ID: 973733174

View in Genome Browser
Species Human (GRCh38)
Location 4:53843302-53843324
Sequence GGCAAATGGGCTGGGTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4926
Summary {0: 2, 1: 12, 2: 108, 3: 837, 4: 3967}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973733167_973733174 15 Left 973733167 4:53843264-53843286 CCTTAGAAATATAGTAGACATAG 0: 1
1: 0
2: 1
3: 17
4: 227
Right 973733174 4:53843302-53843324 GGCAAATGGGCTGGGTGCAGTGG 0: 2
1: 12
2: 108
3: 837
4: 3967

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973733174 Original CRISPR GGCAAATGGGCTGGGTGCAG TGG Intronic
Too many off-targets to display for this crispr