ID: 973733901

View in Genome Browser
Species Human (GRCh38)
Location 4:53851167-53851189
Sequence GGGTGAAAACAGATGGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 249}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973733901_973733911 26 Left 973733901 4:53851167-53851189 CCCAGTCCCATCTGTTTTCACCC 0: 1
1: 0
2: 1
3: 19
4: 249
Right 973733911 4:53851216-53851238 TTATTAAAAGTTTCTTGGCTGGG No data
973733901_973733910 25 Left 973733901 4:53851167-53851189 CCCAGTCCCATCTGTTTTCACCC 0: 1
1: 0
2: 1
3: 19
4: 249
Right 973733910 4:53851215-53851237 GTTATTAAAAGTTTCTTGGCTGG 0: 1
1: 0
2: 3
3: 53
4: 373
973733901_973733909 21 Left 973733901 4:53851167-53851189 CCCAGTCCCATCTGTTTTCACCC 0: 1
1: 0
2: 1
3: 19
4: 249
Right 973733909 4:53851211-53851233 AACAGTTATTAAAAGTTTCTTGG 0: 1
1: 0
2: 4
3: 37
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973733901 Original CRISPR GGGTGAAAACAGATGGGACT GGG (reversed) Intronic
900161449 1:1226015-1226037 GGCAGAACACAGATGTGACTGGG + Intronic
902099051 1:13970186-13970208 GGCTGAGAACAGATGGTATTTGG - Intergenic
903180432 1:21602430-21602452 GGGTGGCCACAGATGGGCCTGGG - Intronic
903485136 1:23684150-23684172 GGGTGAAATCAGGGGAGACTGGG + Intergenic
905516049 1:38562906-38562928 GTGAGAGAACAGATGAGACTTGG - Intergenic
906130489 1:43452695-43452717 GGCAGAAAACAGATGGGAAAAGG - Intronic
907617151 1:55937274-55937296 GGGTGAAAGGAGATGGGACAGGG - Intergenic
909569148 1:77088250-77088272 TGCTGAAAACAGATGGGAAAAGG + Intergenic
909887316 1:80958262-80958284 GGGTGAAAACAGATTAGAAATGG + Intergenic
910175381 1:84424858-84424880 GGGTGGAAAAAAATGAGACTAGG - Intergenic
913287257 1:117237944-117237966 GAGTGAAAACAAATGGGAGGTGG - Intergenic
914905958 1:151744275-151744297 GGGTGAAAAGACAAGGTACTGGG - Intergenic
914985904 1:152457071-152457093 GGGTGAAGAGTGGTGGGACTTGG - Intergenic
918901728 1:190430088-190430110 GGGGAAAAACAGATGAGAGTAGG - Intronic
919052272 1:192525869-192525891 AGGGGAAAACTGATGGCACTTGG - Intergenic
919770998 1:201158466-201158488 GAGAGCAAAGAGATGGGACTGGG + Intronic
920648541 1:207820560-207820582 TGGTGAAAACAGATAGGAAAAGG + Intergenic
921854158 1:219963387-219963409 GGATAAAAAAAGATGAGACTGGG + Intergenic
922346472 1:224700698-224700720 GGGCCCAAACAGAAGGGACTGGG + Intronic
922510103 1:226158618-226158640 AGGTGAAAGAACATGGGACTGGG - Intronic
922585980 1:226735863-226735885 GGGTGCAATCAGAGGGGACTTGG - Exonic
1064485557 10:15784925-15784947 GGATGGGAACAGATGGGAATAGG + Intronic
1066761481 10:38757837-38757859 GGATGAAAAAACATAGGACTAGG + Intergenic
1067575470 10:47405883-47405905 GGGTGAACAGAGCTGGGAATGGG + Intergenic
1067917744 10:50418738-50418760 GGGTGCAAAGAGGTGGGACCTGG + Intronic
1068483424 10:57625136-57625158 TGGTGAAAATAAATGGGAATTGG + Intergenic
1069777339 10:70934760-70934782 GGGAGAAGAGAGGTGGGACTGGG - Intergenic
1070783202 10:79149214-79149236 GGATGAACACAGATGGGAGGGGG - Intronic
1071741774 10:88366752-88366774 GGATTAAAGCAGAGGGGACTTGG - Intronic
1072782363 10:98259437-98259459 GGGAGAAAACAGATAGGAGGTGG + Intronic
1076141719 10:128084672-128084694 TGGTGAAAACAAAAGGGACCTGG - Exonic
1077507998 11:2941042-2941064 GGGTCCAAACAGCTGGGCCTGGG + Intergenic
1078303283 11:10156317-10156339 GGGTGAAGACAGATGGGTGCAGG + Intronic
1078461767 11:11520027-11520049 GGGTGCAAACAGCTGGCACTGGG + Intronic
1078641214 11:13098441-13098463 GGGTCAGAACAGATGGTAGTGGG + Intergenic
1078954254 11:16172158-16172180 GGGTGAAAACAAGAGAGACTAGG + Intronic
1083538019 11:63490072-63490094 GGGTGATAACAGATGGTACTGGG - Intronic
1085214609 11:74817827-74817849 GGGAGAAAAGAGGTGGGAATTGG + Intronic
1089571294 11:119412309-119412331 GAGTTAAAACAGAGAGGACTGGG - Intergenic
1089610736 11:119667153-119667175 GGCGGTAAACAGATGGGACCTGG - Intronic
1090816439 11:130301082-130301104 GGGTGATAACAGATGGTATAAGG + Intronic
1090851665 11:130576043-130576065 GTGTGAAAACAGCTGGCACAGGG - Intergenic
1091280299 11:134377979-134378001 GGGTGAAACCAGAAGGCAATAGG - Intronic
1091506403 12:1073644-1073666 GTCTCAAAACAGAAGGGACTTGG + Intronic
1091544147 12:1489464-1489486 TGGTGAAAGCTGATGGGATTTGG - Intronic
1091990630 12:4952893-4952915 GGAGGAAAAGAGATGGGACTGGG - Intergenic
1093475054 12:19545521-19545543 GGGTCATGTCAGATGGGACTGGG - Intronic
1095886124 12:47190342-47190364 GGGTTAGAACAGATGGAACTTGG - Intronic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1100628200 12:96358800-96358822 GGGTGACAAGAGTTGAGACTCGG + Intronic
1103916608 12:124379005-124379027 GGGTGAAACAGGATGGGACAAGG + Intronic
1104400931 12:128475657-128475679 AGGACAAAAGAGATGGGACTTGG - Intronic
1104555921 12:129799805-129799827 GGTTGAGCACAGAAGGGACTGGG + Intronic
1105449697 13:20488262-20488284 GGGTAGAAACAGGTGGCACTGGG + Intronic
1105543817 13:21337566-21337588 AGGTGAGAGCAGATGAGACTGGG - Intergenic
1105543847 13:21337704-21337726 AGGTGAAGACAGATGAGGCTAGG - Intergenic
1105544067 13:21339188-21339210 AGGTGAGAGCAGATGAGACTGGG - Intergenic
1105544094 13:21339326-21339348 TGGTGAAGACAGATGAGGCTAGG - Intergenic
1107132376 13:36910593-36910615 GAGTGAAAAGAGATGAGGCTGGG - Intronic
1108073408 13:46653219-46653241 GGGAGAAAACAGATGCAACCAGG - Intronic
1108285093 13:48898819-48898841 AGGTGAAAACAGTAGTGACTTGG - Intergenic
1108575432 13:51786375-51786397 GAGTGAAGACAGATGGGAGAGGG - Intronic
1110330426 13:74265976-74265998 TGGGGAAGACAGATGGGTCTTGG + Intergenic
1110781332 13:79469015-79469037 GGTTGAAAGGAGATGGGAATGGG + Intergenic
1110896092 13:80754345-80754367 GGGTGAAAAGAGATAGTATTTGG + Intergenic
1111685765 13:91499052-91499074 GAATGAAAACAAATGAGACTAGG + Intronic
1113292631 13:108923274-108923296 GGTTGAAAACAGATAGGAATGGG + Intronic
1114216895 14:20663876-20663898 GAGAGAGAACAAATGGGACTAGG + Intergenic
1114738402 14:25067557-25067579 AGGTGAAAACAGATGAGAAAAGG + Intergenic
1115795604 14:36931753-36931775 GAGTTAGAATAGATGGGACTTGG + Intronic
1117046529 14:51818269-51818291 GGGTGAAACCTGATGGGCATCGG - Intergenic
1117626727 14:57647692-57647714 GGAAGAACACAGATGGGTCTAGG - Intronic
1118370921 14:65136560-65136582 GGGTGTAAAGAGAAGGGAGTGGG - Intergenic
1119849883 14:77859612-77859634 GGTTGAAACCAGATGGGATGGGG - Intronic
1125396672 15:39256120-39256142 GAGAGAAAAAAGATGCGACTTGG + Intergenic
1125700930 15:41682943-41682965 GGGTGAAGAGAGATGAGGCTGGG - Intronic
1126761938 15:51977474-51977496 GGGCGATAACAGATGGGGGTTGG - Intronic
1126829058 15:52580706-52580728 TGTGGAAAACAGATGGGACAAGG - Intergenic
1127968685 15:63942632-63942654 GGCTGAGGACAGATGAGACTCGG - Intronic
1128745882 15:70113824-70113846 GGGTGACAAGAGGTGGGACTGGG - Intergenic
1129084602 15:73075540-73075562 AAGTGGAAACAGATTGGACTTGG + Intronic
1131571771 15:93544793-93544815 GAGTGGAAACAGAGGGGACTAGG - Intergenic
1132516852 16:370001-370023 GGGGGAAAGTAGATGGGAATGGG + Exonic
1133084277 16:3349659-3349681 GGGGGAAAAAAGATGGGAAAAGG + Intergenic
1134530601 16:14980067-14980089 CAGGGAAAACTGATGGGACTCGG + Intronic
1137747527 16:50834122-50834144 GATGGAAAGCAGATGGGACTGGG - Intergenic
1137819429 16:51429606-51429628 GGGTAAAAAAAGAATGGACTTGG + Intergenic
1138298620 16:55908279-55908301 GGATGCTGACAGATGGGACTGGG - Intronic
1138455893 16:57120511-57120533 GTCTGAGAGCAGATGGGACTGGG + Intronic
1139401445 16:66684954-66684976 GGGTGAGATGAGATGGGATTTGG - Intronic
1139865746 16:70060945-70060967 CAGGGAAAACTGATGGGACTCGG - Intergenic
1141315949 16:82962569-82962591 GGCTGAAGACAGACGGGAGTGGG + Intronic
1143113134 17:4564553-4564575 GGCAGAAGACAGATGGGCCTTGG + Intergenic
1144638038 17:16923495-16923517 GGGTGACCACAGAGGGGACCAGG - Intergenic
1144849545 17:18237080-18237102 GGGTGAGGACAGATGGGAAGTGG + Intronic
1145885330 17:28378249-28378271 GTGTGAAAAGAGATCGGACCTGG - Intronic
1147847492 17:43414899-43414921 ATATGAAAACAAATGGGACTTGG - Intergenic
1149779752 17:59387966-59387988 GGCTGAAATCAGGTGGGACCAGG + Intronic
1150869614 17:68892107-68892129 GAGTAACAACAGATGGAACTAGG - Intronic
1152317083 17:79587447-79587469 GGATGAAAACAGCAGGGGCTGGG - Intergenic
1153266907 18:3280036-3280058 GGGAGGAAACAGATAGGACCCGG - Intergenic
1155041599 18:22069691-22069713 GTGTGAAAACAGAACCGACTTGG + Intergenic
1156511400 18:37639946-37639968 GGATGAGGAGAGATGGGACTGGG + Intergenic
1156516335 18:37683738-37683760 GGGTGAAAGTGGATGGGAGTGGG + Intergenic
1159204359 18:65231313-65231335 AGGTGAAAACTCCTGGGACTTGG + Intergenic
1159428865 18:68325131-68325153 GGGAGAAAACAGATGGGCTAGGG + Intergenic
1161404384 19:4083454-4083476 GGGTGCAAACAGAAGGGATGTGG + Intergenic
1162811236 19:13165326-13165348 CTGTGTAAACAGAGGGGACTTGG - Intergenic
1162979847 19:14231558-14231580 GGGAGTAAACGGATGGGGCTGGG - Intergenic
1163174446 19:15554373-15554395 GTGTGAGCAAAGATGGGACTAGG + Intergenic
1165177295 19:33939493-33939515 GGGTGGAAACAGCCAGGACTGGG - Intergenic
1166317649 19:41998018-41998040 GACAGAAAACAGATGGGGCTGGG - Intergenic
1167312357 19:48744432-48744454 GGGTGAGAGAAGATGGGAGTCGG - Exonic
925138900 2:1536896-1536918 GGTTGCAAACAGTTGGGATTTGG - Intronic
925746474 2:7048094-7048116 GCTTGAAAACAGACAGGACTGGG - Intronic
925924081 2:8658199-8658221 GGCAGAGAACAGATGGGACCTGG + Intergenic
926799125 2:16643648-16643670 GGGCGAATACAGATAGAACTGGG - Intronic
927024440 2:19050973-19050995 GGCTGACCACAGAGGGGACTGGG - Intergenic
927517370 2:23680222-23680244 GGAGGTAAAAAGATGGGACTTGG + Intronic
927975270 2:27333790-27333812 GGGAAAGAAGAGATGGGACTAGG + Intronic
928332894 2:30371154-30371176 GGGTGAAAAAAAATGAGGCTGGG + Intergenic
929300802 2:40301768-40301790 TGGGGAAAACAGGTGGTACTTGG + Intronic
930483702 2:51984795-51984817 GGGTGAAAACTAAAGGGATTTGG - Intergenic
932261424 2:70330813-70330835 GGTTGGAAGCTGATGGGACTGGG + Intergenic
932574845 2:72956959-72956981 GGGTGAGTGCAGAGGGGACTAGG - Intronic
933391368 2:81672647-81672669 GTGTGATAACAGATGGCTCTGGG + Intergenic
933760570 2:85669158-85669180 TGATGAAAAGAGATGGGGCTGGG + Intergenic
935067117 2:99658789-99658811 GGTTGAAAGCAAAGGGGACTAGG + Intronic
935783586 2:106529623-106529645 AGGTGAAAACAGTAGTGACTTGG - Intergenic
938653069 2:133403730-133403752 TGGTGGAATGAGATGGGACTTGG - Intronic
939421252 2:141972704-141972726 TGTTTAAAACAGATGGGTCTAGG - Intronic
939696915 2:145337648-145337670 GAGGGAAAACAGAGGGGACCTGG - Intergenic
942950423 2:181714784-181714806 GGATTAGAACAGATAGGACTGGG + Intergenic
943443713 2:187955852-187955874 GGGTGAAAACATGTGGTATTTGG - Intergenic
944704991 2:202280032-202280054 TGGTGAAAACAGATAGGAAAAGG - Intronic
945729296 2:213513594-213513616 GGGTGAAAACAGAATGGGATGGG + Intronic
947261473 2:228228165-228228187 GGGAGATAAAAGGTGGGACTGGG + Intergenic
948092201 2:235303736-235303758 GGGTGAGAACTGATGGGAACAGG + Intergenic
948236148 2:236392322-236392344 GGATGAAAAAAGATGAGTCTTGG - Exonic
948868892 2:240788549-240788571 GGGTGACAAGAGCTGAGACTGGG + Intronic
949042546 2:241855963-241855985 GGGTGACGGCAGCTGGGACTAGG + Intronic
1169915027 20:10674910-10674932 GGGTGGCAAGAGATGGGCCTGGG + Intergenic
1169930348 20:10826095-10826117 GGGTGACAACAGATGAAACGTGG - Intergenic
1173248645 20:41352949-41352971 GGGTGAGCAGAGATGGGCCTGGG + Intronic
1174317017 20:49711544-49711566 GGGTGTGAAAAGATGGGATTTGG - Intronic
1174762106 20:53216357-53216379 GAGTGAGGACAAATGGGACTGGG + Intronic
1175735141 20:61380533-61380555 GGGTGAAAACAGGTGGGAGGGGG - Intronic
1175764016 20:61580811-61580833 ACGTGAACACAGTTGGGACTGGG - Intronic
1175994866 20:62807511-62807533 GGAAGAAAAGAGATGGGATTAGG - Intronic
1176044858 20:63087325-63087347 GGGTGTACACAGATGCGTCTGGG + Intergenic
1176311709 21:5154232-5154254 GGGTGAGAACAGCAGGGACCCGG - Intronic
1177180008 21:17734868-17734890 ATGAGAAAAGAGATGGGACTTGG + Intergenic
1177462646 21:21433109-21433131 GGGTCAACACAGATGAGACCAGG - Intronic
1178012763 21:28305970-28305992 GGGTGATATCAGAGGTGACTGGG - Intergenic
1178592192 21:33920792-33920814 AGATGGAAAGAGATGGGACTTGG - Intergenic
1179845341 21:44107803-44107825 GGGTGAGAACAGCAGGGACCCGG + Intronic
1181096931 22:20511766-20511788 GGGGGAAGAAGGATGGGACTGGG - Intronic
1181771453 22:25128681-25128703 GGGTGCAAAGAGATGGGGCTGGG - Intronic
1182336243 22:29585420-29585442 GGGTGAAAAAAGGTGGTGCTGGG + Intergenic
1182842074 22:33399219-33399241 GAGTGAGAACAGGTGGTACTTGG + Intronic
1183604280 22:38859644-38859666 AGGGGCAAACAGATGGGGCTGGG + Intergenic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
949131046 3:501651-501673 GTGTGAAAAAAGAGGGGTCTGGG + Intergenic
952024682 3:29065166-29065188 TGGTGAAAACAAATGTGATTTGG - Intergenic
952861800 3:37818950-37818972 GAATGAAGACAGTTGGGACTGGG + Exonic
954366736 3:50150449-50150471 GGGAGAACACAGAAGGGTCTGGG + Intergenic
954370845 3:50168912-50168934 AGCTGAAGAGAGATGGGACTGGG - Intronic
955066778 3:55540264-55540286 GGGAGAAAACAGAATGCACTTGG + Intronic
958873159 3:99585018-99585040 AGGTGAACACAGATTTGACTTGG - Intergenic
959560353 3:107772746-107772768 TGGAGAAAACAGATGAAACTAGG + Exonic
959809052 3:110593994-110594016 CTGTGAAAACAGCTGGGAGTAGG + Intergenic
962318888 3:134375047-134375069 GGGTGAAAACAGCGGGGGTTAGG - Intronic
962752466 3:138443912-138443934 GGGTCCACACAGATGGGTCTGGG - Intronic
966421233 3:179736428-179736450 GGGTGTTAGCAGATGGGACCAGG + Intronic
966430357 3:179825648-179825670 GGAGGAAAACAGATGGGCTTTGG + Intronic
970825477 4:20268017-20268039 CACTGAAAACAGATGGGATTGGG + Intronic
971363642 4:25958979-25959001 GGGTGAGGACAGTTGGGACAGGG + Intergenic
971985772 4:33821678-33821700 GGCTGGAAGCAGATGGGAATGGG - Intergenic
972115692 4:35630893-35630915 TTGTGAAAACTGATGGAACTTGG + Intergenic
973158093 4:46982848-46982870 TGGTGATAACAGCTTGGACTAGG + Intronic
973733901 4:53851167-53851189 GGGTGAAAACAGATGGGACTGGG - Intronic
974520876 4:62978425-62978447 GGGTTCAAACAGCTGGTACTAGG + Intergenic
975853301 4:78595808-78595830 TGGTGAGAACAGATGGGGCACGG + Exonic
979595589 4:122530823-122530845 GGGTGAAGACAGGGGTGACTGGG + Intergenic
979690231 4:123551587-123551609 GGGTGAAATTGGATGGGGCTTGG + Intergenic
980904921 4:138939007-138939029 TGGTGACAACAGATGGAACAAGG + Intergenic
980981779 4:139660561-139660583 GGGCGAAAGCAGAAGAGACTAGG - Intergenic
981815768 4:148829403-148829425 GGAAGAAAACAGATGGGGCATGG + Intergenic
982022649 4:151219107-151219129 GGAAGTACACAGATGGGACTAGG - Intronic
982332231 4:154193334-154193356 GGGTGATACCAGGTGGTACTGGG - Intergenic
985030819 4:185787651-185787673 GGGTGGAGACAGATGGGAGGAGG - Intronic
985051873 4:185999283-185999305 GGAAGAAAGCAGATGGGGCTGGG - Intergenic
986315612 5:6584479-6584501 GGGAGAACACAGAGAGGACTGGG - Intergenic
986321483 5:6635465-6635487 GGGTCATGACTGATGGGACTAGG - Intronic
988219028 5:28317338-28317360 GAGTGAGAACATATGGCACTTGG + Intergenic
988423902 5:31040252-31040274 GGGTGACAACATGTGGGATTTGG - Intergenic
988816518 5:34839699-34839721 GGGTGAAAGGAGAGGCGACTTGG + Intronic
990641686 5:57792559-57792581 GGCTGATAACTGATGGAACTGGG + Intergenic
990791712 5:59488082-59488104 GGGTGAAAACTGAGGGAACTAGG - Intronic
991053712 5:62299901-62299923 GGGGGAAAACAAAGGGGACCAGG - Intergenic
997490855 5:134274656-134274678 GGGAAAAAACACATGGGTCTGGG - Intergenic
999536568 5:152523786-152523808 GGGTAAGAAGAGATGGGGCTAGG + Intergenic
1001859789 5:175044067-175044089 GGGAGAAGAGAGATGGGACAGGG - Intergenic
1003074145 6:2968927-2968949 GGGTGGAAGCAGATGGGGGTCGG + Intronic
1003791333 6:9550838-9550860 GGGTGAAGACAGAAGTGGCTGGG - Intergenic
1007128302 6:39446081-39446103 GGGGGAAAGGAGATAGGACTTGG + Intronic
1007187270 6:39982814-39982836 GGGTATAAACAGAGGTGACTAGG - Intergenic
1007208669 6:40173387-40173409 GGGAGAGAACAGATAGGGCTAGG - Intergenic
1007229215 6:40336776-40336798 TTGTGAACACAGATGTGACTTGG + Intergenic
1007327181 6:41072043-41072065 AGAAGAAAACAGAAGGGACTTGG + Intronic
1009844294 6:69116354-69116376 GGGTGAAAACAGGTGTGTGTGGG - Intronic
1010613332 6:77983587-77983609 GGGTAAAAACAGATGGGAAAGGG - Intergenic
1011106679 6:83789327-83789349 GAAGGAATACAGATGGGACTAGG + Intergenic
1011879853 6:92011667-92011689 AGGTGAAGCCAGCTGGGACTTGG - Intergenic
1012597847 6:101061037-101061059 GGAAGAAAACAGATGGTTCTGGG + Intergenic
1015629343 6:135215763-135215785 GGGTGAAAACAGCTAAGATTAGG - Intronic
1017849353 6:158290582-158290604 GGGTAAAAACAGAAGGGAGGTGG - Intronic
1018110724 6:160534751-160534773 GGGTGAGACCAGAGGAGACTGGG + Intronic
1018832141 6:167451336-167451358 GAGTGAAAAGAGCTGGGACTTGG + Intergenic
1022271043 7:28808479-28808501 GGGTGAAAACAGAAAGGTCAGGG - Intronic
1022656070 7:32320312-32320334 GGGGGAAAACAGGTAGAACTGGG + Intergenic
1022864698 7:34405515-34405537 GGGTGAAAACAAAAGGCACTGGG + Intergenic
1025142756 7:56479304-56479326 GGGTGAAGGCAGCTGGGACAGGG + Intergenic
1025610661 7:63073284-63073306 GGGTGAAGGCAGCTGGGACAGGG - Intergenic
1026797227 7:73374086-73374108 GCGTGACAACTGATGGGATTTGG - Intergenic
1029363709 7:100104179-100104201 AGCTGAGGACAGATGGGACTTGG + Intronic
1030573906 7:111262467-111262489 GGGAGAAAAGAAATGGGAGTGGG + Intronic
1033993004 7:147311151-147311173 GAGAGTAAACAGATGGGCCTAGG + Intronic
1034945521 7:155259415-155259437 GGGTGAGGACAGATGGGGATGGG + Intergenic
1035052627 7:156009510-156009532 CAGTGAAAACATCTGGGACTGGG + Intergenic
1036704913 8:11039691-11039713 GGGCGAGTACAGATGGGAATTGG - Intronic
1037765693 8:21770916-21770938 AGGTGAAACCAGCTGGGATTCGG + Intronic
1037821057 8:22134727-22134749 GGGTGAGCACACATGGGACCCGG - Intergenic
1038387696 8:27164812-27164834 GGGGGAAAAAAGATGGGGATGGG + Intergenic
1041606109 8:59784169-59784191 GAGTGAGAAAAGATGGGACGTGG - Intergenic
1042951523 8:74205096-74205118 GTATGAAAACAGGTGGGATTTGG - Intergenic
1044802556 8:95972272-95972294 GGCTGAAGACAGATGGTGCTGGG - Intergenic
1045600324 8:103707819-103707841 CGGTGAAACCTGCTGGGACTTGG + Intronic
1045950079 8:107841566-107841588 GGGGGCAAACATATGGGATTTGG - Intergenic
1046084500 8:109415563-109415585 AGGTGACAAAAGATGGGACCAGG + Intronic
1046645983 8:116786125-116786147 GGTTGAAAACAGAATGGGCTAGG + Intronic
1047263890 8:123287340-123287362 GGTTAAAAACAGATGGGGCCGGG - Intergenic
1049081392 8:140445874-140445896 GGATGAAACCACAGGGGACTAGG + Intronic
1050697398 9:8294283-8294305 GCGTGATCACAGATGAGACTTGG + Intergenic
1051480607 9:17556091-17556113 GGGTCAAATCAGCTGGGGCTTGG + Intergenic
1052474250 9:28938022-28938044 AAGTGAAAACAGTTGGGATTTGG + Intergenic
1052688219 9:31780773-31780795 TTGTGAAAGCAGATGGGATTAGG - Intergenic
1053429221 9:38030999-38031021 GGGTGAAGACAGATGGCGGTTGG - Intronic
1057855906 9:98600483-98600505 GGCAGAATACAGATGTGACTGGG + Intronic
1058078403 9:100674225-100674247 GGGTGAAAACAGATGGAAAGGGG + Intergenic
1059327639 9:113513925-113513947 GGGAGGAAACAGATTGGGCTGGG + Intronic
1060193938 9:121610828-121610850 GGGTGGAAAGAGATGGGCCCAGG - Intronic
1060231246 9:121827058-121827080 GGGTCCAAACCCATGGGACTCGG - Intronic
1060491069 9:124084758-124084780 GGTAGAAAACAGATGGGAGTGGG + Intergenic
1061003669 9:127916587-127916609 GGGTGAAAGCACATGGCACCCGG + Intronic
1061212005 9:129199043-129199065 GGGTGGGAAGGGATGGGACTTGG + Intergenic
1062502787 9:136858458-136858480 GGGCGGATACAGCTGGGACTGGG + Exonic
1186263196 X:7803388-7803410 TGGTGGAAACAAATGTGACTTGG - Intergenic
1186419908 X:9417344-9417366 GGGTGAAGAAAGATGGAACAAGG - Intergenic
1187261199 X:17686724-17686746 GAGTGGAAAGAGATGAGACTGGG + Intronic
1188872494 X:35390095-35390117 GGGTGTAAAAAGATGAGTCTAGG + Intergenic
1189865813 X:45325907-45325929 GGGTGAAAACAGAAGGTGCTGGG + Intergenic
1190012841 X:46800023-46800045 GGGGGAAAACAGATGCTAATAGG + Intergenic
1190235480 X:48611849-48611871 AGGTCAAACCAGATGGGAGTTGG - Intergenic
1192192319 X:68998779-68998801 GTGTGAAAGTAGATGGGACTTGG + Intergenic
1194163847 X:90489369-90489391 GGGTGATAACAGAGATGACTGGG + Intergenic
1194513320 X:94821461-94821483 GGGTGATAACAGAGATGACTGGG + Intergenic
1195761387 X:108250081-108250103 TGCTGAACAGAGATGGGACTTGG - Intronic
1195887607 X:109656621-109656643 AGTTGAAGACAGATGAGACTTGG + Intronic
1200510110 Y:4067178-4067200 GGGTGATAACAGAGATGACTGGG + Intergenic