ID: 973720560

View in Genome Browser
Species Human (GRCh38)
Location 4:53719698-53719720
Sequence CAACATGAACAAAGGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 1, 2: 12, 3: 89, 4: 575}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973720560_973720566 1 Left 973720560 4:53719698-53719720 CCTCCCTGCCTTTGTTCATGTTG 0: 1
1: 1
2: 12
3: 89
4: 575
Right 973720566 4:53719722-53719744 TCTCAGTCCCTAAAATGATGGGG 0: 1
1: 0
2: 0
3: 8
4: 172
973720560_973720565 0 Left 973720560 4:53719698-53719720 CCTCCCTGCCTTTGTTCATGTTG 0: 1
1: 1
2: 12
3: 89
4: 575
Right 973720565 4:53719721-53719743 TTCTCAGTCCCTAAAATGATGGG 0: 1
1: 0
2: 0
3: 22
4: 178
973720560_973720564 -1 Left 973720560 4:53719698-53719720 CCTCCCTGCCTTTGTTCATGTTG 0: 1
1: 1
2: 12
3: 89
4: 575
Right 973720564 4:53719720-53719742 GTTCTCAGTCCCTAAAATGATGG 0: 1
1: 0
2: 0
3: 8
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973720560 Original CRISPR CAACATGAACAAAGGCAGGG AGG (reversed) Intronic
900037084 1:423261-423283 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900058714 1:659002-659024 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900336144 1:2164816-2164838 CAACATCACGAAAGCCAGGGCGG - Intronic
902030055 1:13415790-13415812 AAAAAAGAACAAAGGGAGGGAGG + Intronic
902302277 1:15510682-15510704 CGGCATGAGCAAAGGCAGGGAGG + Intronic
902311924 1:15587518-15587540 AAGCATGAACAAAGGAAAGGAGG - Intronic
902424123 1:16305754-16305776 AAATATGACCACAGGCAGGGTGG + Intronic
902651119 1:17838280-17838302 CAACCTTACCAAAGCCAGGGTGG + Intergenic
902689938 1:18104805-18104827 CACCATGAACAGAGGGAGGCTGG + Intergenic
903197728 1:21704942-21704964 CGACAGGAAGAAAGGGAGGGAGG + Intronic
903281934 1:22255039-22255061 CACGGTGAGCAAAGGCAGGGAGG + Intergenic
903340226 1:22649287-22649309 CTGCATGGGCAAAGGCAGGGAGG - Intergenic
903359635 1:22768796-22768818 CAGCTTGTACAAAGGCCGGGAGG - Intronic
903381892 1:22902963-22902985 CAACATGAACAAAAGCATGGAGG + Intronic
903537632 1:24077450-24077472 CAGCAAGGGCAAAGGCAGGGAGG - Intronic
904207110 1:28862612-28862634 CCCCTTGAACAAAGGCTGGGAGG + Intronic
904318556 1:29681703-29681725 CGGCATGAACAAAGGCCTGGAGG + Intergenic
904438932 1:30517280-30517302 CGGCATGAACAAAGGCCTGGAGG - Intergenic
904460634 1:30677661-30677683 CAGCATGTGCAAAGGCTGGGAGG + Intergenic
904787731 1:32995310-32995332 CAGCTTGTACAAAGGCATGGAGG - Intergenic
905398449 1:37683796-37683818 AAACATGAACAAAGGCACAGAGG + Intronic
906551023 1:46666622-46666644 CAACATAAACAAAGGTACAGAGG - Intronic
906708961 1:47915197-47915219 CATCATGCACAAAAGCAGGGAGG + Intronic
906718192 1:47985937-47985959 CAACATGAGCAAATGCATGGAGG + Intronic
906852480 1:49266743-49266765 CAACAAGAACAAAGGCTAAGTGG + Intronic
906856282 1:49308723-49308745 CAGAATGAGAAAAGGCAGGGTGG + Intronic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
907310262 1:53535016-53535038 AAGCATGAACAAAAGCAGGGAGG + Intronic
907395592 1:54187526-54187548 CAACATGGACAAAGGCAATTGGG - Intronic
907431646 1:54415553-54415575 CAGCATGGACAAAGGCACAGAGG + Intergenic
907519480 1:55013867-55013889 CAGCATGAGCCAAGGCAGGGTGG - Intergenic
907636029 1:56135394-56135416 GAAAATGACCAAAGGTAGGGAGG - Intergenic
907655132 1:56334382-56334404 CAACATGAGCAAAGACGTGGAGG + Intergenic
908037903 1:60075353-60075375 CAAAGTGAACAAAGGCACTGAGG - Intergenic
908116568 1:60946640-60946662 CTGCATGAACAAAGGAAGAGAGG + Intronic
908180693 1:61602254-61602276 CATCATGAGCAAAGGCACGGAGG + Intergenic
908469709 1:64431737-64431759 CAAAATGGACAAAGACAGGCCGG - Intergenic
908865728 1:68547364-68547386 GAAAATGAAGAAAAGCAGGGTGG + Intergenic
908873390 1:68640969-68640991 TAACAAAAATAAAGGCAGGGTGG - Intergenic
909205266 1:72748557-72748579 CACCATCAACAAAGGCATGGGGG - Intergenic
909291194 1:73885761-73885783 CAACTTGAACAAAGGCAACTGGG + Intergenic
909374393 1:74923686-74923708 CAGAATGAAGAAAAGCAGGGTGG + Intergenic
909664814 1:78121238-78121260 CAACAGCAGCAAAGGCATGGGGG + Intronic
909899348 1:81113012-81113034 CATAATGAACAAAGGAAGAGTGG + Intergenic
910161778 1:84279882-84279904 CAACGTGTACTAAGGCATGGAGG + Intergenic
910253301 1:85220794-85220816 CAGCATGAACAAAGGCAGAGAGG + Intergenic
910283651 1:85529609-85529631 CAATATGAAGAAAGCCAGGTGGG - Intronic
910291753 1:85606395-85606417 CAACAGAAACAAGGGAAGGGTGG - Intergenic
910342590 1:86204566-86204588 CAGCTTGTACAAAGGCATGGAGG + Intergenic
910682875 1:89885270-89885292 CACCATGAACAAAGGCACTGAGG - Intronic
910737576 1:90477674-90477696 TACCATGAACAAAGGAATGGAGG - Intergenic
910902111 1:92132288-92132310 CTATATGAATAAAGGCAAGGGGG + Intronic
911285466 1:95986713-95986735 CAACATGAGCAAAGGCACAGGGG + Intergenic
912144875 1:106781201-106781223 AAAGAAGAACAAAGGTAGGGAGG + Intergenic
912720561 1:112016442-112016464 CAACTTGAGGAAAGGCAAGGAGG - Intergenic
913540366 1:119814272-119814294 TGACATGAAAAAAGGCATGGAGG - Intergenic
914206364 1:145533381-145533403 CAATATGAAGAAAGCCAGGTGGG + Intergenic
914946699 1:152073194-152073216 CAGCATTAACAAAGGCATGGAGG - Intergenic
915900460 1:159843127-159843149 CAACATGAACCTGGGCATGGAGG + Intronic
915900827 1:159845519-159845541 CAACATGAACTTGGGCATGGAGG - Intronic
916167193 1:161974504-161974526 GAACAAGAACAAAGGGAGGTTGG - Intergenic
917712581 1:177701752-177701774 CAACATGTGCAAAGGCTGAGAGG + Intergenic
917791900 1:178504370-178504392 CAACAGGGACAAAGGGAGGAAGG + Intergenic
917861717 1:179152044-179152066 CAATATAAACAAAGACATGGCGG + Intronic
918145171 1:181749877-181749899 CAACTTGAAATAAGGGAGGGAGG - Intronic
918337984 1:183540115-183540137 CAACATGAACAAAGGTGTGGAGG - Intronic
918748050 1:188231701-188231723 CAAAAGGAAGGAAGGCAGGGAGG - Intergenic
919307488 1:195861160-195861182 CAGCATACACAAAGGCAAGGTGG - Intergenic
919515435 1:198516273-198516295 GAACATGCACAAAGGCTGAGAGG - Intergenic
919563542 1:199155370-199155392 TAACATGAACAAAGGCCTGTGGG - Intergenic
919782629 1:201230703-201230725 CACCATGAGCAAAGGCAAGGAGG + Intergenic
919895118 1:202004830-202004852 CAAGAGGAACAAAGGCTTGGAGG + Intronic
920283754 1:204864035-204864057 CAAGATTACCAAAGGCTGGGAGG - Intronic
922050348 1:221983426-221983448 CAGCATGAGCAAAGGCATGGAGG - Intergenic
922710755 1:227829066-227829088 GAGAATGAAGAAAGGCAGGGTGG - Intronic
923322686 1:232851173-232851195 CAAAATTTACAAAAGCAGGGAGG - Intergenic
923681094 1:236119343-236119365 AAACATGAAAAGAGGCCGGGTGG - Intergenic
1062859501 10:799442-799464 CAACAGAAAAAAAAGCAGGGGGG + Intergenic
1063561729 10:7134519-7134541 CAACTTGTACAAAGTCATGGGGG + Intergenic
1063674166 10:8125130-8125152 CAACAGAAACAAAGGGAGGAGGG + Intergenic
1065102707 10:22346155-22346177 GAAGGTGATCAAAGGCAGGGTGG - Intronic
1065516902 10:26532808-26532830 CAGCCTAAACAAAGACAGGGAGG - Intronic
1068679102 10:59799635-59799657 CACCATTAACAGAGGCATGGAGG - Intronic
1068892774 10:62165048-62165070 CAGCATGAGCAAAGGCCTGGGGG - Intergenic
1069032924 10:63617123-63617145 CAGCATGCACAGAGGCAGTGAGG - Intronic
1069868945 10:71521517-71521539 CCGCAGGAACAAAGGCTGGGTGG - Intronic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1070532264 10:77347347-77347369 TAACCTGCACAAAGGCAAGGAGG + Intronic
1070627759 10:78063316-78063338 CAGCAAGAACAAAGGCGTGGAGG + Intergenic
1070753676 10:78978363-78978385 CAGCGTGAACAAAACCAGGGAGG - Intergenic
1070772705 10:79091686-79091708 CGGCATGACCAAAGGAAGGGAGG + Intronic
1070874425 10:79789357-79789379 CAACATGAGGGAAGGCAAGGTGG + Intergenic
1071317477 10:84416231-84416253 GAAAATGAAGAAAAGCAGGGTGG - Intronic
1071641349 10:87311515-87311537 CAACATGAGGGAAGGCAAGGTGG + Intergenic
1071709894 10:88039715-88039737 CAACTTGAGCAAATGCAGGAGGG + Intergenic
1071714021 10:88076981-88077003 CAACATGAACAAAATCAGGGAGG + Intergenic
1071878239 10:89865901-89865923 CAACATGCACAAAGGCCTGGAGG + Intergenic
1072343250 10:94476808-94476830 TAACATGAGCAAAGGCATGGAGG - Intronic
1072782640 10:98260977-98260999 GACCATGAACAACAGCAGGGTGG - Exonic
1072865234 10:99052851-99052873 CCATATGAACAAATGCAGAGAGG + Intronic
1073196917 10:101698934-101698956 CATCATGAAATAAGGCAGGGAGG + Intergenic
1073422097 10:103432911-103432933 CAGCATGAATAAAGACAGGAAGG - Intronic
1073547447 10:104362946-104362968 CAACATGTACAAAGGCATGGAGG - Intronic
1073817324 10:107222401-107222423 CAGCATGATTAAAGGCAGAGAGG - Intergenic
1073880963 10:107979722-107979744 GAACCAGAACAAAGGAAGGGTGG - Intergenic
1074285853 10:112097679-112097701 AAACAATAAAAAAGGCAGGGTGG - Intergenic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1074448459 10:113539504-113539526 CAACATGAGCAAAGGCTTGGAGG - Intergenic
1074665679 10:115720536-115720558 CAATATTAACAAGAGCAGGGTGG - Intronic
1074671676 10:115798615-115798637 CAGGATGAGCAAAGGCATGGAGG - Intronic
1074775245 10:116763206-116763228 CAACTTGAACTCAGGCATGGTGG + Intergenic
1074832634 10:117260270-117260292 CAACATGAAAGCAGGCAGAGAGG - Intronic
1074850054 10:117432443-117432465 CTACATGAGGAAAGGCAGGAGGG - Intergenic
1075476187 10:122736194-122736216 TCACCTGAACTAAGGCAGGGAGG + Intergenic
1076266007 10:129110447-129110469 CAGCTTGCACAGAGGCAGGGAGG - Intergenic
1076963810 11:61183-61205 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1078916761 11:15785615-15785637 CAACATCCACAAAGCCATGGAGG + Intergenic
1079335765 11:19569210-19569232 ATGCATGAACAAGGGCAGGGAGG - Intronic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1079947120 11:26758004-26758026 CACCATGAACAAAGGCTTGGAGG + Intergenic
1080573916 11:33580954-33580976 CCACCTGAAGAAAGGGAGGGAGG + Intronic
1080593410 11:33744593-33744615 CAACATTAAAAAAGCCATGGGGG - Intronic
1080820917 11:35805586-35805608 CAACAGGAAGAAAGGGAGGGAGG - Intronic
1080891020 11:36409367-36409389 CAACAAGAACAGAAGCAGGGTGG - Intronic
1081042012 11:38224760-38224782 GAACCTGAACATAGGAAGGGTGG - Intergenic
1081488717 11:43550416-43550438 CTGCATGAGCAAAGGCAGAGAGG + Intergenic
1081545850 11:44071109-44071131 CACCTTGAGCAAAGGCAAGGAGG + Intronic
1081632526 11:44699579-44699601 CTGCATGAGCAAAGGCATGGAGG + Intergenic
1081758017 11:45558332-45558354 CCACATGGGCAAAGGCAGGCGGG + Intergenic
1081805448 11:45887476-45887498 TGAGATTAACAAAGGCAGGGTGG + Intronic
1083254831 11:61489666-61489688 CAGCATGAGCAAAGGTGGGGAGG + Intronic
1083738659 11:64695961-64695983 CCAAAAGAAGAAAGGCAGGGGGG - Intronic
1084101698 11:66954156-66954178 CAACAAGAACAAGAGCAGAGGGG + Intronic
1084309688 11:68309746-68309768 CCACAGGAACAAAGGGAAGGGGG - Intergenic
1084392335 11:68885790-68885812 CGACAAAAAAAAAGGCAGGGGGG - Intergenic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1085125911 11:74002224-74002246 CAAGAGGAGCAAAGGCATGGAGG - Intronic
1085135978 11:74088761-74088783 GAACATGTGCAAAGGCAGGGAGG - Intronic
1085345528 11:75765977-75765999 CAGCATGGACAAAGGCCTGGAGG - Intronic
1085352842 11:75811280-75811302 CAGCATGAGCAAAGGCACAGGGG - Intergenic
1085722189 11:78922246-78922268 CAGCATGAGGAAAGGCAGGCAGG + Intronic
1085740360 11:79073329-79073351 CATCATGCACAAAGTCAGAGAGG - Intronic
1085828825 11:79877642-79877664 TAATATGAACAAAGGCTTGGAGG + Intergenic
1085865732 11:80289854-80289876 CAGCATGTACAAAGGCACTGTGG - Intergenic
1086597234 11:88587334-88587356 CAATATGTACACAGACAGGGAGG + Intronic
1086604018 11:88672998-88673020 TATCATGAACAAAGGCAAAGAGG + Intronic
1087903839 11:103672882-103672904 CTACATTCACAAGGGCAGGGAGG - Intergenic
1088182562 11:107128776-107128798 CAGCATGAACCAAGACATGGAGG - Intergenic
1088199277 11:107313434-107313456 CAGCATGAACAAAGGTAAAGAGG + Intergenic
1088231656 11:107679189-107679211 CAACATGAATAAAGGCACTAAGG + Intergenic
1088683102 11:112261394-112261416 CAACAAAAACAAACTCAGGGAGG + Intronic
1088828719 11:113517128-113517150 CAACAAGAAGAGAGGGAGGGAGG + Intergenic
1088840649 11:113624794-113624816 CAACATGGACAAAGGCTGGAGGG - Intergenic
1089209659 11:116791623-116791645 CAGCGGGGACAAAGGCAGGGTGG - Exonic
1089293623 11:117454624-117454646 CAACATGAACAAAAGCCAGCAGG - Intronic
1089620566 11:119719973-119719995 CAGCATGTGCAAAGGCACGGAGG + Intronic
1089658022 11:119965944-119965966 CTCCTTGAACAAAGGAAGGGTGG + Intergenic
1089784990 11:120901342-120901364 CAGCATGTGCCAAGGCAGGGAGG - Intronic
1089957506 11:122585224-122585246 CCACGTGAGCAAAGGCAGGCAGG + Intergenic
1089977895 11:122748309-122748331 CAACATTCACAAAAGCAGAGAGG + Intronic
1090491923 11:127171548-127171570 CAACATGAACAGATGAAGTGAGG - Intergenic
1091238039 11:134034595-134034617 CAGCACGAACAAACCCAGGGTGG - Intergenic
1091761683 12:3091658-3091680 AAATAAGAACAAAGGCAGAGTGG + Intronic
1091927338 12:4364883-4364905 CAATATGAAAAATGGCAGAGGGG - Intergenic
1092020109 12:5194712-5194734 CAACACAGACAAAGGCATGGTGG - Intergenic
1092548379 12:9471232-9471254 CATCATTATCAAAGGCAGGGTGG + Intergenic
1092964630 12:13629704-13629726 AAAAAGAAACAAAGGCAGGGAGG - Intronic
1093251499 12:16810275-16810297 CAAAATGAACACAGAGAGGGCGG - Intergenic
1093367840 12:18325446-18325468 CAACATGAACAGAGGCACTTTGG + Intronic
1093675815 12:21939365-21939387 CAACATGGACAAAAAGAGGGAGG + Intronic
1094044063 12:26147585-26147607 ACACATGAAAAAAGGCATGGAGG + Intronic
1094602290 12:31919981-31920003 CAACAAGAAAAAAAGCAGAGAGG + Intergenic
1094752069 12:33421884-33421906 CAGCATGAACAAAAGCACAGAGG + Intronic
1097071595 12:56359159-56359181 CAGCAGGAACAAGGGAAGGGAGG + Intronic
1097888079 12:64750028-64750050 CAACAAAAACAGAGGCATGGTGG - Intronic
1097969324 12:65615637-65615659 CAACATGAATAAAAGGAGGTGGG - Intergenic
1098850136 12:75586400-75586422 CAACATGAACATACACATGGAGG - Intergenic
1100156239 12:91803980-91804002 GAAAATGAAGAAAAGCAGGGCGG + Intergenic
1100492061 12:95090231-95090253 CAGCATGAGCAAAGGCAGAGAGG + Intronic
1101135069 12:101734918-101734940 CAACAAGATCAAAGGTAAGGTGG - Exonic
1101351579 12:103934610-103934632 CATCCTGAATAAAGGCATGGAGG + Intronic
1101575304 12:105991695-105991717 CAGCATGAACAAAGGCCAGGGGG + Intergenic
1101660154 12:106758568-106758590 CTACATGAGCCAAGGCAAGGGGG + Intronic
1101801656 12:108027712-108027734 CTACATCAACAAATGCAGGCAGG + Intergenic
1101882330 12:108633976-108633998 CAACATTGATAAAGACAGGGTGG + Intergenic
1102144986 12:110648330-110648352 CAAAAGGAAAAAAGGCAGGAAGG - Intronic
1102679908 12:114684394-114684416 CAACATGATCAGAGGGCGGGCGG + Intergenic
1103174725 12:118852871-118852893 CAACATCTACAAAGGCATTGGGG - Intergenic
1103201127 12:119088796-119088818 CAGCTTGAACAAAGCCAGAGAGG + Intronic
1104556903 12:129808743-129808765 CAGAATGAACAAAGGCGGGAAGG + Intronic
1104667017 12:130654866-130654888 CAACAGCAAGAAAGCCAGGGAGG + Intronic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1109175538 13:59150828-59150850 CAGCATGAACAAAGTCAAGAAGG + Intergenic
1109560721 13:64046360-64046382 CAACATGAAGAAAAGAAGGATGG - Intergenic
1109993648 13:70092341-70092363 CAACATGAACAAAGTCATATAGG - Intronic
1110259678 13:73471445-73471467 TGGCATGAACAAAGGCAGAGTGG + Intergenic
1110356590 13:74574573-74574595 CAGCATGAACAAAGGCACTGAGG - Intergenic
1110985739 13:81965709-81965731 CAACAGGAAAAAAGGCAGGAAGG - Intergenic
1111331530 13:86765144-86765166 CAACTTGAACCATGGCACGGGGG - Intergenic
1111627873 13:90813046-90813068 CAGGATGAGCAAAAGCAGGGTGG + Intergenic
1112029516 13:95444236-95444258 AAACATGCACAAGGGCAGGAAGG - Intronic
1112375308 13:98834486-98834508 CAATAGGAACCAAGACAGGGAGG - Intronic
1112641230 13:101277873-101277895 CCACATGAGCAGAGGCAGAGAGG - Intronic
1113422711 13:110182662-110182684 CCACCTGAACACAGCCAGGGTGG - Intronic
1114842059 14:26275840-26275862 CAACAGGAACAGAAGGAGGGAGG + Intergenic
1116417949 14:44700863-44700885 GAACATGAACAATGGATGGGAGG - Intergenic
1116576368 14:46581314-46581336 CAAAATGCACAAAGGAAGGAAGG + Intergenic
1117733058 14:58743330-58743352 CAACATGAATTTTGGCAGGGAGG - Intergenic
1117973376 14:61274220-61274242 CAGCATGAGCAAAGACACGGAGG + Intronic
1118493178 14:66281591-66281613 CAACATGTGCAAAGCCAGGGAGG + Intergenic
1119485025 14:74981451-74981473 CAGCATGAACCCAGGCGGGGAGG - Intergenic
1119649702 14:76374973-76374995 CTTCAGGAATAAAGGCAGGGAGG - Intronic
1120061245 14:79985451-79985473 GAACATGAAAGAAGTCAGGGCGG + Intergenic
1121258465 14:92549196-92549218 CAACCTGACCCAAGGCAGCGTGG - Intronic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1121676136 14:95754540-95754562 TAAGATAAACAAAGGCATGGAGG - Intergenic
1121678520 14:95773784-95773806 CAGCAAGAGCAAACGCAGGGAGG - Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122774928 14:104112921-104112943 CAGCCTGGGCAAAGGCAGGGTGG - Exonic
1123144017 14:106110561-106110583 TAAAATGAACAAAGGCAGCAAGG + Intergenic
1123697637 15:22890686-22890708 GAACACGAACAGAGACAGGGTGG + Intronic
1123697649 15:22890747-22890769 GAACACGAACAGAGACAGGGTGG + Intronic
1123697661 15:22890808-22890830 GAACACGAACAGAGACAGGGTGG + Intronic
1124624705 15:31301204-31301226 CAAGGTGAACAAAGGCAGTGGGG - Intergenic
1124690511 15:31817794-31817816 CAACTTGGAGAAAGGCAGGTGGG - Intronic
1125363700 15:38891120-38891142 CAACATGAATAGAAACAGGGAGG + Intergenic
1125518833 15:40337338-40337360 AAAGATGAACAAAGCCAAGGAGG + Intronic
1125750255 15:42023036-42023058 CAGCATGAACACAGGCAGGGAGG + Intronic
1126793645 15:52242873-52242895 CAGCATGAGTAAAGGCATGGAGG + Intronic
1127165935 15:56244540-56244562 CAGCATGAGCAAAGGCACGAAGG - Intronic
1127203244 15:56681874-56681896 CAACCTGAACAAACACAGAGTGG + Intronic
1127847594 15:62884955-62884977 CAAAATGTACTAAGGCTGGGAGG - Intergenic
1127992087 15:64127077-64127099 CAACAGGAGGAAAGGCAGTGAGG - Intronic
1128087225 15:64894625-64894647 CAGCCTGGGCAAAGGCAGGGAGG + Intronic
1128798863 15:70484365-70484387 CAACATGAGCAAGGGCAAAGAGG - Intergenic
1129191962 15:73942505-73942527 CAGCATGAACAAAGACCTGGAGG - Intronic
1129330554 15:74824897-74824919 CAGCATGAGAAAAGGCAGGGAGG + Intronic
1129372276 15:75105077-75105099 AAAGCTGAACAAATGCAGGGTGG + Intronic
1130919967 15:88335606-88335628 CAGCATGAACAGAGGCTTGGAGG + Intergenic
1131077997 15:89510345-89510367 CAGCATGTGCAAAGGCATGGAGG + Intergenic
1131225844 15:90623888-90623910 CAGCATGCGCAAAAGCAGGGAGG - Intronic
1131689752 15:94813950-94813972 CCACATCAAGAAAGGGAGGGAGG + Intergenic
1132444743 15:101903990-101904012 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1132918580 16:2369402-2369424 CAACATGAGCAAAGCCAAGGTGG - Intergenic
1133777298 16:8907028-8907050 CAAAATTAACAGAGGCAGGAAGG + Intronic
1133987272 16:10677945-10677967 CTACATTAGCAAAGGCAGGCAGG + Intronic
1134094877 16:11412710-11412732 CTGCATAAACAAGGGCAGGGAGG - Intronic
1134859089 16:17545065-17545087 GAACAAGAACAAAGGTTGGGAGG + Intergenic
1136045072 16:27609018-27609040 CAGCATGAACAAAGGTTTGGGGG - Intronic
1137289122 16:47039637-47039659 CAAGAGGAACACAGTCAGGGTGG + Intergenic
1137558275 16:49486816-49486838 CACCATGAGCAAAGGCATGGAGG + Intergenic
1137982959 16:53085349-53085371 TAAGATGATCAAAGGCAGGCTGG - Intronic
1138386926 16:56642185-56642207 CAAAATGTACAAAGTAAGGGAGG + Intronic
1138404434 16:56778270-56778292 TAACCTGACCAAAGTCAGGGAGG + Intronic
1138607435 16:58098046-58098068 CACCATGGACAAAGGCCTGGAGG - Intergenic
1139140538 16:64256776-64256798 CAACACGATCAAAGGCTGAGGGG - Intergenic
1139438035 16:66948178-66948200 CCGCTTGAGCAAAGGCAGGGAGG - Intergenic
1139657248 16:68396450-68396472 CAGCATGTGCAAAGGCATGGAGG - Intronic
1140125075 16:72111930-72111952 CAACATGACTCAAGGCAGGCTGG - Intronic
1140735730 16:77896180-77896202 CAACTGGAACAAAGGCAGGGAGG - Intronic
1140900540 16:79363182-79363204 AAAGATGAACAAGGGTAGGGGGG + Intergenic
1141527609 16:84621950-84621972 CAATATAAACAAATGCAGGCTGG - Intergenic
1141847098 16:86618300-86618322 TAGCTTGAACAAAGGCATGGAGG - Intergenic
1142319625 16:89372656-89372678 AAACATGAACAAGTGCAAGGAGG + Intronic
1142956617 17:3527237-3527259 CAGCATGAGCAAAGGCTCGGAGG - Intronic
1143317370 17:6042571-6042593 CACCAGGAAGAAAGACAGGGTGG + Intronic
1143374680 17:6460234-6460256 CAGCATGTGCAAAGGCACGGAGG - Intronic
1144197912 17:12913478-12913500 TAATATGAATAAAGGGAGGGAGG + Intronic
1144481762 17:15635750-15635772 CAACATATGCAAAGGCAGAGAGG - Intronic
1144916538 17:18728022-18728044 CAACATATGCAAAGGCAGAGAGG + Intronic
1145204295 17:20973598-20973620 CAACACTAATTAAGGCAGGGTGG - Intergenic
1146218174 17:30995518-30995540 CAACATGAAACCAGGCATGGTGG - Intronic
1146645367 17:34573684-34573706 CAGCAGGAACAAAGGTGGGGAGG + Intergenic
1147199045 17:38787313-38787335 GAACAGAAATAAAGGCAGGGAGG - Intronic
1147872355 17:43596533-43596555 CAGCATGAGCAAAGGCTTGGAGG - Intergenic
1147889755 17:43709075-43709097 CAGCATGTATAAAGGCACGGAGG - Intergenic
1149074772 17:52582059-52582081 GAATAAAAACAAAGGCAGGGAGG + Intergenic
1149646759 17:58246654-58246676 CACCGTGAACAAAGGCAGGCAGG - Intronic
1152488282 17:80610200-80610222 AAAGATGAACAAATGCAAGGAGG - Intronic
1153368263 18:4284309-4284331 CAAGCCGAACACAGGCAGGGTGG + Intronic
1153684347 18:7529977-7529999 GATGATGAACAAAGGCAGAGAGG - Intergenic
1153999781 18:10473485-10473507 CAACATGAATTAGGGCAGAGAGG + Intronic
1154184755 18:12173072-12173094 GAGCATGAACCAAAGCAGGGTGG - Intergenic
1155804414 18:30148192-30148214 CAACAATAACAATGGCAGTGTGG + Intergenic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1156123154 18:33869928-33869950 GTATATGAAGAAAGGCAGGGTGG + Intronic
1156333919 18:36151482-36151504 CAACACTATCAAAGGCTGGGTGG - Intronic
1156359500 18:36371924-36371946 CAACAGGAACAAAGGCTTTGAGG - Intronic
1156380579 18:36556602-36556624 CAACAGGCACAAAGACTGGGAGG - Intronic
1156667036 18:39421149-39421171 CCACATGAAGAAAGGTAGAGTGG - Intergenic
1156699301 18:39806181-39806203 CAACATGAGCAACTGGAGGGAGG - Intergenic
1156756122 18:40528555-40528577 TAACATGTAGAAAGGCAGGTGGG - Intergenic
1157390604 18:47299500-47299522 TAACAGGAACAAAGGCACAGAGG - Intergenic
1157575614 18:48741281-48741303 CAACATGTACCAAGGAGGGGGGG - Intronic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158041529 18:53100599-53100621 CAAAAGGGACAAAGGAAGGGAGG + Intronic
1158633105 18:59133077-59133099 CAGCAGGAAAAAAGGCAGGGTGG + Intergenic
1158925457 18:62253213-62253235 CAACAAGAACAAAGGCCCTGAGG + Intronic
1159484519 18:69037634-69037656 GAACATGAGCAAAGGCATGAGGG + Intronic
1159912228 18:74156487-74156509 AACCATGGAGAAAGGCAGGGAGG + Intronic
1160524622 18:79527735-79527757 CAACAAGAAGGAAAGCAGGGAGG + Intronic
1160640613 19:130814-130836 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1160705517 19:528236-528258 CAACAGGAACGGGGGCAGGGAGG + Intergenic
1160957730 19:1701413-1701435 AAACTTGAACAAAGGCTGGGTGG - Intergenic
1160969571 19:1761552-1761574 CAGCAGGGACAAAGGCTGGGAGG + Intronic
1161501337 19:4617731-4617753 CAGCATGGGCAAAGGCCGGGTGG - Intergenic
1161523425 19:4738599-4738621 CCACATGAACCAGGGTAGGGAGG + Intergenic
1162306888 19:9880242-9880264 CAGCATGGGCAAAGGCAGGGAGG + Intronic
1162606693 19:11714406-11714428 CACCATAAAAAAAGTCAGGGAGG - Intergenic
1163502360 19:17684179-17684201 CAGCATGAGCAAAAGCATGGTGG - Intronic
1164628474 19:29745389-29745411 CAACAAGAGCAAAGGCACTGGGG + Intergenic
1165187165 19:34032153-34032175 CAACAGGAACAAAGGAGGAGAGG + Intergenic
1165367978 19:35381288-35381310 GAAAACGAACAAAGGCAGGCAGG - Intergenic
1165700499 19:37933585-37933607 CAACATGATCCAAGGATGGGTGG + Intronic
1166388894 19:42397831-42397853 CAGCGTGACCAAAGACAGGGAGG + Intergenic
1167266125 19:48483589-48483611 CTGCATGAACCAAGGCAGCGGGG - Intergenic
1167345946 19:48945863-48945885 CAACAAGAACAAAAGCTGGGTGG - Intergenic
1167683312 19:50939468-50939490 CACCATGACAAAAGGCAGGAAGG - Intergenic
1167887228 19:52510802-52510824 CGACATGATCAAAGGCATGCTGG + Exonic
1167892619 19:52553337-52553359 CAACATGATCACAGGCATGCTGG + Exonic
1167896056 19:52582432-52582454 CGACATGATCAAAGGCATGCTGG + Exonic
1167911484 19:52706612-52706634 CAACATGATCACAGGCATGCTGG - Exonic
1167919084 19:52767520-52767542 CAACATGATCACAGGCATGCTGG - Exonic
1167923218 19:52801450-52801472 CAACATGATCAAAGGCATGCTGG - Exonic
1167928301 19:52841899-52841921 CAACATGATCAAAGGCATGCTGG - Exonic
1167935893 19:52907930-52907952 CAATATGATCAAAGGCATGCTGG - Intergenic
1167938798 19:52929162-52929184 CGACATGATCAAAGGCATGCTGG - Exonic
1167990004 19:53351048-53351070 CGACATGATCAAAGGCATGCTGG + Exonic
1168710114 19:58494725-58494747 CAACAGAAACAAAGGGAGGAGGG - Intronic
925442408 2:3899802-3899824 GAAAATGAAGAAAAGCAGGGTGG - Intergenic
926019683 2:9484141-9484163 CACCTTGAACAGAGGCAGAGAGG - Intronic
926044763 2:9702497-9702519 CAATGTGTACAAAGGCAGGAAGG - Intergenic
926352790 2:12012084-12012106 CAACATGAGCAAAGGTACGGAGG - Intergenic
927061837 2:19430346-19430368 AAAAATGAACAAAAGCATGGAGG + Intergenic
927096507 2:19751327-19751349 CAGCATGAGCAAAGGCGAGGTGG + Intergenic
927178015 2:20423962-20423984 CAACTTGAACAACCACAGGGAGG - Intergenic
927438717 2:23093521-23093543 TGACATGAACTAGGGCAGGGTGG + Intergenic
927716318 2:25355691-25355713 CCACAGGAGCAAAGGCAAGGGGG + Intergenic
929004077 2:37378646-37378668 CCACAGGAATGAAGGCAGGGAGG + Intergenic
929295547 2:40242427-40242449 CAACATAAACACAGGCAGCATGG - Intronic
929438352 2:41946219-41946241 CAACATGAGCAGGGGCACGGAGG + Intronic
929875893 2:45796061-45796083 CAGCATGAGCAAAGGCACAGAGG - Intronic
930106955 2:47647836-47647858 CAGCATGAGCAAAGGCATAGAGG + Intergenic
930692770 2:54381252-54381274 CAGCATGAACAAAGGCATAGAGG - Intronic
931273053 2:60719595-60719617 CAGCCTGAACAAAGGCACAGAGG + Intergenic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
931673376 2:64669544-64669566 CAGGATGAACAAAGATAGGGAGG + Intronic
933250553 2:80024453-80024475 CAGCATGAGCAAAGGCATGAAGG + Intronic
933971955 2:87477018-87477040 CAGCATGTGCAAAGGCATGGAGG + Intergenic
934682932 2:96298431-96298453 CAAAAGGAACAAAGGAAGTGAGG + Intronic
936321771 2:111473179-111473201 CAGCATGTGCAAAGGCATGGAGG - Intergenic
936530239 2:113271261-113271283 CAAGATGAACCTAGGCAGGGAGG + Intronic
937040531 2:118817247-118817269 CAGCATGTGCAAAGGCAGGGAGG - Intergenic
937435010 2:121873228-121873250 GAAGAAGAACAAAGGCAGGAAGG - Intergenic
937540323 2:122942782-122942804 CAACAACCACAGAGGCAGGGAGG + Intergenic
938782952 2:134601970-134601992 CAGCTTGAACAAAGGCTTGGAGG + Intronic
939179111 2:138783365-138783387 CAGAATGAGCAAAGGCAGAGTGG + Intergenic
940403590 2:153274351-153274373 CAAGAAGGACAAAGGAAGGGTGG - Intergenic
941135520 2:161713090-161713112 CAACATCATTAAAGGTAGGGAGG + Intronic
941470952 2:165886106-165886128 AAATGTGAACAAAGTCAGGGAGG - Intronic
942177729 2:173350613-173350635 GAACATGAACAAAGTCAGGAAGG - Intergenic
942628762 2:177933382-177933404 CAAAAAGAACAAAGCCAGGCTGG + Intronic
943296653 2:186148714-186148736 CATCATTCACTAAGGCAGGGAGG + Intergenic
944198861 2:197084264-197084286 CAACCTGGACAAAGGTAGGGGGG - Intronic
944590236 2:201210089-201210111 TAGCATGAACAAAAGCATGGGGG + Intronic
945157290 2:206852988-206853010 CAACATGAAGAAAGACTGAGAGG + Intergenic
945221184 2:207485781-207485803 CAACATGAGCAAAGGGTTGGGGG + Intergenic
945649324 2:212538874-212538896 CAACAATAAAAAAGGAAGGGGGG + Intergenic
946643486 2:221808805-221808827 CAACAAAAAAAAAGGAAGGGAGG + Intergenic
946827127 2:223690482-223690504 CAGCATGAACAAAGACATGGGGG - Intergenic
948547310 2:238742082-238742104 GAAAAAGAACAGAGGCAGGGTGG + Intergenic
948741974 2:240054122-240054144 GAACCTGAACAAGGACAGGGTGG - Intergenic
1169186472 20:3621247-3621269 CCCCATGCACACAGGCAGGGAGG + Intronic
1169681413 20:8218039-8218061 CAACATGGACTAAGACAGGTGGG + Intronic
1170545592 20:17433505-17433527 CAACAGGAGCAGAGGCAGAGAGG + Intronic
1170556780 20:17521338-17521360 CAGCATGAAGAAATGCATGGTGG + Intronic
1172347311 20:34212752-34212774 CAAAATTAACAAGGGCAGGTGGG - Intronic
1172506690 20:35467849-35467871 CAGCAGGTACAAAGACAGGGAGG - Intronic
1172604547 20:36205927-36205949 CAGCAGGAAGAAAGGCAGGCAGG + Intronic
1172634150 20:36398369-36398391 CAGCATGGGCAAAGGCATGGAGG + Intronic
1172804801 20:37604141-37604163 CAGCATGTACAAAGGCCTGGAGG - Intergenic
1172807230 20:37621067-37621089 CAGCATGAACAAAGGTACTGAGG + Intergenic
1172821493 20:37738831-37738853 GAGCATGAACAAAGGCACAGAGG + Intronic
1172957379 20:38770804-38770826 CAACATGCACAAATGGAGGTGGG - Intronic
1172983608 20:38964231-38964253 CAGCATGAACAAAGGCAGAATGG + Intronic
1173234739 20:41234430-41234452 AAACATGAACCAAGGTAAGGAGG - Intronic
1173462503 20:43254560-43254582 CAGCATGGTCAAAGGCAAGGAGG - Intergenic
1173530651 20:43766869-43766891 CAGTATGAACAAAGACAGGGAGG - Intergenic
1174005426 20:47407065-47407087 CAGCAAGGAGAAAGGCAGGGAGG + Intergenic
1174005434 20:47407114-47407136 CAGCAAGGAGAAAGGCAGGGAGG + Intergenic
1174188165 20:48721735-48721757 GGACAAGAACAGAGGCAGGGAGG + Intronic
1174360631 20:50027037-50027059 CAACATGGACACAGGGTGGGGGG + Intergenic
1174492202 20:50908037-50908059 CTCCATGAACAAATGCATGGAGG - Intronic
1176963749 21:15188802-15188824 CATTTTGAACAAAGGCAGTGAGG - Intergenic
1177865896 21:26513038-26513060 CAACGTGAACAAAGACACAGAGG - Intronic
1178320872 21:31604666-31604688 CAAGAGGAACAAGGCCAGGGTGG + Intergenic
1178467112 21:32858817-32858839 CACCATGGACAGTGGCAGGGGGG - Intergenic
1178677338 21:34642384-34642406 CAACATGACCAAAGGCAGGTGGG - Intergenic
1179118606 21:38520608-38520630 CAACATGCACAAAGGAAAGCTGG + Intronic
1179837242 21:44044534-44044556 CAACAATAACAAAGGCTGGGAGG - Intronic
1181046219 22:20215570-20215592 CAACATTAGCAAAGGCCTGGAGG - Intergenic
1181134937 22:20758612-20758634 CTACATGGACAAATGCAAGGTGG + Intronic
1181304864 22:21909997-21910019 CAGCATCAACAAAGGCAGGATGG - Intergenic
1181440486 22:22933031-22933053 CCACATGGAGAAAGACAGGGAGG - Intergenic
1181534457 22:23534359-23534381 TGACGTGAACAAAGGGAGGGTGG - Intergenic
1181906437 22:26200887-26200909 CAGCTTGAACAAAGGCTGAGAGG - Intronic
1181957310 22:26597301-26597323 CACCATGAACAAAGGCATAGAGG - Intergenic
1182461121 22:30484798-30484820 CAGCATGAGCAAAGGCAGAGGGG + Intergenic
1182840893 22:33389107-33389129 CACCATGGACAAAGGCACAGAGG + Intronic
1183031708 22:35111285-35111307 CAACTGGAACACAGTCAGGGAGG + Intergenic
1183133057 22:35858293-35858315 AAACATGATCAAAGGCACAGAGG - Intronic
1183515363 22:38262447-38262469 CTATATGAGCAAAGGCACGGAGG + Intronic
1183678361 22:39312373-39312395 GAACATGAACACAGGCACAGAGG - Intergenic
1183951434 22:41355154-41355176 CAGCCTGTACAAACGCAGGGAGG + Intronic
1184168060 22:42742321-42742343 CATCTTGTACAAAGGCCGGGGGG + Intergenic
1184320885 22:43741405-43741427 AGACCTGAACGAAGGCAGGGAGG - Intronic
1184928088 22:47658360-47658382 CAACTTGCACAAAGGCTTGGAGG - Intergenic
1185307059 22:50125099-50125121 CAACCTGAAAAAGAGCAGGGAGG + Intronic
950076240 3:10189292-10189314 CAGCATGTACAAAGGCCTGGGGG + Intronic
950627673 3:14260103-14260125 AAACTTGAACAAAGGCATAGAGG - Intergenic
950635203 3:14309174-14309196 CAGCAAGAGCAAAGACAGGGAGG + Intergenic
950668484 3:14511420-14511442 CGACATCAAGAAAGGCAGCGTGG - Exonic
950900783 3:16495621-16495643 CAGCAAGAGCAAAGGCATGGAGG + Intronic
950930307 3:16782683-16782705 CAACCTTGACAAAGGCAGAGAGG - Intergenic
951598006 3:24339015-24339037 CTACATTAACAAAGCCAGGAAGG + Intronic
951684441 3:25328700-25328722 GAACATGAGCCAAAGCAGGGCGG + Intronic
952743067 3:36752627-36752649 AGACCTGAACAAAGGCAGGAAGG - Intergenic
952963448 3:38606969-38606991 CAGCACGAACAAAGTCACGGAGG - Intronic
953809210 3:46097425-46097447 CGACATGAAGACAGGCAGGTGGG + Intergenic
954176324 3:48848309-48848331 CAACAAGAGCAAAGGCCTGGTGG + Intergenic
954286992 3:49626110-49626132 CATCCTGAACAAAGCCAGGCTGG - Intronic
954418389 3:50405442-50405464 CACCATGGACAGAGGTAGGGAGG + Intronic
954799568 3:53179380-53179402 CAGCAGGAACAAAGGCCTGGAGG + Intronic
954982575 3:54759970-54759992 CCACATGCAGAAAGGCAAGGTGG + Intronic
956137271 3:66111524-66111546 AAAAATGAAGAAAGGAAGGGAGG - Intergenic
956847070 3:73193363-73193385 CAAAATGAACTAACTCAGGGTGG - Intergenic
957321424 3:78635869-78635891 CAACATGAACAATGGCAGCGGGG - Exonic
957576743 3:82017261-82017283 GAGCATGAGCAAAGGCAGTGAGG + Intergenic
959024955 3:101230597-101230619 GAGCATGAGCAAAGTCAGGGAGG - Intronic
959766005 3:110029196-110029218 CAGCATGATCAAAGGCATAGAGG - Intergenic
960007361 3:112793961-112793983 CACCATGAAGAAACTCAGGGAGG - Intronic
960673814 3:120176111-120176133 CATCATGACCAGAGGCAGGGAGG - Intronic
960916834 3:122703386-122703408 CAGCATGAACATAGGCATGGTGG - Intronic
961155487 3:124676150-124676172 CAACAGAACCAAAGGTAGGGAGG - Intronic
962236868 3:133714128-133714150 CAGCAAGCACAAAGGCATGGGGG + Intergenic
962250041 3:133830490-133830512 CAGCATGAACAAAGGAAAGAAGG - Intronic
962887728 3:139642892-139642914 CAGCAGGATCAAAGGCATGGAGG - Intronic
963004058 3:140709600-140709622 CAGCATGAAGAAAGGTAGAGGGG + Intergenic
963787442 3:149549124-149549146 CACCATGCTCAAAGGCCGGGGGG + Intronic
964415888 3:156447009-156447031 CAACATGAGCAAGGACAAGGAGG - Intronic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
967854010 3:194102758-194102780 CAACATAAACAAAGGCTCTGAGG - Intergenic
967855922 3:194117489-194117511 CATCAGGAAGAAAGGCAGGTGGG - Intergenic
967867670 3:194203874-194203896 CCTGATGAACAAAGGCAAGGGGG + Intergenic
968382584 4:108642-108664 CAACATGTGCAAAGGCACAGGGG + Intergenic
968705802 4:2076859-2076881 CAACATGAAGAAAGAGAGGAAGG - Intronic
969157125 4:5220769-5220791 CAGAAAGAACAGAGGCAGGGAGG + Intronic
969166407 4:5319608-5319630 CAGCATGAACAAAGGCTGAGAGG - Intronic
969238548 4:5885178-5885200 CAGCATGGGCAAAGGCAAGGAGG - Intronic
969319783 4:6404735-6404757 CACCAAGCACAAAAGCAGGGAGG + Intronic
969341219 4:6542961-6542983 CAACAGGAAAAAAAGCAGGGAGG + Intronic
969424143 4:7114103-7114125 CGACATGAACAAAGGCACCGAGG + Intergenic
969633855 4:8353822-8353844 CCACATGAACAAAGTCAAGGAGG + Intergenic
970850276 4:20594624-20594646 CTGCATGAAGAAAGGCAGTGTGG - Intronic
970914063 4:21311784-21311806 CAAGATGAACAGATGCAGTGAGG + Intronic
971796932 4:31240029-31240051 CAACCTGACAAAAGGCAGGATGG + Intergenic
972397803 4:38672567-38672589 AAAAATGAACAAAGGCCTGGGGG + Intronic
972688971 4:41378109-41378131 GAACATGAGCAGAGGCATGGAGG + Intronic
973720560 4:53719698-53719720 CAACATGAACAAAGGCAGGGAGG - Intronic
973782550 4:54301892-54301914 ACACATGAACACAGGCGGGGGGG + Intergenic
974201890 4:58653477-58653499 CAACATGATCAAAAGCACTGAGG - Intergenic
974356211 4:60815974-60815996 CAATAGGAAGAAAGTCAGGGTGG - Intergenic
974880917 4:67756319-67756341 CATCATTAACAAAGAAAGGGAGG - Intergenic
976205896 4:82622941-82622963 CAACAGGAAGGAAGGAAGGGAGG - Intergenic
977084588 4:92576844-92576866 CAGAATGAAAAAAAGCAGGGTGG - Intronic
977452626 4:97218451-97218473 TAACATACATAAAGGCAGGGAGG - Intronic
978210206 4:106126077-106126099 CAACATGTGCAAAGGCACAGTGG - Intronic
979797140 4:124860317-124860339 CAAAAACAACAAAGGCACGGTGG - Intergenic
980159419 4:129141376-129141398 CAGAATGAACAAAGGCACAGAGG + Intergenic
980510858 4:133785762-133785784 CTACAAGAAGAAAGGGAGGGAGG + Intergenic
982429588 4:155307248-155307270 CAACATGAACAAAGAAAGAGAGG - Intergenic
982693371 4:158572476-158572498 CAGCATGAACAAAGGCAAAGAGG + Intronic
982842076 4:160201866-160201888 CAACAAGAACAAAGGCCCAGAGG - Intergenic
983771895 4:171561229-171561251 GAAAATGAACTAAGACAGGGAGG - Intergenic
983870701 4:172822190-172822212 CAAACTGAAGAAAAGCAGGGAGG - Intronic
984080048 4:175237177-175237199 AAAGATGAAAAAAGGCAGAGAGG - Intergenic
984600498 4:181721142-181721164 CATTATGTACAAAGGCAGAGAGG + Intergenic
984844542 4:184098471-184098493 CAGAAGGAAGAAAGGCAGGGTGG - Intronic
985257099 4:188081172-188081194 CAATAAAAACACAGGCAGGGTGG + Intergenic
985683946 5:1271922-1271944 AATCATGAACAAAGGCACTGCGG + Intronic
986820621 5:11462440-11462462 CCACAACAGCAAAGGCAGGGAGG - Intronic
987373014 5:17210303-17210325 CAACATGAATAAAGCTAGAGAGG + Intronic
988482570 5:31642056-31642078 CCACATGATCAAAGGCAAGGGGG - Intronic
989043537 5:37252412-37252434 AAGCAGGAACACAGGCAGGGGGG - Intergenic
989265153 5:39464762-39464784 CAACATGAGGAAAGGCAGGAAGG - Intergenic
990363777 5:55048406-55048428 CAGCATGAACAAAGCCACAGAGG + Intergenic
990625386 5:57604924-57604946 TAGCAAGAACAAAGGCATGGAGG + Intergenic
990991602 5:61689879-61689901 CAACATGGACATAGGGTGGGTGG - Intronic
991251273 5:64564195-64564217 GAACATGACCAGTGGCAGGGTGG - Intronic
992431870 5:76717520-76717542 CACCCTGAACAAAGACAGAGAGG - Intronic
992486767 5:77204687-77204709 CAGCATGAACAAAGGCACAGAGG - Intergenic
992659654 5:78945772-78945794 GAACATAAATAAAGACAGGGAGG - Intronic
994066248 5:95545823-95545845 CAACATGAATACAGGCACTGAGG - Intronic
996029547 5:118689709-118689731 CAACACTAACAAAGGCAATGTGG - Intergenic
996901139 5:128542888-128542910 CAAGAAGAACAAAGGCAGAGTGG + Intronic
997311423 5:132886885-132886907 CAACATGTACAAGGGCTGGATGG - Intronic
997738111 5:136229345-136229367 GCACATGTACCAAGGCAGGGAGG - Intronic
997817912 5:137035813-137035835 TAAGCTGAACAAAGGCAGTGGGG + Intronic
998056751 5:139085170-139085192 TAGCATGAACAAAAACAGGGAGG + Intronic
998545790 5:143026468-143026490 AAATCTGAACAAAGGGAGGGAGG + Intronic
998623761 5:143822987-143823009 CAGCATGAGCAAAGGCCTGGAGG + Intergenic
998804542 5:145905782-145905804 CTAAATGAACAAAGGCTGGGAGG + Intergenic
999087691 5:148907615-148907637 CAACATGACAAATGACAGGGAGG + Intergenic
999241681 5:150131603-150131625 CAAGCTGCACAAAGGCAGGGAGG + Intronic
999402833 5:151280117-151280139 GAACAGGAAGAAAGGAAGGGAGG + Intronic
999694601 5:154178008-154178030 CAGCATGAGCAAAGGCATGGGGG + Intronic
1000371518 5:160541043-160541065 AAACATGAGCAAAGGCATGATGG + Intergenic
1000371989 5:160545660-160545682 CAACATGAATAAACTCAGAGAGG + Intergenic
1000480426 5:161766922-161766944 AAAAATGAAGAAAGGGAGGGAGG + Intergenic
1000598755 5:163246997-163247019 CAACATGAGCTAAGGCCAGGAGG + Intergenic
1000706844 5:164523176-164523198 CAGTAGGAACAAAGGCATGGAGG + Intergenic
1000732460 5:164853270-164853292 TATCATGAACAGAGGCATGGAGG + Intergenic
1001407827 5:171488388-171488410 CAGCTTGAGCAAAGGCATGGAGG + Intergenic
1001583478 5:172816671-172816693 CCACATGAGCAAAGACATGGAGG + Intergenic
1001671338 5:173476797-173476819 AAACATGAAGGAAGGCAGGGAGG - Intergenic
1001875198 5:175194303-175194325 CAGCATGGGCAAAGGCAGGGAGG + Intergenic
1001883878 5:175270909-175270931 CAGCATGTGCAAAGGCATGGGGG + Intergenic
1002736737 5:181395605-181395627 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1002747962 6:79217-79239 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1003476078 6:6484389-6484411 CAAAAAGAAGAAAGGGAGGGAGG + Intergenic
1004265625 6:14146139-14146161 TAACATGATCAGAGGCACGGAGG - Intergenic
1004293624 6:14390314-14390336 CAAAATGAACAAGGGCAGCTTGG + Intergenic
1004956891 6:20737103-20737125 GAGCATGAACAAAGACAAGGAGG - Intronic
1005988683 6:30890284-30890306 CAACAAGAAGAAAGGCAGCGTGG - Intronic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1006706269 6:36024106-36024128 CAAAATTAACAAAAGCAGTGGGG + Intronic
1006779960 6:36625740-36625762 CAGCATGAGCAAAGGCAGAGAGG + Intergenic
1007746983 6:44049156-44049178 CAGCATGGACAAAGGCATGGAGG - Intergenic
1007968924 6:46030711-46030733 CAACATGAGCAAAGGCATGGAGG - Intronic
1008110233 6:47484119-47484141 CAAAATAAACAAAAGCTGGGAGG - Intronic
1008763538 6:54882766-54882788 AATCATGAACAAAAGCAGGAAGG - Intronic
1008884054 6:56412089-56412111 CAAAATGAAAAAAGGTGGGGGGG + Intergenic
1008910111 6:56722789-56722811 GAACATGTACAAAGGCAGGGAGG + Intronic
1009813940 6:68706537-68706559 GAATATGAACACAGGCAGCGTGG - Intronic
1009999350 6:70932738-70932760 AAACATGAAGAAAAGCAGTGAGG - Intronic
1010397227 6:75406327-75406349 CAACATGAACAGAATCAGAGTGG - Intronic
1011202762 6:84855382-84855404 CAATAAGAACAGAGACAGGGAGG - Intergenic
1012272620 6:97233287-97233309 CAACATGGACAAATACATGGAGG - Intronic
1013459309 6:110359406-110359428 CAACATTCAAAAGGGCAGGGGGG - Intergenic
1014999906 6:128202186-128202208 GAAAATGAAGAAAAGCAGGGTGG + Intronic
1015094251 6:129395834-129395856 AAACATATACAAAGGCATGGAGG + Intronic
1015219677 6:130789796-130789818 CAATATGAGCAAACTCAGGGAGG - Intergenic
1016574660 6:145555319-145555341 CCATATGCACAAAGGCTGGGAGG - Intronic
1016983051 6:149870536-149870558 CAACAATAACAAAGCCAGGTGGG - Intergenic
1017931157 6:158956921-158956943 AAACATGAGCAATGGCAGGCTGG + Intergenic
1019241836 6:170671134-170671156 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1020115079 7:5471702-5471724 CCACATGGACAAAGGCCAGGCGG + Intronic
1020120121 7:5498418-5498440 CCACATGGACAAAGGCCAGGGGG + Intronic
1020434247 7:8145373-8145395 CAGAATGAACAAAGACAGGAAGG - Intronic
1020566186 7:9798733-9798755 CTACATGAAAGAAGGCAGGCTGG + Intergenic
1020630889 7:10637957-10637979 CAAGAGGAACAGAGGCAGGCAGG + Intergenic
1021416638 7:20393714-20393736 CAGCAAGAACAAAGGCACAGAGG - Intronic
1021424067 7:20479083-20479105 GAACATGAACAAAGACACAGAGG + Intergenic
1022472480 7:30690294-30690316 CAGCATGTGCAAAGGCAGAGAGG + Intronic
1023119988 7:36899448-36899470 CAGCATGAGCAAAGGCAAGGAGG + Intronic
1023127175 7:36965925-36965947 AAATATGAACACAGGCAGGATGG - Intronic
1023883244 7:44333553-44333575 CAACAACAAAAAAGGCAAGGGGG + Intronic
1023993837 7:45146639-45146661 CAGTATGAACGAAGGCAGGCCGG + Intergenic
1025626454 7:63226717-63226739 CAGAATGAACAAAGGCAGCTTGG - Intergenic
1025989071 7:66481461-66481483 AAATATGAGTAAAGGCAGGGAGG - Intergenic
1027212031 7:76157478-76157500 AAATATGAGTAAAGGCAGGGAGG - Intergenic
1027987235 7:85308778-85308800 CCACATGCACAAAAGCAGAGAGG + Intergenic
1028180290 7:87713345-87713367 CTACATGAACTAAGGCAGGCAGG + Intronic
1029793893 7:102873809-102873831 CAGCCTGCACAAAGGCATGGAGG - Intronic
1030047730 7:105512554-105512576 CAGCATGTGCAAAGGCATGGGGG + Intronic
1030097077 7:105909943-105909965 CCACTTGAGCAGAGGCAGGGAGG + Intronic
1030167731 7:106571588-106571610 CACCCTGAACATGGGCAGGGGGG - Intergenic
1030500898 7:110357078-110357100 GAGGATGAACAAAAGCAGGGTGG - Intergenic
1030797679 7:113809057-113809079 CAGCATGCAGAAAGGCAAGGAGG + Intergenic
1032879514 7:136074343-136074365 TAACAAGAGAAAAGGCAGGGTGG + Intergenic
1033718123 7:144024387-144024409 CAGCCTGAACAAAGACAAGGAGG - Intergenic
1034196528 7:149252609-149252631 CAAGATGACCAATGGCAGGGAGG - Intronic
1034294874 7:149963295-149963317 CAACAGGAAAAATGTCAGGGTGG - Intergenic
1034458721 7:151186477-151186499 GCACATGAACACAGGCAGTGTGG + Exonic
1034553631 7:151836495-151836517 CAACAACAACAAAGGCAAGGTGG + Intronic
1034811190 7:154133657-154133679 CAACAGGAAAAATGGCAGGGTGG + Intronic
1035506281 8:136962-136984 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1036760347 8:11504322-11504344 CAAAATAAAGAAAGGAAGGGAGG + Intronic
1037628283 8:20627942-20627964 CAGTATGAACCAAGGCATGGAGG + Intergenic
1037824151 8:22150974-22150996 CAGCATGAACGAAGTCAAGGAGG - Intronic
1038416401 8:27399348-27399370 CAGCATGTCAAAAGGCAGGGAGG + Intronic
1038491797 8:27976953-27976975 CAGCCTGGACTAAGGCAGGGGGG - Intronic
1039977561 8:42380330-42380352 CAACAAGAAGGAAGGGAGGGAGG + Intergenic
1041127564 8:54659605-54659627 CAACAGTAATAAAGGCAGTGTGG - Intergenic
1041675991 8:60540478-60540500 CAAAAAGAAGAAAGGGAGGGAGG - Intronic
1041828797 8:62128894-62128916 GAACTTGGAAAAAGGCAGGGTGG - Intergenic
1042489277 8:69380196-69380218 AAGAATGAAGAAAGGCAGGGTGG + Intergenic
1043587211 8:81783404-81783426 CAACAGGCACGAATGCAGGGAGG - Intergenic
1044213405 8:89578869-89578891 CAACATGAACAAAAGCATCAAGG + Intergenic
1044274791 8:90286431-90286453 CACCAGGAAAAAAGGGAGGGAGG - Intergenic
1044587952 8:93885389-93885411 TAACATGAACAAAGGCAGAGGGG + Intronic
1044675185 8:94720942-94720964 CAAAAAAAAAAAAGGCAGGGGGG - Intronic
1045480537 8:102588079-102588101 CAGCATGAACAAAGACATAGAGG + Intergenic
1045901068 8:107280601-107280623 TAGCATAAACAAAGGCATGGAGG + Intronic
1046090438 8:109497386-109497408 CAGTGGGAACAAAGGCAGGGAGG - Intronic
1046109239 8:109701972-109701994 CACCATGTACAAAGGCAGAGCGG + Intergenic
1046794336 8:118354416-118354438 TAGCATGAGCAAAGGCTGGGAGG - Intronic
1047037257 8:120953480-120953502 CCAAAAGAACAAAGGCAAGGAGG - Intergenic
1048196115 8:132333060-132333082 GAAGATGAACAAAGGAAGAGAGG + Intronic
1048245805 8:132797469-132797491 TAGCATGAGCAAAGGCAGAGAGG + Intronic
1048328269 8:133454992-133455014 CGACATGGAGAGAGGCAGGGGGG + Exonic
1048509599 8:135050285-135050307 CAACTTGAGTAAAGTCAGGGTGG - Intergenic
1049300578 8:141867377-141867399 CATCATCAACAGAGGCAGGACGG - Intergenic
1049740699 8:144239595-144239617 CAACCTGAAAAGAGGCAGCGTGG - Exonic
1050723169 9:8614423-8614445 CAAACTGAATACAGGCAGGGAGG - Intronic
1051103155 9:13546114-13546136 AAACATGAATATAGGCCGGGTGG + Intergenic
1052610619 9:30768928-30768950 CAGCATGGGCAAAGGCATGGGGG + Intergenic
1052937840 9:34108105-34108127 CAGCAAGAGCAAAGGCAGGGAGG - Intronic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1053287317 9:36858423-36858445 CCAAATGGACAATGGCAGGGTGG + Intronic
1053366778 9:37528434-37528456 CAGCATGAGCAAAGGCAGCAGGG - Intronic
1053462648 9:38282431-38282453 CAGCTTGAGCAAAGGCATGGGGG + Intergenic
1053465972 9:38308814-38308836 CAGCATGATCAAAGGCACAGGGG + Intergenic
1054261885 9:62875127-62875149 CAGCTTGAACTAAGGGAGGGAGG - Intergenic
1054853296 9:69871236-69871258 AATAATAAACAAAGGCAGGGAGG + Intronic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1055130115 9:72765521-72765543 CGGCATGCACAAAGGCATGGAGG + Intronic
1055422217 9:76155884-76155906 CAGCCTGGACAAAGGCAGTGGGG + Intronic
1056456274 9:86764002-86764024 CAGCATGAGCAAAGGCACAGAGG + Intergenic
1056521421 9:87405208-87405230 CAGCATGAACCAAGGCACAGAGG - Intergenic
1056888527 9:90467986-90468008 CAACTTCAACAAAGACAAGGGGG - Intergenic
1057561639 9:96132644-96132666 CAACATGAACAAAGGCATGGAGG - Intergenic
1058086737 9:100755798-100755820 CAGCAAGAGCAAAGGCATGGAGG - Intergenic
1058739411 9:107928363-107928385 CAACATTAACAAAAACATGGAGG - Intergenic
1059323347 9:113486327-113486349 AAGCATGAGCAAAGGCAAGGAGG + Intronic
1059454369 9:114390236-114390258 GTGCATGAGCAAAGGCAGGGAGG - Intronic
1059598787 9:115753205-115753227 CTATGTGAATAAAGGCAGGGTGG - Intergenic
1060775741 9:126372891-126372913 CAACACGAGCAAAGGCAGGGAGG + Intronic
1060786110 9:126452675-126452697 CAGCAAGATCAAAGGCATGGGGG - Intronic
1061105008 9:128523257-128523279 CTGCATGAAAAATGGCAGGGAGG - Intronic
1061145402 9:128795028-128795050 TAACATGCACAAACACAGGGTGG - Intronic
1062341939 9:136097605-136097627 CAACAAGATCAAATGCAGGGAGG - Intergenic
1203602027 Un_KI270748v1:20368-20390 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1185805124 X:3050145-3050167 CAACATGATCAAAGGTTGGGTGG + Intronic
1186105157 X:6197735-6197757 CAACATGAACTAAAGCAGAAAGG + Intronic
1186594996 X:10971285-10971307 CAGCATTTACAAAGGCAGTGGGG - Intergenic
1186693241 X:12002277-12002299 CTACATGAACAGAAGCAGGCCGG - Intergenic
1186818363 X:13260486-13260508 TAACATGGACAAAGGCTGGGAGG - Intergenic
1187580540 X:20603011-20603033 CAGCATGAACAAAAGCATGCCGG - Intergenic
1187958739 X:24546679-24546701 CAACATGTTCTAAGGCATGGAGG - Intergenic
1189398797 X:40646698-40646720 CATCATGAGCACAGGCAGGGAGG - Intronic
1189795233 X:44639642-44639664 GAACATGAACAAAGACAGTCTGG + Intergenic
1190481932 X:50885744-50885766 CAGCATGAGAAATGGCAGGGAGG + Intergenic
1190829307 X:54045708-54045730 CAACGTGTACAAATGCATGGAGG + Intronic
1190940468 X:55035458-55035480 CAATATCAACAAAATCAGGGAGG + Intergenic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1192592501 X:72372049-72372071 CAACATGACCAAAAGCCAGGTGG - Intronic
1193534905 X:82702139-82702161 TTGCATGAACAAAGGGAGGGTGG - Intergenic
1194975377 X:100390858-100390880 CAAAATGAGCAGAGGCATGGTGG + Intronic
1195100282 X:101549204-101549226 CACCATGAATAAGGGCAGAGGGG + Intergenic
1195302182 X:103541199-103541221 CAATTTGAACACAGGCAGTGTGG - Intergenic
1195929422 X:110059353-110059375 CAACAGTAACAAAGACAGTGTGG - Intronic
1196535674 X:116840825-116840847 TAACATGAATGAAGGCATGGTGG + Intergenic
1196537891 X:116868582-116868604 GAAAATGAAGAAAAGCAGGGTGG - Intergenic
1196562394 X:117166097-117166119 CAACGTTAATAAAGGCATGGAGG + Intergenic
1197626922 X:128812500-128812522 CAATATGAAGAAAGTCATGGAGG - Intergenic
1198281362 X:135146025-135146047 CAATAGGCACCAAGGCAGGGTGG - Intergenic
1198289597 X:135226491-135226513 CAATAGGCACCAAGGCAGGGTGG + Intergenic
1198475066 X:136988145-136988167 CATCATGAGCAAAGGCACGATGG - Intergenic
1198775038 X:140170618-140170640 GAGCATGAACAAAGACAGGAGGG + Intergenic
1198775738 X:140177155-140177177 TAGCATGTACAAAGGCAAGGAGG + Intergenic
1198946160 X:142016982-142017004 GATCATGAACAACGGGAGGGAGG - Intergenic
1199886008 X:152022583-152022605 TAACAAGAGCAAAGGCATGGTGG - Intergenic
1200219013 X:154381471-154381493 CCACAAAAACAAAGTCAGGGTGG - Exonic
1200243329 X:154508922-154508944 CAACCTGAGCAAAGGCAGTGTGG + Intronic
1201250436 Y:12052416-12052438 CCAAGTGGACAAAGGCAGGGAGG - Intergenic
1201276139 Y:12300460-12300482 CAACATGATCAAAGGTTGGGTGG - Intergenic
1201751079 Y:17432738-17432760 CAACAACCTCAAAGGCAGGGAGG - Intergenic