ID: 973718925

View in Genome Browser
Species Human (GRCh38)
Location 4:53704090-53704112
Sequence CTGTATCAACAGTTGTACTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973718923_973718925 27 Left 973718923 4:53704040-53704062 CCAAAAAAACAAAAACGTATGAT 0: 1
1: 0
2: 7
3: 91
4: 793
Right 973718925 4:53704090-53704112 CTGTATCAACAGTTGTACTTCGG 0: 1
1: 0
2: 0
3: 4
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973718925 Original CRISPR CTGTATCAACAGTTGTACTT CGG Intronic
900414381 1:2528359-2528381 CTGTAGCAACAGATCTACTGCGG + Intergenic
903714622 1:25355437-25355459 CTGTATTAATAGTTGTATCTGGG - Intronic
909508852 1:76427572-76427594 CTGGACCAACAGTTTTTCTTGGG + Intronic
911868063 1:103053189-103053211 CTATATAAACTGTGGTACTTTGG + Intronic
913369942 1:118087119-118087141 TTGTGTCATCAGTGGTACTTGGG - Intronic
916626542 1:166564216-166564238 CTGCATCAACAGGTATACTCAGG + Intergenic
917049982 1:170910969-170910991 CTGTCTTAAAAGTTGTTCTTGGG + Intergenic
920903349 1:210134720-210134742 CTTTATCAACAGTTTTACAGTGG - Intronic
924590965 1:245403934-245403956 TTGTATCAAAAATTGTAGTTTGG + Intronic
924771254 1:247081876-247081898 CTGTAACATAAGTTGTAATTCGG + Intergenic
1071780885 10:88843344-88843366 CTTTACCAACAGTTGACCTTTGG - Intronic
1073518677 10:104103453-104103475 CTCTATCAAGAGTTTTATTTAGG + Intergenic
1074247573 10:111710286-111710308 CTGTATCCCCAGTTGCACATAGG + Intergenic
1076089651 10:127671299-127671321 CTGTATTTACAGTTTTACTCGGG - Intergenic
1077799138 11:5521200-5521222 CTCTATCAAGATTTGTACTTGGG + Intronic
1077914306 11:6601284-6601306 CTCAATGAACAGTTGTACTCAGG - Exonic
1080579709 11:33632233-33632255 CTGTATCCACAGGTGGACTCTGG + Intronic
1081164923 11:39796656-39796678 TGGTTTCAACAGTTGTACTATGG + Intergenic
1085882205 11:80480792-80480814 CTGTATCAATAACTGTACTGGGG + Intergenic
1092090405 12:5799124-5799146 CTGGATCAACACTGGCACTTGGG + Intronic
1098754624 12:74344713-74344735 TTATATCCAAAGTTGTACTTTGG - Intergenic
1098754696 12:74346089-74346111 TTATATCCAAAGTTGTACTTTGG + Intergenic
1099055954 12:77841037-77841059 CTGTAAGAACTGTTTTACTTTGG + Intronic
1100120460 12:91363935-91363957 CAGGTTTAACAGTTGTACTTTGG + Intergenic
1100712606 12:97274227-97274249 GTGCATCCACATTTGTACTTGGG - Intergenic
1104334596 12:127881573-127881595 GTCTAGCAAAAGTTGTACTTGGG - Intergenic
1105511869 13:21058919-21058941 CTGTAACAACCGTTGTAATAAGG - Intronic
1107123648 13:36821085-36821107 CTGTATACCCAGCTGTACTTGGG + Intronic
1109679143 13:65724370-65724392 GTGTTTCAACAGCTGTACTCGGG - Intergenic
1109878745 13:68442495-68442517 ATTTATCAATAGTTGTACTGCGG - Intergenic
1113200586 13:107865022-107865044 ATGAATGAACAGTTGTAATTAGG - Intronic
1115183909 14:30662591-30662613 TTGTTTCAACAGATGTACTTTGG - Intronic
1116767219 14:49087331-49087353 TTGTGTCAACAGTTGTTCTGTGG - Intergenic
1123402879 15:20004230-20004252 CTGTCTCTACAGCTGTACCTGGG + Intergenic
1123512218 15:21010884-21010906 CTGTCTCTACAGCTGTACCTGGG + Intergenic
1128513578 15:68328090-68328112 CTTTACCAACAGTTGTTGTTTGG + Exonic
1135174593 16:20216701-20216723 CTGTTTCAACAATTTTAATTAGG + Intergenic
1146385460 17:32368596-32368618 CGGGATCATCAGTTGAACTTGGG + Intronic
1148660652 17:49328969-49328991 CAGTCTCAAAAGATGTACTTAGG + Intronic
1153121614 18:1734333-1734355 CTCTATCCACAGTTGTAGCTGGG - Intergenic
1154984706 18:21538149-21538171 GGGAATCAAAAGTTGTACTTGGG + Intronic
1156039052 18:32798439-32798461 CTGTATTGACATTTGTACTTAGG + Intergenic
1156665996 18:39407808-39407830 CTGCATAAACAGTAGTACGTTGG + Intergenic
1157825992 18:50813063-50813085 CCTTTTCAACAGCTGTACTTTGG + Intronic
1159458086 18:68688223-68688245 CTGAATCAATGGTTATACTTGGG + Intronic
1166623844 19:44331473-44331495 CTGTTTAACCAGTTGTCCTTAGG - Intronic
925170946 2:1750211-1750233 CTCTATCATCAGTTGACCTTAGG + Intergenic
933574262 2:84049547-84049569 TTCTATCAACAGTTTTACTCAGG + Intergenic
938197438 2:129341381-129341403 CTGTATTAAAATTTGTATTTGGG - Intergenic
939936413 2:148298846-148298868 GTATATAAACAGGTGTACTTAGG - Intronic
943641977 2:190369637-190369659 CTGTATAGCCAGTTGAACTTTGG + Intronic
946584608 2:221170737-221170759 CTTTATCAACAGCTGTTCCTGGG - Intergenic
948245844 2:236485416-236485438 CTGTTTCAACATTTTTACCTGGG + Intronic
1170515512 20:17125676-17125698 CTGTGTTACCAGTTGTACTAAGG - Intergenic
1171234252 20:23511352-23511374 CTGTATCACAAGTTGAACATAGG - Intergenic
1179558842 21:42199694-42199716 CTGAATCATCATTTGTAGTTTGG + Intronic
949671929 3:6408301-6408323 CTTTATCACCAGTAGTGCTTTGG + Intergenic
952532045 3:34272873-34272895 TTGTATCACCAGTTGAAGTTGGG - Intergenic
957109037 3:75929460-75929482 CTAGAGCAACAATTGTACTTTGG - Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
962735016 3:138317924-138317946 TTGTATCACCAGTTAGACTTGGG + Intronic
964292014 3:155191854-155191876 CTGAATCAACATTCGTAATTGGG + Intergenic
966828213 3:183983425-183983447 GTGTACCTACAGTTGTACTGGGG + Intronic
972735056 4:41832352-41832374 CTGGAGCAACAGCTGTAATTGGG - Intergenic
973718925 4:53704090-53704112 CTGTATCAACAGTTGTACTTCGG + Intronic
977452353 4:97214926-97214948 TTTTATCATCAGTTGTCCTTCGG + Intronic
980917717 4:139049586-139049608 CAGTATCAAATGTTCTACTTTGG - Intronic
982694437 4:158583303-158583325 CTGTATAGTAAGTTGTACTTGGG - Intronic
983003793 4:162456593-162456615 CTGTATTAATAATTGCACTTTGG + Intergenic
983329889 4:166312166-166312188 CTGAATCAGCAGTTTCACTTAGG + Intergenic
983447583 4:167873977-167873999 CTGTATTAATACTTCTACTTTGG - Intergenic
986455094 5:7910602-7910624 CTTTATCAACCTTTGTAATTGGG + Intergenic
989356781 5:40552326-40552348 TTGAGTCAACAGTTGTTCTTAGG - Intergenic
990289618 5:54334831-54334853 ATGTATCTACAGTGTTACTTGGG - Intergenic
991613978 5:68476974-68476996 CTGTAACTCCAGTTGAACTTTGG + Intergenic
994003620 5:94811421-94811443 CTGTTTGAACAGTTGGAGTTCGG - Intronic
994439718 5:99787311-99787333 ATGTATTAAAAGTTGTATTTAGG - Intergenic
1001104130 5:168838915-168838937 CTGGATCAACTGGTGTACTGAGG - Intronic
1003383497 6:5646566-5646588 CTATAACTACAGTTGGACTTTGG + Intronic
1008423702 6:51332204-51332226 CAGTATCAAAACTTGTCCTTAGG - Intergenic
1008566919 6:52777676-52777698 CTGTATCAAATGCTGCACTTAGG + Intergenic
1009620655 6:66071692-66071714 CTGTACCAATAGTTGCACATTGG - Intergenic
1013001363 6:106026023-106026045 CTGTATTAACAGAGGTACTTAGG + Intergenic
1013365794 6:109436894-109436916 GTTTAGCAAGAGTTGTACTTAGG - Intronic
1017264298 6:152424254-152424276 CTGATTTAACAGTTGAACTTTGG - Intronic
1019889092 7:3931324-3931346 TTGTATGAACATTTGCACTTAGG - Intronic
1021813040 7:24422507-24422529 CAGGATCAACAGCTGTCCTTGGG - Intergenic
1023240378 7:38139728-38139750 GTGTATGAATAATTGTACTTGGG - Intergenic
1023891484 7:44394981-44395003 CTGTGTCCACAAGTGTACTTTGG + Intronic
1024481135 7:49864544-49864566 ATGTCTCAACAGTTGTCTTTTGG + Intronic
1024864061 7:53882600-53882622 CTGTATCAAAAATAGTACATAGG - Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1025167654 7:56726871-56726893 TTGGATCATCAGTTGTACATAGG + Intergenic
1026381379 7:69803075-69803097 CAGTAACAACAGCTGAACTTGGG - Intronic
1027750810 7:82142943-82142965 CATTATCAACTGTTGTACCTGGG + Intronic
1027846993 7:83392705-83392727 CTGTAGCAACAGCTGTATATTGG - Exonic
1031419304 7:121530764-121530786 TTGAATAAACAGCTGTACTTTGG - Intergenic
1036910273 8:12753457-12753479 GTTTATCAACAGTGGCACTTGGG + Intronic
1044143146 8:88679394-88679416 CTGGATCCACATTTGTGCTTTGG - Intergenic
1048598549 8:135893500-135893522 CTGCATAAACATCTGTACTTTGG - Intergenic
1051311661 9:15780655-15780677 CTTTATGCACAGTTGTAGTTTGG + Intronic
1051312819 9:15794682-15794704 CTGTATCACATGTTGTTCTTTGG - Intronic
1051853148 9:21532398-21532420 CTGTAAATACAGTTATACTTGGG - Intergenic
1052406768 9:28071013-28071035 CTTTATAAACAGTAGTACTGGGG - Intronic
1052618165 9:30870271-30870293 CTGTATCAATACTTTAACTTTGG + Intergenic
1056004935 9:82258901-82258923 TTGTATAAACACTTGTATTTGGG + Intergenic
1058763765 9:108161814-108161836 CTGTACCAAAAGTGGTATTTTGG + Intergenic
1060013932 9:120069997-120070019 CTTTATCTACTGTTGGACTTAGG + Intergenic
1188360791 X:29250732-29250754 TTGTATCAGCAGTGGTACCTTGG + Intronic
1189601889 X:42635727-42635749 ATGTATCAAGAGTAGTATTTGGG + Intergenic
1193939561 X:87664291-87664313 CTGTATGAAATGTAGTACTTTGG - Intronic
1197688426 X:129470606-129470628 CTGTAGTATCAGTTGCACTTTGG + Intronic