ID: 973724723

View in Genome Browser
Species Human (GRCh38)
Location 4:53763913-53763935
Sequence CTGCTGTCACTGTGCACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973724723 Original CRISPR CTGCTGTCACTGTGCACCAC AGG Intronic
900154612 1:1198935-1198957 CTGCTGTCCCTGTGGAGCGCAGG - Intergenic
902196981 1:14805068-14805090 TTGCAGTCACTTTGCACAACAGG - Intronic
902232922 1:15039483-15039505 CAGCTGTCCCTGTGAACCATGGG + Intronic
902463960 1:16603148-16603170 CTGCTGTCAGTGAGAACAACAGG - Intronic
906220957 1:44078887-44078909 AGGGTGTCACTGTGCTCCACTGG - Intergenic
907130475 1:52092997-52093019 ATACTGTCACTGTACATCACTGG - Intergenic
908289710 1:62652108-62652130 CTGCTGTCACTGTGCACACATGG + Intronic
908580004 1:65505012-65505034 GTGCTGTCAACGTGCAGCACTGG + Intronic
913472074 1:119198212-119198234 CTGCTTTTGCTGTGCTCCACAGG - Intergenic
914453005 1:147810020-147810042 CTGTTTTCACTGTGGAGCACAGG + Intergenic
915895741 1:159809417-159809439 CTGTGCTCACTCTGCACCACGGG + Exonic
917017305 1:170547458-170547480 CTACTGCTACTGTTCACCACTGG + Intronic
917620783 1:176793626-176793648 CTGCTGACACTCTGGAGCACTGG + Exonic
919773619 1:201178977-201178999 CTGCTGTAACAGAACACCACAGG - Intergenic
920011836 1:202873701-202873723 GTGCTGTCCCTGTACACCTCTGG + Intergenic
921030870 1:211334207-211334229 CTGCTGTCACAATGCACTGCTGG - Intronic
921266964 1:213428877-213428899 CTGGTGTCAATGTGCACATCTGG + Intergenic
921577688 1:216855956-216855978 AGGCTATCACTGTGCAGCACTGG - Intronic
921581673 1:216902879-216902901 TAGCAGTCACTGTGAACCACAGG - Intronic
922252707 1:223864416-223864438 CTGCTGTCCCTGTACGCCTCTGG - Intergenic
1063715286 10:8520790-8520812 CTGCTGTAACAATGTACCACGGG + Intergenic
1065467460 10:26040034-26040056 CTGCTGTCACTGTATTCCATAGG + Intronic
1066321594 10:34308373-34308395 CCGCTGTTACTGTGCCCCAGTGG - Intronic
1070503335 10:77091586-77091608 CTCCTGTCCCTGTGCCCCCCAGG + Intronic
1072446221 10:95501053-95501075 TTGCTGCCACTGTGCAGAACTGG - Intronic
1076383958 10:130044194-130044216 CTCCTATCACAGTGCACCAGTGG - Intergenic
1078244235 11:9558936-9558958 CTGCTTTCACTGTATCCCACAGG + Intergenic
1081383728 11:42446503-42446525 CTGCTGTCACTGTGCATCTCAGG - Intergenic
1084553141 11:69860913-69860935 CTGGAGTCACGGTGGACCACTGG - Intergenic
1084738396 11:71121008-71121030 ATGCTGTGTCTGTGCAGCACGGG + Intronic
1086165910 11:83777697-83777719 TTGCTGTCTCTGTGTACCATGGG - Intronic
1087589282 11:100165277-100165299 CTGCTTTCACTGTACTCCAGTGG + Intronic
1089908475 11:122071036-122071058 CTGCTGTCCCTTTACACCGCAGG + Intergenic
1090317995 11:125813972-125813994 CTGCTTTCACTGTATCCCACAGG + Intergenic
1093419722 12:18961349-18961371 CTGCTTTCACTGTACCCCATAGG + Intergenic
1094380466 12:29837399-29837421 CTGCTTTCACTGTATCCCACAGG + Intergenic
1099305885 12:80955324-80955346 ATACTGTCACTGAGCACTACGGG - Intronic
1101315252 12:103623161-103623183 CAGGTGCCACTGTGAACCACTGG + Intronic
1102475677 12:113186720-113186742 CTGCTGTCACCAGGGACCACAGG + Exonic
1105424788 13:20284998-20285020 CTGCTGCAAATGTGGACCACTGG + Intergenic
1105624249 13:22097956-22097978 TTCCTGTCACAGTGCACAACTGG - Intergenic
1105661077 13:22496000-22496022 CTGCTGTCACTGTGCGAGTCAGG + Intergenic
1105983056 13:25538442-25538464 CAGCTATCAATGTGCAGCACTGG - Intronic
1106078045 13:26477571-26477593 CTCCTTACACTGTGCACCCCAGG - Intergenic
1106643146 13:31607149-31607171 CTGCTGTAACAGTGTACCATGGG - Intergenic
1106645747 13:31631918-31631940 CTTCTTTCATTGTGCTCCACAGG + Intergenic
1108163139 13:47663822-47663844 CTGTGGGTACTGTGCACCACAGG - Intergenic
1108314423 13:49223442-49223464 CTGCTGTCACTCAGCTCCAAAGG + Intergenic
1112329861 13:98469135-98469157 CTGCACGCAGTGTGCACCACGGG + Intronic
1113491955 13:110699213-110699235 CTGCTGTAACAGAACACCACAGG - Intronic
1115407372 14:33032692-33032714 GTGCTACCACTGTGGACCACTGG - Intronic
1116355095 14:43918090-43918112 CTGCTTTCACTGTATCCCACAGG - Intergenic
1116486031 14:45449968-45449990 CTGCTTTTACTGTGTTCCACAGG + Intergenic
1117019256 14:51552508-51552530 CTGCAGTCACTCTGCAAAACTGG + Intronic
1117634493 14:57727551-57727573 CTGCTTTCACTGTGTCCCATAGG + Intronic
1119984815 14:79125559-79125581 CTGCTCTCACACTTCACCACTGG + Intronic
1120033966 14:79674497-79674519 CTGTGGTCACTGTCCACCAAGGG + Intronic
1121645507 14:95515313-95515335 TTCCTGTCACTGTGCCCCAGCGG - Intergenic
1122662772 14:103309227-103309249 CAGCTGTCACTCTGCACAACTGG + Intergenic
1124215669 15:27805725-27805747 CAGCGCTCACTGTGCACCTCTGG - Intronic
1124606087 15:31171302-31171324 CTGCTGTGACTAAGGACCACAGG + Intergenic
1125979784 15:43989746-43989768 GTGCTGTCCCTGTACACCTCTGG - Intronic
1126571847 15:50160538-50160560 CTGCTTTCACTGTATCCCACAGG + Intronic
1128108083 15:65058890-65058912 TGGCTGTCCCTGGGCACCACTGG + Intronic
1128547273 15:68576862-68576884 CTTCTCTCACTGTGTACCCCTGG - Intergenic
1129906617 15:79192084-79192106 CTGCTGCCACTGTGCAGGCCTGG + Intergenic
1132471435 16:105840-105862 ATGCTGTCACTGAGGGCCACTGG + Intronic
1133265746 16:4582612-4582634 GTGCTCAGACTGTGCACCACTGG + Intronic
1133746547 16:8691417-8691439 CTGCTGCAACTGTGCTCCCCAGG + Intronic
1134394258 16:13848562-13848584 ATGCTGTCACTGTGGAACACTGG - Intergenic
1136993715 16:35173453-35173475 TGGCTGTGACTGTGCCCCACAGG - Intergenic
1138378535 16:56583987-56584009 GTGCAGTCACTGTGAGCCACAGG - Intergenic
1139958152 16:70703066-70703088 CTGCTGTGAGTGGGCACCAGGGG + Intronic
1140551156 16:75867374-75867396 CTGCTGCTGCTGTGCACCACTGG + Intergenic
1141255830 16:82401666-82401688 CTGCTGTCAATTTGGGCCACAGG - Intergenic
1143414000 17:6732514-6732536 CTGCTTTCACTGTATCCCACAGG - Intergenic
1145255969 17:21322584-21322606 CTGCTGGCCCTGGGCACCACAGG + Intergenic
1145312481 17:21708171-21708193 CTCCTGGCACTGGGCACCAGCGG - Intergenic
1145320652 17:21765361-21765383 CTGCTGGCCCTGGGCACCATAGG - Intergenic
1147381911 17:40061378-40061400 CAGCTGCCACTGCACACCACAGG + Intronic
1150013802 17:61532808-61532830 CTCCTGTAACTCAGCACCACAGG - Intergenic
1150156348 17:62856961-62856983 CTGCTGTCTTTGTGCCCTACTGG - Intergenic
1150583953 17:66500690-66500712 TAGCTGTCAATGTGCTCCACTGG - Intronic
1150599065 17:66634583-66634605 CTTTTATCACTGTGCACCAAAGG - Intronic
1150977545 17:70105484-70105506 TTGCTGTCACTTTGCAACAGTGG - Intronic
1151142158 17:72003984-72004006 CTGCTGGCACTCAGCACCATGGG - Intergenic
1152103492 17:78316065-78316087 GTCCAGGCACTGTGCACCACGGG + Intergenic
1152343594 17:79738380-79738402 CTGCCATCTCTGTGCTCCACTGG + Intronic
1152387442 17:79983367-79983389 CTCCTGTCCCTCTGCACCAAAGG + Intronic
1152512647 17:80800980-80801002 CTGCTGTCCCTGGGCCACACGGG - Intronic
1155062269 18:22239119-22239141 CTGCAGGCACATTGCACCACTGG + Intergenic
1155149067 18:23108109-23108131 CTGTTGTAAATGTGCACCCCTGG + Intergenic
1155325069 18:24656942-24656964 CAGATGGCACTGTGGACCACAGG - Intergenic
1156022474 18:32615869-32615891 CTGCTGTCCATGTGATCCACTGG + Intergenic
1158468906 18:57717152-57717174 CTGCTTTCACTGTGTCCCACAGG - Intronic
1161328025 19:3672781-3672803 CTGCTGTCACAGTGCCCTGCAGG - Intronic
1161826552 19:6570495-6570517 CTGCTTTCACTGTACCCCATAGG + Intergenic
1162005544 19:7776241-7776263 CGGCAGTAACTGAGCACCACTGG - Intergenic
1202679618 1_KI270711v1_random:40588-40610 CTGCTGTCAGTGAGAACAACAGG - Intergenic
925426395 2:3751933-3751955 CAGCTGTGACTGTGCAGGACAGG - Intronic
925788087 2:7452603-7452625 CTGCTGTTATTGTAGACCACAGG - Intergenic
926316173 2:11711868-11711890 GAGCAGTCACTGTGCACCACTGG - Intronic
927484655 2:23480162-23480184 CTCCGGTCAATGTGCACCAAGGG - Intronic
928376175 2:30776529-30776551 TTGCTGTAACTGAGCACCTCTGG - Intronic
928483959 2:31711030-31711052 CTGCTGTGACAGGGCAGCACTGG - Intergenic
930048544 2:47194983-47195005 TTGCTGTCACTGTCCACCTGGGG - Intergenic
932128921 2:69169760-69169782 CAGCTGTCACTGGTCCCCACGGG - Intronic
935832909 2:107019117-107019139 GTGCTATCACTGTGGGCCACGGG - Intergenic
936939478 2:117869713-117869735 CTGCTTTCACTGTGTTCCATAGG + Intergenic
938282574 2:130074935-130074957 GTGCTGTCCCTGTACACCTCTGG - Exonic
938333201 2:130463507-130463529 ATGCTGTCCCTGTACACCTCTGG - Exonic
938356611 2:130657164-130657186 ATGCTGTCCCTGTACACCTCTGG + Exonic
939941445 2:148356420-148356442 CTACTGTCACTCTCCCCCACTGG + Intronic
943301968 2:186213995-186214017 CAGCTGTCACTGAGCAGCATGGG + Intergenic
943596149 2:189859479-189859501 CTGCTGTCACAGAGCTCCATAGG - Intronic
947004683 2:225497287-225497309 GTGCTGTCTCTATGCACAACAGG - Intronic
948006170 2:234609583-234609605 CAGCTGTCTCTGCGCACCAATGG + Intergenic
948076974 2:235172517-235172539 CTGTTGTCACTCTCCACCCCTGG + Intergenic
948741869 2:240053651-240053673 CTTCTGTCGCTGTGCACCTCGGG + Intergenic
948859197 2:240744765-240744787 CTTCTGTCACAAAGCACCACAGG - Intronic
1171232696 20:23500304-23500326 CTGCTGTCCCTGTGGTCCGCAGG - Intergenic
1171377057 20:24700723-24700745 CTGCTGTCCCAGTCCACCCCTGG + Intergenic
1175598688 20:60255571-60255593 CTGCTGCCACTGTGCACCACGGG - Intergenic
1175786618 20:61716068-61716090 TTGCTGTCACTGTGCTCGGCTGG + Intronic
1176676866 21:9786811-9786833 CTGCATTCACTGGGCACCCCAGG - Intergenic
1177183088 21:17764727-17764749 CTGATGTCACTAAGAACCACTGG - Intergenic
1180023881 21:45147627-45147649 GTGCTGTTCCTGTGCACCCCCGG - Intronic
1180652551 22:17390324-17390346 CTGCTGATACTATGCACCAAGGG - Intronic
1181421407 22:22801579-22801601 CTCCTGTCACTGGGCATCTCAGG - Intronic
950695232 3:14695149-14695171 CTGCTTTCACTGTATCCCACAGG + Intronic
951063515 3:18237743-18237765 CTGCTCACACTGTGGAGCACTGG - Intronic
951259636 3:20492193-20492215 CTGCTTTCACTGTATCCCACAGG + Intergenic
953369408 3:42374694-42374716 CTCCTGTCACTTGGCACCAGTGG - Intergenic
955237175 3:57149823-57149845 CAGCTGTCACCAGGCACCACAGG + Intronic
956026474 3:64987966-64987988 CTGCTGTTACAGTGCTCAACTGG + Intergenic
956624739 3:71256298-71256320 CTGCTGTCCCTGAGCTCTACAGG - Intronic
961000255 3:123369341-123369363 TTGCTGTAACTGAACACCACAGG - Intronic
965347956 3:167575469-167575491 GGGCTGCCACTGTGAACCACTGG + Intronic
965980189 3:174681070-174681092 CTGCTGTGACAGGGCACTACTGG - Intronic
967971518 3:195003100-195003122 CTCCTGGGACTGTGCAGCACGGG + Intergenic
969298306 4:6282259-6282281 CTGGGGTCACCCTGCACCACAGG - Intronic
970209758 4:13696939-13696961 CTGCTGTCAGGGTGCACAACTGG + Intergenic
970479683 4:16460360-16460382 CAGCTGTCCCTGAGCTCCACAGG - Intergenic
971255143 4:25007777-25007799 CAGCTGTCCATGTGCACCAGGGG - Intronic
972934198 4:44112059-44112081 CTGCTTTCACTGTATACCATAGG + Intergenic
973724723 4:53763913-53763935 CTGCTGTCACTGTGCACCACAGG + Intronic
975630068 4:76391508-76391530 CTGCTTTCACTGTATACCATAGG - Intronic
979340251 4:119514112-119514134 CTGCTGTCAGTGAGCACTAATGG + Intronic
981645324 4:146991907-146991929 CTGCTCTCACTGGGGACCTCTGG - Intergenic
982930988 4:161407526-161407548 CTACTCTCACTGTGGACCTCTGG + Intronic
985398673 4:189571972-189571994 CTGCATTCACTGGGCACCCCAGG + Intergenic
993048234 5:82893489-82893511 TTCCTGTGAATGTGCACCACAGG - Intergenic
998223224 5:140305074-140305096 CACCTGTCACAGTGCATCACGGG + Intergenic
1000914646 5:167065942-167065964 CTGCTGTCACTTTGTAGCTCTGG + Intergenic
1002576977 5:180179412-180179434 CTCCACTCCCTGTGCACCACTGG - Intronic
1002993855 6:2264454-2264476 CTGCTATGACTATGTACCACAGG - Intergenic
1005166148 6:22923367-22923389 CTGGTGTCACTGCTCACCATTGG + Intergenic
1007513334 6:42391516-42391538 CTGCTGAGACTGTTCACCAGAGG - Intronic
1008223193 6:48878761-48878783 ATGATGTCACTGAACACCACTGG + Intergenic
1008642127 6:53474799-53474821 CTGCTGTGACAGGGCAGCACTGG + Intergenic
1009710508 6:67311624-67311646 CTGCTTTTACTGTATACCACAGG + Intergenic
1012045700 6:94270223-94270245 CTGTTGCCACTGAGAACCACGGG + Intergenic
1012628265 6:101431021-101431043 ATGCTGTCCCTGTACACCTCCGG - Intronic
1018380416 6:163253856-163253878 CTGCAGTCACTGAGTGCCACTGG + Intronic
1019281077 7:200524-200546 CTGCTGTCTCTGCTCAGCACGGG - Intronic
1019538061 7:1539034-1539056 GTGCTGTGACTGTCCACCCCGGG + Intronic
1019950821 7:4370901-4370923 CTGGGGTCACTGGGCAGCACGGG + Intergenic
1021484319 7:21150058-21150080 CTTCTGTAACTGAGCACCATTGG + Intergenic
1022379370 7:29845318-29845340 CTGCTGTCACTGAGCTCAAGGGG - Intronic
1023862114 7:44222951-44222973 CTGCTGTCACTGTGCAGCAGGGG - Intronic
1024049420 7:45609411-45609433 CTGCTGGCACTGAGCACGACAGG + Intronic
1026024143 7:66731857-66731879 CTGCTTTCACTGTGCACCTTGGG - Intronic
1028906626 7:96161540-96161562 CAGCTGTAACAGTGCAACACAGG + Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030060594 7:105618011-105618033 CTGCTGTCACTGAGCAACATTGG - Intronic
1030390609 7:108922900-108922922 CTGCTGTCACTGTATCCCATAGG + Intergenic
1031090644 7:117349647-117349669 CTCCTTTCACTGAGCACCATAGG + Intergenic
1034416344 7:150966182-150966204 CAGCTGCCACTGTCCACCAGGGG + Intronic
1034926324 7:155125252-155125274 CTGAAGTCACTGTGTGCCACGGG + Intergenic
1035835946 8:2751878-2751900 CTGTTGTAACAGTGCACCACAGG - Intergenic
1037922094 8:22814655-22814677 CTGTGGTCATTGTGAACCACAGG + Intronic
1037991090 8:23321673-23321695 CTGCTGCCACTGAGAACCAAAGG - Intronic
1039390884 8:37179992-37180014 CAGGGGTCACTGTGCACCAGCGG + Intergenic
1039491210 8:37948765-37948787 CTGTTGGCTCTGTACACCACTGG - Intergenic
1041313931 8:56542512-56542534 CTGCTGTCACTGAGTCCCACCGG - Intergenic
1042041388 8:64594245-64594267 CTGCTGACAGTGTCCATCACTGG + Intronic
1043045613 8:75319928-75319950 CTGCAGTCATTGAGCAACACAGG + Intergenic
1044845374 8:96375161-96375183 CTGCTTCCACTGAGAACCACTGG - Intergenic
1045256367 8:100527067-100527089 CTGATGTCACTGGGCTCAACAGG - Intronic
1045426666 8:102073853-102073875 TTGCTGTCTCTTTTCACCACAGG + Intronic
1045809506 8:106205000-106205022 CTGCTGTCACTGGGGAGCATTGG - Intergenic
1048192974 8:132307228-132307250 ATGGTGTCACTGTGGAACACAGG - Intronic
1048446192 8:134495140-134495162 CTGCTGTCACAAAGCAGCACAGG + Intronic
1049361656 8:142214922-142214944 CTGCTGTAACCAAGCACCACAGG - Intronic
1050570437 9:6932632-6932654 CTGCTTTGGCTGTGCACCAGGGG - Intronic
1050686913 9:8181741-8181763 CTGCTGTCATGGTGCATCAATGG + Intergenic
1055693348 9:78857453-78857475 CTCCTCTCACTGTGCTCCACTGG - Intergenic
1056146414 9:83734932-83734954 CTGCTTTCACTGTGTCCCATAGG + Intergenic
1058897303 9:109411438-109411460 CTGCTGTCACTGTACAGGACAGG + Intronic
1061040267 9:128137620-128137642 CTCCTGTTTCTCTGCACCACCGG + Intergenic
1061222078 9:129258162-129258184 CTGCTGTTACTGGTCACCTCTGG + Intergenic
1061505643 9:131030421-131030443 TTGCTGTCTCTGGGCCCCACTGG + Intronic
1062723052 9:138054382-138054404 CTGCTGTCACTGTCCACATGAGG + Intronic
1187424948 X:19168899-19168921 CTGCTGTCACAAAACACCACAGG - Intergenic
1191949940 X:66578859-66578881 CTGCTTTCACTGTATCCCACAGG + Intergenic
1199084787 X:143616097-143616119 CTGCTGTCGCTCAGCAACACTGG + Intergenic
1199870456 X:151893832-151893854 CTACTGCCACTCTTCACCACCGG + Intergenic
1200753425 Y:6967887-6967909 CTGCTGTAACAGAGCACCACGGG + Intronic
1201143138 Y:11044917-11044939 ATGCTGTGTCTGTGCAGCACGGG + Intergenic