ID: 973730189

View in Genome Browser
Species Human (GRCh38)
Location 4:53815642-53815664
Sequence GCCACAGAAGTCCTCAGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973730189_973730192 27 Left 973730189 4:53815642-53815664 CCCTATCTGAGGACTTCTGTGGC 0: 1
1: 0
2: 0
3: 16
4: 163
Right 973730192 4:53815692-53815714 TCGCCATCTAATGAAAGAAAGGG 0: 1
1: 1
2: 2
3: 25
4: 141
973730189_973730191 26 Left 973730189 4:53815642-53815664 CCCTATCTGAGGACTTCTGTGGC 0: 1
1: 0
2: 0
3: 16
4: 163
Right 973730191 4:53815691-53815713 GTCGCCATCTAATGAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973730189 Original CRISPR GCCACAGAAGTCCTCAGATA GGG (reversed) Intronic
901334012 1:8433154-8433176 AACACAGTAGTCCTGAGATAGGG - Intronic
902165584 1:14568760-14568782 CCCACAGAAGCCATGAGATAAGG + Intergenic
902452110 1:16503054-16503076 GCCTCTAAATTCCTCAGATAAGG + Intergenic
902686644 1:18081709-18081731 GTCTCAGCAGGCCTCAGATAGGG + Intergenic
903491087 1:23729118-23729140 GCCACAGAAGGTTTCAGAAAGGG - Intergenic
903544309 1:24114006-24114028 GCCACAGAAGAGCTTAGAAAGGG - Intergenic
904933440 1:34108815-34108837 GACACAGGAGTCCTGGGATAGGG + Intronic
906656525 1:47552326-47552348 GCCACAGAAGACCTCAGCCCAGG - Intergenic
906860255 1:49351700-49351722 TCCACAGAAGTCATGAGTTATGG + Intronic
914942033 1:152031610-152031632 GCCAAAAATGACCTCAGATATGG + Intergenic
916960842 1:169887299-169887321 AGCACAGAAGTCCTCAAAAATGG + Intronic
920078131 1:203351883-203351905 GCCATAGAATTCCTCAGCCAGGG + Intergenic
922928812 1:229373100-229373122 CCCACAGCACTCCTCAGACAGGG - Intergenic
1066097261 10:32084251-32084273 GCCACAGAAGAGCTCAGTTTTGG - Intergenic
1066268592 10:33799899-33799921 GCCAGGGAAGCCCACAGATATGG + Intergenic
1066497515 10:35956489-35956511 GCCCTGGAAGTCCTCAGCTAGGG + Intergenic
1066625163 10:37398559-37398581 GCCCTGGAAGTCCTCAGCTAGGG + Intergenic
1070102572 10:73402072-73402094 GCCACAGAAATCCCCTCATATGG + Intronic
1071960011 10:90801094-90801116 GCCACAGAACTCCTCTAAAAAGG + Intronic
1072662221 10:97370122-97370144 GCCTGAGAAGCCCTCAGATTAGG - Intronic
1076121016 10:127936546-127936568 TCCACAGGGGTCTTCAGATAGGG + Intronic
1077537006 11:3129261-3129283 GCCTCAGAAGTCCCCTGAGAGGG - Intronic
1079115098 11:17635563-17635585 GTCACAGCAGTCCTCTCATAGGG - Intronic
1079185786 11:18235312-18235334 GCCACAGGAGGGCTGAGATACGG - Intronic
1079448775 11:20581260-20581282 GGCACAGATGTCCTCACAAATGG + Intergenic
1080399582 11:31921729-31921751 GCAACAGCACTCCTCAGAAAGGG - Intronic
1080783984 11:35457987-35458009 GCCAAAGAAAGCCTCAGACAGGG + Intronic
1084472614 11:69372019-69372041 TCCACCCAAGCCCTCAGATACGG - Intergenic
1086219288 11:84421917-84421939 GCCACAGGAGGCCTCGGAGAGGG - Intronic
1088981679 11:114870251-114870273 GCCACTGAAGTCTTCAAGTAGGG + Intergenic
1090972722 11:131656757-131656779 GGCCCAGAAGTCTTCAGAGAGGG + Intronic
1092728508 12:11507452-11507474 GCCACAGAAGTGTTAAGATTAGG + Intergenic
1092797424 12:12126504-12126526 TACACAGAAGGCCTTAGATATGG - Intronic
1093078674 12:14784382-14784404 GCCCCAGTAGTCCTTAAATAAGG + Intergenic
1095604610 12:44052261-44052283 GCCAGAAAAGTCATGAGATATGG - Intronic
1098192193 12:67961141-67961163 GTCTCAGAATTCCTCAGATGGGG + Intergenic
1100810181 12:98330014-98330036 GTCACAGAAGCCTTCTGATATGG - Intergenic
1101887890 12:108683881-108683903 GCCACTGAATTCATCATATAAGG + Intronic
1102175999 12:110875191-110875213 GCCTCAGAATTCCTAGGATATGG + Intronic
1102502896 12:113364826-113364848 GCCACAGCAGTCCTCTGAAGGGG + Intronic
1103986808 12:124772854-124772876 GCCCCAGGAGTCCTGAGACAGGG + Intergenic
1105067080 12:133210238-133210260 CCTACAGGAGTCTTCAGATATGG + Intergenic
1109194559 13:59363814-59363836 ACCACAGAAGTTCTCAGAGAAGG + Intergenic
1112894481 13:104282161-104282183 GGCTGAGAAGTCCTGAGATAGGG - Intergenic
1113569328 13:111342807-111342829 GCCACAGAAGTCCAGCGAAAAGG + Exonic
1115310427 14:31973783-31973805 GCCACAGCCTTGCTCAGATATGG - Intergenic
1115364820 14:32546144-32546166 GCCACACAAGACCTCAGAAGAGG + Exonic
1116997504 14:51339337-51339359 GTCAGAGAAGACCTCAGATGAGG - Intergenic
1117802656 14:59461260-59461282 CCCACAGAAGTCTACAGGTAAGG - Exonic
1117807573 14:59510091-59510113 GCCACAGAACTCTCCAGATTAGG - Intronic
1119124155 14:72109823-72109845 CACACAGAAGACCTCAGATGTGG + Intronic
1124786565 15:32686940-32686962 GCCACACCAGTCCTCAGTTCTGG - Intronic
1128354022 15:66911719-66911741 GCCAGAGAAGTCCCCAGAGCTGG + Intergenic
1128474354 15:67984422-67984444 GGCACTGAAGTCCTAAGATGTGG - Intergenic
1129557147 15:76523377-76523399 ACCACAGAAGTACTGAGCTATGG + Intronic
1130354446 15:83117043-83117065 GGCACAGAAGTACTCAGAGGAGG + Intronic
1130805237 15:87314025-87314047 GCCACAGAAGTGCTAAGATTGGG + Intergenic
1130917665 15:88318598-88318620 GCAAGAGAAGCCCTCAGAAAGGG - Intergenic
1134354760 16:13471241-13471263 GCCACAGCAGTCCTGAAATATGG + Intergenic
1134800303 16:17078183-17078205 GCCACAGAAGCCCACTGATGCGG + Intergenic
1137440854 16:48497601-48497623 CCCACAGAAATGCTCAGACATGG - Intergenic
1139270314 16:65675901-65675923 GTCACAGAAGACATCAGACAAGG - Intergenic
1139726136 16:68900283-68900305 TCCAAAGATGTGCTCAGATATGG - Intronic
1140423777 16:74843246-74843268 GCCCCAGAAGTCCTAGGAAAGGG - Intergenic
1140431668 16:74909518-74909540 GCCCCAGAAGTCCTAGGAAAGGG + Exonic
1140800963 16:78487985-78488007 GGTACAGGAGTCCTCAGAAATGG + Intronic
1141462587 16:84186645-84186667 CCCACAAAAGCCCTCAGACAAGG + Intronic
1145475937 17:23609627-23609649 TCCAAAGAAATCCTCAGAGAGGG - Intergenic
1145679272 17:26567191-26567213 TCCAAAGAAATCCTCAGAAAGGG - Intergenic
1145707101 17:26881215-26881237 TCCAAAGAAATCCTCAGAAAGGG + Intergenic
1147559068 17:41497851-41497873 GCCACATAGGTCCTCAGATGGGG + Intergenic
1150749437 17:67846684-67846706 CCCACACAAGTCCTAAGCTATGG - Intronic
1151357289 17:73567409-73567431 CCCACAGAAGGCCTCTGCTAGGG + Intronic
1151693430 17:75701447-75701469 GCCACAGGCGTCCTCAGGAAGGG - Intronic
1152232148 17:79119222-79119244 ACCACAGATGCCCTCAGATCTGG - Intronic
1153838701 18:8987218-8987240 GCTCCAGAAGACCTCAGAAAGGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161308334 19:3579201-3579223 GCCTCAGAGTTTCTCAGATAGGG + Intergenic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161572398 19:5037765-5037787 GCCACAGACATCCCCAGACATGG + Intronic
1163515715 19:17762381-17762403 GCCACATAATTCCTCATTTATGG + Intronic
1165324221 19:35104794-35104816 GCCACAGAAGGCCTGGTATAGGG - Intergenic
1166007294 19:39916364-39916386 GCCACAGTAGTGCTCTGAGATGG - Intronic
1166050421 19:40255815-40255837 GCCATAGAAGGCTTTAGATAGGG + Intronic
1166897146 19:46030964-46030986 GCCACAGGAGGCCTCTGATGAGG + Intergenic
925784830 2:7421827-7421849 GCTCCAGAATTCCTCAGGTATGG + Intergenic
927955334 2:27203886-27203908 TACACAGCAGTCCTCAGAGAGGG + Intronic
928862279 2:35873861-35873883 GGCACAGGAGTCCTTAGACAAGG + Intergenic
928910464 2:36415749-36415771 ACCACATAAGTCCTCAGTTAGGG - Intronic
930188747 2:48436473-48436495 GCCACAGAAGTCTTCATTTGGGG + Intergenic
931973503 2:67616711-67616733 GCCTCAGACATCCTCATATAAGG + Intergenic
936047762 2:109200411-109200433 GACACAGAAGCCATCAGAGATGG - Intronic
936255356 2:110906084-110906106 GCCACTGGAGACCTCAGAGAAGG - Intronic
936732499 2:115401070-115401092 GCCATAGAAGGTCTGAGATAAGG + Intronic
937926928 2:127174836-127174858 GCCAGAGAAGTCCCCAGAGAAGG + Intergenic
939734774 2:145830128-145830150 GCCTCTGAGGTCCACAGATATGG + Intergenic
940224156 2:151384208-151384230 GCCACAGAAGTCGACAGGTGGGG + Intergenic
940618866 2:156085091-156085113 ACCATGGAAGTCCTCAGAAAAGG + Intergenic
944515994 2:200512180-200512202 GACACAGAACTCTTCTGATATGG - Intronic
945717453 2:213377549-213377571 CCCAAAGAAGTCCTCAGCTGAGG - Intronic
1170339723 20:15310716-15310738 AACAGAGAAGTCCTCAGATAAGG + Intronic
1170762507 20:19263307-19263329 GAGACAGAAGCCCTCAGCTAGGG + Intronic
1172715458 20:36960025-36960047 GCCACAGAAGTACAAAGATAGGG - Intergenic
1173540600 20:43848194-43848216 TCCACAGGAGTCCTCGGAGAAGG - Intergenic
1178147369 21:29755671-29755693 TCCACAGGAGCCCTCTGATATGG + Intronic
1180005050 21:45016806-45016828 GCCATGGAAGTCCTCAGCCAGGG + Intergenic
1180039775 21:45269838-45269860 GCCACAGATGCCGTCAGAAAGGG - Exonic
1182260540 22:29071047-29071069 GGCACAGAAGTCCTGGAATAAGG + Intergenic
1182448827 22:30406163-30406185 GCCCCAGAAGTTCTCAGTAAAGG + Intronic
1184370386 22:44078218-44078240 TCCAGAGAAGTCCTCACTTAAGG + Intronic
953381782 3:42477683-42477705 GCCAAAAAAGCCCTCAGATAGGG - Intergenic
953785198 3:45906188-45906210 GTCACAGAACTCCTCTGAGAAGG + Intronic
955804936 3:62723978-62724000 GACACAGAAGTGCCCACATAAGG - Intronic
956486531 3:69728753-69728775 GCCTCAGTAGTCCTTACATATGG - Intergenic
956903615 3:73742536-73742558 GGCACAGAGGTCCCCAGATATGG - Intergenic
957219965 3:77369510-77369532 GCCTCAGAAGTGCTCAGTTATGG - Intronic
958405021 3:93746469-93746491 TTCACAGAAGGCCTCAGATCTGG + Intergenic
959012067 3:101089185-101089207 GCCACAAAAGGCCTCTGATGAGG + Intergenic
960596904 3:119415081-119415103 GGCACAGCAGTCCACAGATTAGG + Exonic
964878317 3:161394894-161394916 GCCACAGAACTGGCCAGATAAGG - Intergenic
965691639 3:171363202-171363224 GCCTCAGCACTCCTGAGATATGG - Intronic
970965362 4:21922024-21922046 GCCAGAGAAGTTATCACATAGGG - Intronic
973730189 4:53815642-53815664 GCCACAGAAGTCCTCAGATAGGG - Intronic
974443851 4:61953746-61953768 GACCCAGGAGTCCTCAGAGAGGG + Intronic
976535114 4:86204650-86204672 GCCCCAGAAGTCCTTAAACATGG - Intronic
977551722 4:98449973-98449995 TCCATAGAAATCCCCAGATATGG + Intergenic
982890572 4:160844337-160844359 CCCACACAAGTCTTCCGATAGGG - Intergenic
988846922 5:35136609-35136631 GCTGCAGAGGTCCTCAGATCTGG + Intronic
989286705 5:39708027-39708049 GCCAGAGAACTGATCAGATAAGG + Intergenic
992093719 5:73341118-73341140 GCCCCAGATGCTCTCAGATAGGG - Intergenic
993186573 5:84629662-84629684 GCTACATAAGTCCTTAGGTAAGG - Intergenic
996261979 5:121482747-121482769 GCCACAGATGTAATCTGATAAGG - Intergenic
998482519 5:142474617-142474639 GCCACAGAAGGCTTCAGGGAGGG - Intergenic
999610241 5:153361681-153361703 GACCCAGATGTCCTCAGATGGGG - Intergenic
1001221850 5:169907148-169907170 GCCTCAGCAGCCATCAGATATGG - Intronic
1001526845 5:172435104-172435126 GGCACAGAAGACCTCAGAACAGG + Intronic
1001577366 5:172772766-172772788 AGCAAAGAGGTCCTCAGATAAGG + Intergenic
1002620928 5:180487658-180487680 GCCACAGTTCTCCTTAGATAGGG - Intergenic
1004934904 6:20497603-20497625 GCCACAGAGGTCCTGATCTAGGG + Intergenic
1007178496 6:39912306-39912328 CCCACAGAAATGCTCAGACATGG + Exonic
1007568087 6:42868796-42868818 GCCACATAGGTCCTTAGCTATGG + Intergenic
1009504261 6:64454859-64454881 GTCATAGAAGTCGTCATATAAGG - Intronic
1010465872 6:76166271-76166293 CCCACTGAAGTCCTCAGGCAGGG - Intergenic
1013145498 6:107386895-107386917 ACCACAGAAGTCCAAAGCTAGGG + Intronic
1013629155 6:111968394-111968416 TCCACAGAAGTGCTCAGGGAAGG - Intergenic
1014941844 6:127450024-127450046 TCCTCAGAAGTCCTCAGGTCAGG + Exonic
1016747774 6:147599462-147599484 GCCATAGAAGTTGTCAGAAATGG + Intronic
1019211409 6:170408280-170408302 ACCACGGAAGTCAGCAGATAGGG - Intergenic
1023025046 7:36042460-36042482 CACACAGAAGTGCTCAGACAGGG - Intergenic
1023200094 7:37687681-37687703 GTCTCAGAAATCCTCAGAGAGGG - Intronic
1023417361 7:39946093-39946115 GCCTCAGAATCCCTCAGACACGG - Intergenic
1023794361 7:43779627-43779649 GCCACAGGGGCCTTCAGATAAGG - Intronic
1025106884 7:56178353-56178375 GCATCAGAAGTCCTCTGAGATGG - Intergenic
1026311383 7:69187852-69187874 GCATCAGAAGTCCTCTGAGACGG + Intergenic
1026685325 7:72504734-72504756 GCCCCAGAAGACCACAGATGTGG - Intergenic
1031244380 7:119289707-119289729 GCCACAGACAGCCTCAGAAAGGG - Intergenic
1032325221 7:130921763-130921785 GCCACAGAAGACATCAGAACTGG - Intergenic
1032559616 7:132874972-132874994 TCCTCAGAAGCCCTCAGATTAGG + Intronic
1034280759 7:149852669-149852691 GCAACAGACTTCATCAGATATGG - Intronic
1034943620 7:155248173-155248195 GCCCCAGATGTCCTCAGCTCAGG + Intergenic
1036421869 8:8603892-8603914 CCCAGAGAAGTCCTCAGGCATGG - Intergenic
1036470353 8:9047349-9047371 GCCACAGAAGTGAGCAGAGAAGG - Intronic
1038093439 8:24280633-24280655 GCTACAGAATTACTCAGATAAGG - Intergenic
1040932024 8:52745751-52745773 GCCTCAGAAGTGCTGAGATTAGG - Intronic
1041453497 8:58032838-58032860 ACCACAGAAGTTCTCAGCTTAGG - Intronic
1041516096 8:58700446-58700468 GGCACAGTATTCCTCAGGTATGG - Intergenic
1045378983 8:101604122-101604144 GACACAGAAGTCCTCCCATTGGG - Intronic
1049281013 8:141744621-141744643 GTCACATTAGTCCTCAGATTAGG + Intergenic
1055790291 9:79916152-79916174 TCTACAGAAGTTCTCAGATTAGG - Intergenic
1057046148 9:91887617-91887639 GTCAGAGAACCCCTCAGATAAGG - Intronic
1061481207 9:130898537-130898559 GTCACAGAGGTCCTCAGACAAGG - Intergenic
1187717401 X:22116665-22116687 GCCACAAATGTACTTAGATATGG - Intronic
1194957999 X:100203504-100203526 CCCACAGAAGCCCTTACATAGGG - Intergenic
1200705465 Y:6438808-6438830 GCCACAGACGGCCTCTGATATGG - Intergenic
1201028646 Y:9725900-9725922 GCCACAGACGGCCTCTGATATGG + Intergenic