ID: 973726486

View in Genome Browser
Species Human (GRCh38)
Location 4:53782127-53782149
Sequence CTCTTTACTTAGTTTAGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973726486_973726489 7 Left 973726486 4:53782127-53782149 CCTTACCTAAACTAAGTAAAGAG 0: 1
1: 0
2: 0
3: 14
4: 187
Right 973726489 4:53782157-53782179 CATAGAAAATGCTAAACATCTGG 0: 1
1: 0
2: 1
3: 27
4: 286
973726486_973726490 19 Left 973726486 4:53782127-53782149 CCTTACCTAAACTAAGTAAAGAG 0: 1
1: 0
2: 0
3: 14
4: 187
Right 973726490 4:53782169-53782191 TAAACATCTGGCATAATTTCTGG 0: 1
1: 0
2: 2
3: 44
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973726486 Original CRISPR CTCTTTACTTAGTTTAGGTA AGG (reversed) Intronic
904879344 1:33683436-33683458 TTCTTTACTTATTTTTGGAAAGG + Intronic
908103678 1:60817661-60817683 CTATTTACTTAGATTTGCTAAGG - Intergenic
908651219 1:66335433-66335455 ATCTTTACTTCATCTAGGTAGGG + Intronic
910063560 1:83123947-83123969 CTATTTACTTATTTTAACTAGGG + Intergenic
910367335 1:86480222-86480244 CTTTTTATTTAGTTTATGTTTGG - Intronic
912026141 1:105176622-105176644 ATCTTGACTTAGTTTTGGAAAGG - Intergenic
912328433 1:108792905-108792927 CTCTTTACTTTGTCTAGATCAGG + Intronic
919187229 1:194168193-194168215 CTCATTAATTAGTTTAGTTTAGG - Intergenic
921130941 1:212219267-212219289 CTCTTTTCTTTGTGTAGGTTTGG - Intergenic
921586287 1:216949770-216949792 CTCTTTTACTAGTTTAGGGAGGG + Intronic
924075678 1:240333367-240333389 CCCTTTACTTAGTATTGGAATGG + Intronic
924496279 1:244593315-244593337 CCCATGACTTTGTTTAGGTAAGG - Intronic
1063951956 10:11231660-11231682 CTGTTTACTTAGTTTGTATATGG + Intronic
1064709945 10:18112764-18112786 TTCTTTAGGTAGTTTAGGGATGG - Intergenic
1066192072 10:33065210-33065232 CTCTTTACATATTTTAAGTCTGG + Intergenic
1067423406 10:46179712-46179734 GTCTGTACTTGGTTTAGTTATGG + Intergenic
1068346958 10:55793603-55793625 ATCTGTACTTGGTTTAGTTATGG - Intergenic
1068585307 10:58791796-58791818 TTCTTTTTTTAGTTTAGGTGAGG + Intronic
1069193100 10:65514532-65514554 CTTTTTACTCAGTTTAGCTTTGG + Intergenic
1070015492 10:72525702-72525724 CCCTTTACTCAGTTTAAGAAAGG - Intronic
1070877990 10:79832815-79832837 ATCTGTACTTGGTTTAGTTATGG - Intergenic
1071092842 10:81939656-81939678 CTTTTTTCTTAGTCTAGCTAAGG + Intronic
1071644488 10:87348858-87348880 ATCTGTACTTGGTTTAGTTATGG - Intergenic
1074552491 10:114457658-114457680 CACATTACTTTGTTTAAGTAAGG - Intronic
1080203383 11:29700465-29700487 CTCCTTACATATTTTAAGTATGG - Intergenic
1080915007 11:36648500-36648522 CTTTTGAATTAGTTGAGGTAAGG + Intronic
1081116025 11:39202315-39202337 TTGTTTACTTATTTTAGATATGG + Intergenic
1081467196 11:43332230-43332252 CTATTTACTTACTTGATGTATGG - Intronic
1082200973 11:49366797-49366819 CTGTTTACATAGATTAGGTAGGG - Intergenic
1084511913 11:69611203-69611225 CTATGTACTTTGTTTAAGTAAGG + Intergenic
1086654700 11:89339408-89339430 CTGTTTACATAGATTAGGTAGGG + Intronic
1087353526 11:97063813-97063835 CTCTCTTCTTAGTTTAGCTAGGG - Intergenic
1087862352 11:103175417-103175439 ATCTTTACTTATTACAGGTATGG - Intronic
1090194897 11:124806494-124806516 CTTTTTACTCATTTTAGCTAGGG - Intergenic
1093314781 12:17634902-17634924 CACTTTTCTTAGTTTAGCTTAGG - Intergenic
1093676674 12:21948913-21948935 CTTTTTTCTTAGTATAGCTAAGG - Intergenic
1094745359 12:33338371-33338393 ATCTTTACTTAATTATGGTACGG - Intergenic
1095749449 12:45695045-45695067 CTCTTTACATATTTTAAGTTCGG + Intergenic
1096902152 12:54895419-54895441 GTCTTTATTTAGTTTATGTTCGG - Intergenic
1098766264 12:74493945-74493967 CTTTGTACTTATTTTAGTTAGGG - Intergenic
1099544907 12:83966578-83966600 CTCTTTTTTTAGTCTAGGTAAGG - Intergenic
1099768245 12:87018897-87018919 TTTTTTTCTTAGTTTAGATAAGG - Intergenic
1104574537 12:129955045-129955067 CTCTTTATTTAGTTTAACTTTGG - Intergenic
1108887055 13:55199631-55199653 CTCTTTCCCTAGTTTGGGTCGGG + Intergenic
1109526512 13:63582451-63582473 TTCTATACTTAGAATAGGTATGG - Intergenic
1109761648 13:66837572-66837594 CTCGTTACTTAATTTAGAGAAGG - Intronic
1109826155 13:67724716-67724738 CTCTTTACTTAGAATAGCTCTGG + Intergenic
1110948456 13:81454638-81454660 CACATTAATTAGGTTAGGTAAGG - Intergenic
1111164482 13:84441008-84441030 ATCTTCACTTAATTTATGTAAGG - Intergenic
1113273951 13:108707417-108707439 ATCTTTACGAAGTTTGGGTAAGG + Intronic
1115955816 14:38777810-38777832 CATTTTTCTTAGTTTAGCTAAGG - Intergenic
1116718649 14:48462659-48462681 CTATTTATTTATTTTAGGCAGGG - Intergenic
1118909294 14:70047808-70047830 TTCTTTACTTAATTCAGTTAGGG - Intronic
1123930002 15:25163219-25163241 TTCTTGACTTATTTTAGGTAAGG - Intergenic
1124993390 15:34698111-34698133 CTCCTTACATATTTTAGGTTTGG - Intergenic
1130858106 15:87859781-87859803 CTCCTGACATAGTTTATGTAGGG - Intronic
1132199458 15:99940145-99940167 CTTTTTACTTAGTCTAGCTAAGG + Intergenic
1135328082 16:21540305-21540327 CTATTTACTTATTTTAAGAAAGG - Intergenic
1136338435 16:29626329-29626351 CTATTTACTTATTTTAAGAAAGG - Intergenic
1137317499 16:47341890-47341912 CTCTTTACTTGTTATAGGTCTGG - Intronic
1137827419 16:51511247-51511269 TTCTTTATTTAGTTTAGAAATGG - Intergenic
1138850441 16:60622599-60622621 CTCCGTACTGAGTTTGGGTAGGG - Intergenic
1139067551 16:63336890-63336912 CTGTTTACTTATTTTTGGGATGG - Intergenic
1142041167 16:87895242-87895264 CTATTTACTTATTTTAAGAAAGG - Intronic
1142823252 17:2489271-2489293 CTCTTTAGTTAGCATAGGAATGG - Intronic
1143934994 17:10474463-10474485 ATCTTTATTTGGTTTTGGTATGG + Intergenic
1147517390 17:41133882-41133904 CTCTTTACATATTTTAGGCTTGG - Intergenic
1150118476 17:62577471-62577493 CTTTTTAGCTAGTTTAGGCAAGG - Intronic
1153930479 18:9874401-9874423 ATCTTTTCTATGTTTAGGTATGG - Intergenic
1155023876 18:21923305-21923327 CTATTTATTTATTTTAGGGATGG + Intergenic
1158450743 18:57562157-57562179 CTTTTGAGTTATTTTAGGTAGGG - Intronic
1165241590 19:34472844-34472866 ATCTTTACTTATTTTAGAGAGGG + Intergenic
926675967 2:15619960-15619982 CATTTTACTTAGTTTTTGTAGGG + Intronic
926905206 2:17799065-17799087 CTCTTAACTTGGTTTATGCATGG + Intronic
928382045 2:30826529-30826551 CTCCTTACATATTTTAGGTTTGG + Intergenic
928734099 2:34265677-34265699 CTCTTTGCTTAGTCTTGGTTTGG - Intergenic
929349533 2:40932523-40932545 TTCTTAATTTAGTTTAGGTATGG + Intergenic
930634716 2:53791647-53791669 GTCTTTCATTAGTTTAGGAAAGG - Intronic
931413245 2:62055296-62055318 CTTTTTACTTATTTTGGCTAGGG - Intronic
931853454 2:66276774-66276796 CTTTTTACTTAGATTGAGTATGG - Intergenic
932827369 2:74954136-74954158 CTCTTTACATAGTTTAAGTTTGG - Intergenic
933234401 2:79849255-79849277 ATATTTACATAGTTTTGGTATGG + Intronic
935637939 2:105264372-105264394 CTCTTTATTTAGACTAGGTATGG + Intronic
941332344 2:164194391-164194413 ATTTATACTTAGGTTAGGTAAGG - Intergenic
942857656 2:180569180-180569202 CTCCTTACTCAGTTTAAGTGGGG - Intergenic
943529880 2:189065999-189066021 GTCTTTACTTAGTGTGTGTATGG + Intronic
943561187 2:189464584-189464606 TTATTTACTTAGTATAGGCAAGG + Intronic
944151008 2:196558847-196558869 ATCCTTACTTAGTTTAGCTGGGG + Intronic
944265904 2:197726263-197726285 GGCTTTACTTAGTATATGTAAGG + Intronic
946966065 2:225039764-225039786 CTCTCCAATAAGTTTAGGTAAGG - Intronic
947429661 2:230015275-230015297 TTTTTTCCTTAGTTTAGCTAGGG - Intergenic
948127540 2:235575834-235575856 CTCTTTACTGAGATTGGGGAGGG + Intronic
1169552197 20:6712625-6712647 CTGTTTACTGAGTTTATCTAAGG - Intergenic
1169911951 20:10654226-10654248 CTCTTTAATTAGGTGAGGTTGGG - Intronic
1171158951 20:22904315-22904337 ATCTTTCCTTAGATTAGGTGCGG - Intergenic
1181449257 22:23007128-23007150 TTATTTACTTAGTTTAGAAATGG - Intergenic
1183239121 22:36642842-36642864 CTCTTTACTTAAATTTGCTATGG - Intronic
949496910 3:4640950-4640972 CTCCTTATTTATTTTAGCTAGGG + Intronic
953479136 3:43234375-43234397 CTGTTTACCCAGTTTAGATAGGG - Intergenic
954944194 3:54403743-54403765 CTCTTTTCTTAGTCTAGCTAAGG - Intronic
958576983 3:95963262-95963284 CTTTTTTCTTAGTTTAGCTAAGG - Intergenic
959223764 3:103555286-103555308 CTCTTTACTAAGATTAGTTTTGG - Intergenic
959227700 3:103606607-103606629 TTCTTTACTAATTTTAGGTTTGG - Intergenic
959274945 3:104266732-104266754 CTTTTTACTTAGTTTTGTTTTGG + Intergenic
961619697 3:128213915-128213937 CTCTTTACTTGGCTGAGGTTGGG - Intronic
961915270 3:130367840-130367862 TTCTATTCTTATTTTAGGTAAGG + Intronic
962289882 3:134125732-134125754 TTTTTTACTTAGTTTTGTTATGG - Intronic
962489272 3:135876267-135876289 CTTCTTAATTAGTTTAGCTAAGG - Intergenic
964221365 3:154349938-154349960 TTCTTTACTTATTTGAGATAGGG + Intronic
964545837 3:157832360-157832382 CTATTAAATAAGTTTAGGTAGGG + Intergenic
968455050 4:693422-693444 CTATTTACTTAGATGAGGGAGGG + Intergenic
970796765 4:19921918-19921940 CTCATCACTTAGTTTGGGTCTGG - Intergenic
971458139 4:26863158-26863180 CTCTATACTTATTTAAGGCATGG + Intronic
971506553 4:27372651-27372673 CTCTTGACTTAAATGAGGTAGGG + Intergenic
971885908 4:32447258-32447280 CTCTTTACTCATGTTAGGAAGGG + Intergenic
973726486 4:53782127-53782149 CTCTTTACTTAGTTTAGGTAAGG - Intronic
974922877 4:68264102-68264124 TTCTTTACTTACTGTAGGTCAGG - Intergenic
975676650 4:76833741-76833763 CTCCATTCTTAGTTTAGGGATGG + Intergenic
976133677 4:81912029-81912051 CTCTTTGCTTAGTTCATTTAGGG + Intronic
976459595 4:85294213-85294235 TTTTTTACTTAGTATAGCTATGG - Intergenic
976525313 4:86081000-86081022 CTCTGCACTTATATTAGGTAAGG - Intronic
977040098 4:92005082-92005104 CTCTTTGTTCAGTTTAGGGAGGG - Intergenic
979080851 4:116339129-116339151 CTTTTTTCTTAGTCTAGCTAAGG + Intergenic
980049537 4:128025208-128025230 CTTTTTATTTTGTTGAGGTAGGG + Intronic
980114581 4:128666932-128666954 CTCTTTAATTAGTTTGGGGCTGG - Intergenic
980160773 4:129159316-129159338 CTCTTTTGTTTGCTTAGGTACGG + Intergenic
982565486 4:156980613-156980635 TTGTTTCCTCAGTTTAGGTAAGG - Intergenic
982885464 4:160774726-160774748 GTTTTTCCTTTGTTTAGGTAGGG + Intergenic
982912035 4:161154723-161154745 CTGTTTACTTATTTTGGGCAGGG + Intergenic
983818915 4:172169023-172169045 CTCTTAAGTTAGTTTATGTTTGG + Intronic
987021850 5:13881928-13881950 TTTTTTACTTAGTCTAGCTAAGG - Intronic
988898401 5:35703119-35703141 CTCTTTATTTATTTTAGAAAAGG + Intronic
989318112 5:40105266-40105288 CACTTTACTTACTTTAGATTGGG + Intergenic
991038426 5:62151566-62151588 TTCTTTCCTTATTTTTGGTAGGG - Intergenic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
993203830 5:84852418-84852440 TTCTTTAAATAGTTTGGGTAAGG - Intergenic
993844604 5:92925009-92925031 TTATTTATTTAGTTTAGGTTTGG + Intergenic
993845938 5:92943388-92943410 TTATTTAGTTAGTTTGGGTAAGG + Intergenic
994879724 5:105474151-105474173 CTCTTCATTTAGTACAGGTATGG - Intergenic
995379939 5:111520509-111520531 CACTGTACTTAGTTTAGCTCTGG - Intergenic
995497638 5:112764336-112764358 TTATTTTCATAGTTTAGGTAGGG + Intronic
996380248 5:122855968-122855990 TTATTTACTTATTTTAGGTTCGG + Intronic
996591108 5:125148774-125148796 CTCTTTCCTGAGTCTAGGGATGG - Intergenic
999875619 5:155802426-155802448 CTATGTACTTAGTTTAGTTGGGG + Intergenic
1000601085 5:163275162-163275184 CTCTTTACATATTTTAAGTTTGG + Intergenic
1003616131 6:7656950-7656972 CTCTTTCCTGAGTTTTGGTGGGG + Intergenic
1005605266 6:27471097-27471119 GTCTTTACATTCTTTAGGTATGG - Intronic
1008109948 6:47481252-47481274 CTCTTTAATAATTTTAGATAAGG + Intronic
1008784741 6:55153891-55153913 CTCTTTTTTTAGTCAAGGTAAGG - Intronic
1009467115 6:63985299-63985321 CTCTTAACTCATTTTTGGTAAGG - Intronic
1009632797 6:66220708-66220730 CTCTTTTATGAGTCTAGGTAAGG + Intergenic
1010737899 6:79463520-79463542 CTCTTTACATAAATTAGGCATGG + Intergenic
1010866938 6:80987604-80987626 TTTTTTCCTTAGTCTAGGTAAGG - Intergenic
1011105362 6:83773770-83773792 CTCTTTAGTTTGATTAGATAAGG + Intergenic
1012182721 6:96175309-96175331 GTCTTTACTGAGTAAAGGTAAGG + Intronic
1012619552 6:101324325-101324347 ATCTTTAATTACTTTTGGTAGGG + Intergenic
1012927330 6:105280911-105280933 TTCTTTACTTAATTTAGAAAAGG + Intronic
1013857820 6:114595536-114595558 CTATTTAGTTTGTTTAGTTAGGG + Intergenic
1014651953 6:124050708-124050730 TTTATTCCTTAGTTTAGGTAGGG + Intronic
1015270302 6:131331331-131331353 TTCTTTACTTAGCATAGGTCAGG - Intergenic
1016673070 6:146731064-146731086 CTCTTTCCTTATTTTTCGTAGGG + Intronic
1016812937 6:148278563-148278585 CTTTTTAGTCAGTTTATGTAAGG - Intronic
1017111848 6:150940058-150940080 CTCTTTACCCAGTTTAGTCAAGG + Intronic
1017737314 6:157377209-157377231 CTCTTTACATATTTTAAGTTTGG - Intergenic
1020635276 7:10689226-10689248 CTTTTTGCTTAGTTTAGCTTTGG - Intergenic
1020677913 7:11202367-11202389 CTCTTTGCTTAGCGTAGGTTGGG + Intergenic
1021080242 7:16356015-16356037 TTCGTTACTTAGCTTAGCTAGGG - Intronic
1021134600 7:16949789-16949811 CACTTTACCTAATTTAGCTAAGG - Intergenic
1021417753 7:20407811-20407833 TGCTTTCCTTAGTTTAGGTCAGG - Intronic
1037467394 8:19173453-19173475 CTCTTTACATATTTTAAGTTTGG - Intergenic
1037552079 8:19984565-19984587 CTCTTTACTAAGTTAAAGAAGGG - Intergenic
1037643040 8:20765624-20765646 CTCTTTTCTTACTTTAGTTTTGG + Intergenic
1038207992 8:25487124-25487146 CTCTTTTTTTTGTTTAGATATGG + Intronic
1039405352 8:37307972-37307994 CTCCTCACTTATTTTATGTATGG + Intergenic
1042489050 8:69378295-69378317 CTCTTTACTGAGGGTAGGCAAGG + Intergenic
1042807507 8:72787499-72787521 CTTTTTAATTAGTATAAGTATGG + Intronic
1046033162 8:108807479-108807501 CTCTATACTTAATCTAGTTAAGG + Intergenic
1048415829 8:134226721-134226743 CTCTTTACATATTTTAAGTTTGG + Intergenic
1051752037 9:20352494-20352516 CTTTTTAGTTAGTATGGGTAAGG - Intronic
1052397965 9:27964111-27964133 CTCTCTACTTATTTATGGTAAGG + Intronic
1052733214 9:32313699-32313721 CTTTTTACTTAGTATAGCTTTGG - Intergenic
1053529367 9:38864037-38864059 CTTTTTTCTTAGTCTAGCTAAGG - Intergenic
1054201591 9:62088465-62088487 CTTTTTTCTTAGTCTAGCTAAGG - Intergenic
1054636767 9:67499894-67499916 CTTTTTTCTTAGTCTAGCTAAGG + Intergenic
1055084679 9:72301914-72301936 CACTTTTCTTTGTTGAGGTAGGG - Intergenic
1057993197 9:99794748-99794770 ATCTTTACTTATTTTGGGTTCGG + Intergenic
1058162544 9:101585446-101585468 CTCTTTACTTAGGTAATGAACGG + Intronic
1059622131 9:116018393-116018415 ATCCTTACTTAGTCTAGCTAAGG + Intergenic
1060842678 9:126805848-126805870 CTCTTTCCTGAGTTTGGGTGGGG + Intronic
1188246438 X:27840848-27840870 CCCTGTACTTAGTTTAGTTAAGG - Intergenic
1191101651 X:56736088-56736110 CTGTTTTGTTAGTTGAGGTAAGG + Intergenic
1191649056 X:63517077-63517099 GTCTTTAATTATTTCAGGTATGG - Intergenic
1191699295 X:64022213-64022235 CTCTTTCCTGAGCTTAGGGATGG + Intergenic
1191822965 X:65333136-65333158 ATCTTTACTTACTACAGGTAAGG + Intergenic
1193301243 X:79891638-79891660 CTCTTTCCTAAGATTATGTATGG - Intergenic
1194200327 X:90947025-90947047 TTCTTTACTTAGTACAGGTAAGG - Intergenic
1194861121 X:98999893-98999915 CAGTTTACTTAGTTTATGTTGGG + Intergenic
1196903892 X:120412825-120412847 CTCTTTACCTCTTTGAGGTAAGG + Intergenic
1197587935 X:128372714-128372736 CCCTTCCCTTAGTTTAGCTAAGG + Intergenic
1200108860 X:153728873-153728895 CTCTTTGCTTAGTTTAGGGGGGG + Intronic
1200382010 X:155847600-155847622 TTTTTTTCTTAGTTTAGCTAAGG - Intergenic
1200546324 Y:4523418-4523440 TTCTTTACTTAGTACAGATAAGG - Intergenic