergenic
1172011218 20:31846973-31846995 AGGCTACCCCAGCTGCAGCCTGG + Intergenic
1172753778 20:37269449-37269471 AGGTTACCCGAGGATCAGCTGGG - Intergenic
1174599477 20:51712821-51712843 TGGTTACTCCAGCACCAGGGAGG - Intronic
1174780160 20:53382255-53382277 CCCTGACCCCAGCACCAGCAGGG - Intronic
1175776276 20:61655796-61655818 AGGTTGTCCCATCACCTGCAGGG + Intronic
1175879189 20:62246935-62246957 AGGTTGCCAGAGCACCAGGAAGG - Intronic
1175971648 20:62689550-62689572 AGGGGACCCCAGCCCCAGCAGGG + Intergenic
1177957645 21:27619859-27619881 ACCTTACCCCAATACCAGCAAGG - Intergenic
1178683912 21:34696454-34696476 AGGGGACCCCAGGGCCAGCAGGG - Intronic
1179445154 21:41425835-41425857 GGATGATCCCAGCACCAGCAGGG - Intronic
1180617937 22:17140915-17140937 AGGTTACTGCAGCAACAACAGGG + Intronic
1180625320 22:17190243-17190265 AGGTGCCCCCAGAGCCAGCAAGG - Intronic
1180920154 22:19517417-19517439 CTGCTTCCCCAGCACCAGCACGG + Intronic
1180981422 22:19879823-19879845 AGGGGTGCCCAGCACCAGCAGGG - Intronic
1181749978 22:24982613-24982635 AAGTTACCCCAGCACCCACAGGG - Intronic
1184252257 22:43267589-43267611 AAGAGACCCCAGCACTAGCAGGG + Intronic
1184286752 22:43476336-43476358 AGGTTACCCCACCTCCTCCAGGG - Intronic
1185051294 22:48555677-48555699 AGGTGACCCCGTCATCAGCAAGG + Intronic
949940362 3:9149968-9149990 CTGTTTCCCCAGCACCTGCACGG - Intronic
950039524 3:9911049-9911071 AGGTTCCCCCAGGACCAGGGTGG + Intronic
953103674 3:39854946-39854968 ACATTCCCCCAGCACCAGCCTGG - Intronic
954529264 3:51304236-51304258 CAGTTTCCCCAGCACCAGCAGGG + Intronic
963852844 3:150225159-150225181 AGTTGACCCAAGCACCACCATGG + Intergenic
968726346 4:2249651-2249673 AGTTCACCCCAGCCCCAGCCAGG + Exonic
968952369 4:3701713-3701735 GGGTGACCCCAGCAACAGCAGGG - Intergenic
970142362 4:12996437-12996459 AGGAGCCCCCAGCACCACCAGGG + Intergenic
971193537 4:24450081-24450103 AACTTACCCCATCACCAACATGG + Intergenic
973712634 4:53644697-53644719 AGGTTACCCCAGCACCAGCAGGG + Intronic
980159808 4:129146831-129146853 ATGATCCCCCAGCACCATCAGGG + Intergenic
985759429 5:1737537-1737559 ATGCTGCCCCAGCACCAGCCAGG + Intergenic
986539508 5:8828947-8828969 AGCATTCCCCAGCACCAGCCTGG + Intergenic
989276819 5:39599030-39599052 AAGTCTCCCCTGCACCAGCAGGG + Intergenic
990762734 5:59148544-59148566 AGCGTATCCCAGCACCTGCATGG + Intronic
993837661 5:92835144-92835166 CAGTTTCCCCAGCACCACCAGGG + Intergenic
994092090 5:95818508-95818530 AGGTTTCCCCAGCCTCAGCCAGG + Intronic
994220994 5:97194500-97194522 TCTTTACCCCAGCAACAGCAGGG - Intergenic
994247039 5:97489551-97489573 AGGTTACCACCCCACCAGCTTGG + Intergenic
995264169 5:110138905-110138927 CAGTCTCCCCAGCACCAGCAGGG + Intergenic
996004645 5:118405626-118405648 CAGCTTCCCCAGCACCAGCAGGG + Intergenic
996179647 5:120403404-120403426 ATTTTACACCATCACCAGCAAGG - Intergenic
998269170 5:140691346-140691368 TGGTTGCCCCAGCCTCAGCAAGG + Exonic
1000193618 5:158937433-158937455 GGGTTCCCGCAGCACCAGCCAGG + Intronic
1002180965 5:177431008-177431030 AGGCTCCCCCGGCCCCAGCAGGG - Intronic
1003313258 6:4987442-4987464 AGGTTGCCCCAGCTAGAGCAGGG + Intergenic
1013432118 6:110064586-110064608 TGGGTGCCCCAGCCCCAGCAGGG + Intergenic
1013757179 6:113475743-113475765 AGCTTACACCAGCACTAGCTTGG - Intergenic
1018845340 6:167551807-167551829 AGGGTCCCCCAGGACCAGCTGGG + Intergenic
1019279945 7:194518-194540 AGGTTACCCCAGCAGCAGAGGGG + Intronic
1024203498 7:47130957-47130979 AGGCTGGCCCACCACCAGCAAGG + Intergenic
1025107684 7:56185804-56185826 ATGTTTCCCCAGCACCATCTTGG - Intergenic
1026310564 7:69180284-69180306 ATGTTTCCCCAGCACCATCTTGG + Intergenic
1026660944 7:72301945-72301967 AGGTGACCCCAGACACAGCAAGG + Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1028667016 7:93357360-93357382 ACATTTCCCCAGCAGCAGCAGGG + Intronic
1032128091 7:129209171-129209193 AGTTCACCCCAGCCCCAGCTGGG + Intronic
1035099170 7:156382361-156382383 AGGGGACCCCAGCACCAACTCGG - Intergenic
1037187894 8:16086804-16086826 AAGTTATCCCAGCAAGAGCAAGG + Intergenic
1037249597 8:16877139-16877161 CAGTGCCCCCAGCACCAGCAAGG + Intergenic
1040841804 8:51792638-51792660 CAGTCTCCCCAGCACCAGCAGGG - Intronic
1043651252 8:82595844-82595866 AGGTTAGCCCATAAGCAGCAGGG + Intergenic
1044508545 8:93049115-93049137 TGGTTACCTCAGAGCCAGCAGGG + Intergenic
1047588898 8:126304784-126304806 CTGTTACCCCAGCACCTGCAGGG - Intergenic
1048730446 8:137434390-137434412 AGATGACCACAGCAGCAGCATGG - Intergenic
1050348679 9:4718944-4718966 AGGTTGCCCCAGGAGCAGCAGGG - Intronic
1050785699 9:9398815-9398837 TGGTCACCCCAGCACCAAGATGG + Intronic
1056543738 9:87595855-87595877 AGGTTGCCACGGCACCAACAGGG - Intronic
1057052215 9:91934312-91934334 ATCATACCCCAGCACCAGGAGGG + Intronic
1059353617 9:113683466-113683488 AGGCTCCCCCAGCCCCACCACGG + Intergenic
1059699768 9:116763904-116763926 AGATAACTCCAGTACCAGCAGGG + Intronic
1060519698 9:124287261-124287283 AGGTTACCCTGGCACCAGCAGGG + Intronic
1061062966 9:128259960-128259982 AGGTGACCCCAGCACCCTCCAGG - Intronic
1062631998 9:137467250-137467272 AGCGTCCCCCAGCACCAGCAAGG + Intronic
1062685879 9:137813172-137813194 AGGTGAGCCCAGCCCCAGGACGG + Exonic
1189267231 X:39726107-39726129 AAGTTTGCCCAGCAGCAGCAGGG - Intergenic
1189772626 X:44441641-44441663 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1189772944 X:44444323-44444345 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1189940161 X:46112976-46112998 CAGTCTCCCCAGCACCAGCAGGG + Intergenic
1190928709 X:54930768-54930790 TGGCGAACCCAGCACCAGCACGG + Exonic
1191768851 X:64733162-64733184 CAGTGTCCCCAGCACCAGCAGGG + Intergenic
1192788146 X:74354453-74354475 AGCCCACCCCAGCACCAGCCAGG + Intergenic
1196467685 X:115990187-115990209 AGATTCCCCCACCACCAGCAAGG + Intergenic
1198867669 X:141141933-141141955 AGGTTGCCAGAGTACCAGCATGG + Intergenic
1200103920 X:153701927-153701949 AGGTTCCCTCCGCACCCGCAGGG + Intronic
1200496281 Y:3887219-3887241 AGGTTGTCCCATCACAAGCATGG - Intergenic
1202373306 Y:24212566-24212588 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1202497476 Y:25457554-25457576 AGGTGACCCCAGCACCCTCCAGG + Intergenic