ID: 973734431

View in Genome Browser
Species Human (GRCh38)
Location 4:53856572-53856594
Sequence GAATGACTTGTAGGGAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973734424_973734431 8 Left 973734424 4:53856541-53856563 CCATCAGTTAGAAGGTGTCAAAG 0: 1
1: 0
2: 1
3: 14
4: 134
Right 973734431 4:53856572-53856594 GAATGACTTGTAGGGAGGGCTGG 0: 1
1: 0
2: 3
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973734431 Original CRISPR GAATGACTTGTAGGGAGGGC TGG Intronic
902438300 1:16412194-16412216 GGATGACTTTTAGGGAGGGAGGG - Intronic
903938121 1:26910695-26910717 GAGTGACCTGAAGGGTGGGCAGG - Intronic
905299789 1:36979207-36979229 GCATGTGTTGTAGCGAGGGCTGG - Intronic
906300426 1:44677702-44677724 GAAAGACTTGAGGGGAGGGAAGG + Intronic
906925602 1:50112761-50112783 GAATGACTTGAATGAATGGCAGG - Intronic
907253603 1:53161028-53161050 GAATGACTTCTGAGCAGGGCAGG + Intergenic
907883417 1:58572116-58572138 GAAGGAATTGTTGGGAGGGATGG - Intergenic
908693344 1:66807794-66807816 GAATGACTTCTAGGAAAAGCTGG - Intergenic
909271012 1:73624012-73624034 GAATAACTTGGAGAGAGTGCTGG + Intergenic
910513696 1:88035850-88035872 TAAAGACTTGTAGGGTGGGTTGG + Intergenic
911557103 1:99357535-99357557 GAATGGTTTGTAGGGAGGTGAGG - Intergenic
913689118 1:121261523-121261545 CAAAGACTTGTAAGGAGGTCGGG - Intronic
914148480 1:145018758-145018780 CAAAGACTTGTAAGGAGGTCGGG + Intronic
914334208 1:146700348-146700370 GAGTGACAGGTAGGGAGGGGAGG - Intergenic
914425095 1:147568670-147568692 GAAAGATCTGTAGGGAGGGAGGG - Intronic
915676873 1:157540178-157540200 GAATGACTAGGATGGAGGACAGG - Intronic
919018269 1:192069235-192069257 GACTGACTTTTAGGGAGAGACGG + Intergenic
920476441 1:206279999-206280021 CAAAGACTTGTAAGGAGGTCGGG - Intronic
920573082 1:207032774-207032796 GAATGAGAGGTAGGGAGGGGAGG - Intronic
1064484179 10:15767554-15767576 GAATGACTTCCATGGAGGACTGG - Intergenic
1068168112 10:53357739-53357761 GAATGCCTATTTGGGAGGGCAGG - Intergenic
1070522315 10:77264857-77264879 GAATGACTTGTAGGCTGGTGTGG - Intronic
1070823329 10:79375838-79375860 GAAGGAGGTGGAGGGAGGGCTGG + Intergenic
1071513632 10:86282807-86282829 GAATGGGTTGGAGGCAGGGCTGG - Intronic
1072631309 10:97148826-97148848 GAATAACTTTTAGGGAGGTGAGG - Intronic
1074752498 10:116600137-116600159 AAAGGACTTGTAGGAAGTGCAGG - Exonic
1076379414 10:130014925-130014947 AAATGACTTGGAGGGAGGGCGGG - Intergenic
1078638412 11:13073786-13073808 GGATGACGTGCAGGGAGGGATGG - Intergenic
1081516260 11:43833335-43833357 GAATGACGGGTAGAGAGGGGAGG - Intronic
1082197389 11:49322428-49322450 GCTTGACTTGTAGGGAAGGGAGG + Intergenic
1083844453 11:65322713-65322735 GAATGCCTAGCAGGGAGGTCAGG + Intergenic
1086658423 11:89385696-89385718 GCTTGACTTGTAGGGAAGGGAGG - Intronic
1089615589 11:119692968-119692990 GAGTGCCTTGTAGAGAGGGCAGG + Intronic
1094201799 12:27802644-27802666 AAATGACTTGTACGGTTGGCTGG + Exonic
1094541074 12:31363711-31363733 GAAGGACCTGTAAGGAGGGACGG - Intergenic
1095297678 12:40545612-40545634 GATTATCATGTAGGGAGGGCAGG + Intronic
1098220892 12:68268625-68268647 GACTAACTTGTAGGGAGAGGTGG - Intergenic
1102528343 12:113528017-113528039 GAAATACTTATAGGGAGGGCTGG + Intergenic
1106749766 13:32750522-32750544 GAATTAGCTGTAGGGAGGGAAGG - Intronic
1108500832 13:51068456-51068478 CATGGACTTGCAGGGAGGGCGGG + Intergenic
1110720539 13:78756121-78756143 GATTGAATAGTATGGAGGGCTGG + Intergenic
1112993657 13:105545514-105545536 CAATGACTTCTAGGGTAGGCTGG - Intergenic
1113286791 13:108858553-108858575 GTATAACTTGAAGGTAGGGCCGG - Intronic
1116921996 14:50588558-50588580 GAATAACTTGGAGTGATGGCTGG - Intronic
1118367837 14:65110705-65110727 GAAGGAGTTGAAGGGAGGCCAGG - Intergenic
1118855813 14:69621312-69621334 GAGTCATTTGTAGGGAGGCCTGG + Intronic
1119529340 14:75348677-75348699 GACTGACATGTGGGGAAGGCTGG - Intergenic
1121017868 14:90559283-90559305 CAATGACTTGGAGGGAGACCAGG + Intronic
1122326085 14:100881407-100881429 GGATGAGTCGTAGGGAGCGCTGG + Exonic
1122982360 14:105197431-105197453 GAATGACAGCCAGGGAGGGCTGG + Intergenic
1124065783 15:26342442-26342464 GAATCACTTGTAGGGAGCCATGG - Intergenic
1124403885 15:29377030-29377052 GAAGGAGTTGGGGGGAGGGCAGG + Intronic
1124842688 15:33258247-33258269 GAAGGACTAGCATGGAGGGCAGG - Intergenic
1126487839 15:49202343-49202365 GGATAACATGTAGTGAGGGCAGG - Intronic
1128736390 15:70056253-70056275 GCATGCTTTGTAGGGTGGGCAGG - Intronic
1128787676 15:70410304-70410326 GAGTGACTTGCAAGGAAGGCAGG + Intergenic
1129156872 15:73723559-73723581 GACTGAGGTGGAGGGAGGGCAGG + Intergenic
1129577309 15:76764132-76764154 CAATGACTTGTGGGGAATGCAGG + Intronic
1132172384 15:99673671-99673693 GAATAATTTGGAGGGAGGGAAGG + Intronic
1133220059 16:4316020-4316042 GGATGTCTTAGAGGGAGGGCGGG - Intronic
1133447695 16:5876243-5876265 GAATGACTTGCAGAGTGGCCTGG - Intergenic
1134634558 16:15782468-15782490 GAATGAATTTTAGGGAGAGCTGG - Exonic
1135030333 16:19033007-19033029 GAAGGTCATGGAGGGAGGGCTGG + Intronic
1135630749 16:24034241-24034263 AAATGAGTTGTGGGGAGGGAAGG - Intronic
1136595805 16:31249091-31249113 GAAAGAATTGAAGGGATGGCAGG + Intergenic
1139547340 16:67655780-67655802 GAATGGATGGTATGGAGGGCTGG - Intronic
1139910954 16:70397335-70397357 GAAAGCCTTGTAGGGAAGGCCGG - Intronic
1139999410 16:71010884-71010906 GAGTGACAGGTAGGGAGGGGAGG + Intronic
1140949201 16:79799838-79799860 GAATGACTTCTAGGAAATGCTGG - Intergenic
1141911785 16:87065106-87065128 AAATGAATTGAAGGGAGGGGAGG + Intergenic
1142669371 17:1480681-1480703 GAGTGGCTGGCAGGGAGGGCAGG - Intronic
1143289997 17:5821219-5821241 GAATGACTCGTAGGTCTGGCAGG - Intronic
1144018619 17:11220699-11220721 GAAGGAATGGTAGAGAGGGCAGG - Intergenic
1146759926 17:35468264-35468286 CAATGGCTTGTATGGAGGGTTGG - Intronic
1147745787 17:42693579-42693601 TAATGGGATGTAGGGAGGGCAGG + Intronic
1147857182 17:43490298-43490320 GAATGTCCTGTAGGGAAGGGTGG - Intronic
1148231152 17:45935789-45935811 CTAAGACTTGAAGGGAGGGCAGG - Intronic
1149336529 17:55641740-55641762 GAATTACTTGTTGAGAGAGCTGG - Intergenic
1149349371 17:55771748-55771770 GAATGAAATGTAGGGAGGCTTGG + Intronic
1149349971 17:55776499-55776521 GAATGACTATTTGGGCGGGCTGG + Exonic
1149611045 17:57957849-57957871 CAATGACTTGAGGGCAGGGCAGG - Intergenic
1151547454 17:74801883-74801905 GAATTTCATTTAGGGAGGGCTGG - Intronic
1153647087 18:7205009-7205031 GTTTGACTTGTAGGGAGAGCAGG + Intergenic
1155011455 18:21783173-21783195 GAATTTCTTGTAGGGAGCACAGG + Intronic
1155386772 18:25286230-25286252 GAATGAAGTGAAGGGAGGGAAGG + Intronic
1156491409 18:37498531-37498553 GAATGACAGGAAGGGAGGGAGGG - Intronic
1163007728 19:14406977-14406999 GAAGGACTTGGAGGCGGGGCCGG + Intronic
1166720858 19:44994941-44994963 GAATGGGATGTGGGGAGGGCAGG - Intergenic
929525563 2:42699621-42699643 GACTGACTTTTATGGCGGGCGGG + Intronic
931464047 2:62471548-62471570 GAATTCCTTGCAGGTAGGGCTGG + Intergenic
939118802 2:138091501-138091523 GAATGAATTCGAGGGAGGCCAGG + Intergenic
946939780 2:224758614-224758636 GAATGCCTTCTGGTGAGGGCTGG + Intergenic
947182759 2:227426629-227426651 GAATGACCTGCAGAGAGAGCAGG + Intergenic
947377416 2:229510603-229510625 GAATGACTTGTAGAGATGTCTGG + Intronic
948509136 2:238451519-238451541 GCATGACTTGGAGGGGGGCCTGG + Exonic
1170745745 20:19097511-19097533 GAAGGAGTTGCAGGGAGGGCAGG + Intergenic
1172630451 20:36374858-36374880 AAATGACCTGCTGGGAGGGCAGG + Intronic
1172656413 20:36541285-36541307 GAGGGCCTTGTAGGGAGGGGAGG - Intergenic
1174406067 20:50304241-50304263 GCAAGACTTGGAGGGTGGGCTGG + Intergenic
1175931341 20:62495315-62495337 GAATGTCTTGTGGGGTGGGCGGG + Intergenic
1177647075 21:23913200-23913222 GAATAACTTGTAGGGATGTTGGG - Intergenic
1180274526 22:10632222-10632244 AGAAGCCTTGTAGGGAGGGCTGG + Intergenic
1180918686 22:19507009-19507031 GAATGGGTTGTAGGGAGGGCTGG + Intronic
1181746327 22:24957243-24957265 GGATGAGTAGGAGGGAGGGCTGG + Intronic
1183289238 22:36989220-36989242 GAATGACTTAAAGGTAGGGTTGG - Intergenic
1184076046 22:42178822-42178844 GAATTATTTGTAGGCCGGGCGGG - Intronic
1184288828 22:43487422-43487444 GAATGACCTGGAAGGTGGGCAGG + Intronic
1185030371 22:48439793-48439815 GAGTGGGTGGTAGGGAGGGCTGG + Intergenic
1185061232 22:48607905-48607927 CTATGACTTGTGGGGAGGGTGGG + Intronic
949736466 3:7177648-7177670 GAATGAAATGCAGGGAGGGAGGG + Intronic
950769646 3:15301298-15301320 TCATGACTTCAAGGGAGGGCAGG + Intronic
953516838 3:43601868-43601890 GATTGTCTTGAAGGGAGAGCTGG - Intronic
953874677 3:46659890-46659912 AAATGAGTTGCAGGGAGGTCAGG - Intergenic
954898114 3:53994834-53994856 GAAGGACTTGGAGGGCAGGCTGG - Intergenic
962858113 3:139368608-139368630 GAAAGACTTCTAGGGAGGGTGGG - Intronic
963469685 3:145724626-145724648 GAATGAGTTATCGGGAGGTCTGG + Intergenic
966786161 3:183624805-183624827 GGATGGCTTGGAGGGAGAGCAGG + Intergenic
967416640 3:189225705-189225727 AAATGTCCTGTAGGGAGGGTAGG + Intronic
969415654 4:7056245-7056267 GAAAAACTTGTAGGCAGGGCTGG - Exonic
970275578 4:14396480-14396502 GGCAGACTTGTTGGGAGGGCTGG + Intergenic
971745511 4:30574697-30574719 GAATGACTTCTAGGGAGGAAGGG - Intergenic
973734431 4:53856572-53856594 GAATGACTTGTAGGGAGGGCTGG + Intronic
974480093 4:62431771-62431793 TAAACACTTGTAGGGCGGGCTGG + Intergenic
974577227 4:63741867-63741889 GAATGAGTTGAGGGCAGGGCTGG - Intergenic
978715266 4:111834665-111834687 GGATGACTAATAGGGAGGGTTGG - Intergenic
987817204 5:22917931-22917953 GAATGAGTTGAGGGGAGTGCTGG - Intergenic
992393419 5:76350177-76350199 AAATCACATGTATGGAGGGCAGG - Intronic
995816894 5:116179974-116179996 AAATAACTTGGAAGGAGGGCTGG + Intronic
996289777 5:121838956-121838978 GAATGCCTTGTAGAGAAGGTAGG - Intergenic
998100285 5:139427399-139427421 GAATTACAGGTAGGGAGTGCGGG - Intronic
1000477144 5:161724853-161724875 AAATGATTTGTAAGGAGAGCAGG + Intergenic
1001883771 5:175270082-175270104 CAATAACTTGTAGGGTGGGCAGG + Intergenic
1002430485 5:179200677-179200699 GATTAACTTCTGGGGAGGGCAGG + Intronic
1006739990 6:36301293-36301315 GCATGACTTTTAGGCAGGGGAGG - Intronic
1006950259 6:37816211-37816233 CAATGTCTTCTAGGGAGGGTGGG + Intergenic
1007506610 6:42340311-42340333 GACTACCTTGGAGGGAGGGCAGG + Intronic
1008343864 6:50402414-50402436 GAATAAATTGTAGGGAAGACTGG - Intergenic
1009520944 6:64681587-64681609 GAATCACTTTTAGCGAGGCCAGG - Intronic
1009911394 6:69933508-69933530 GAAAGACATGAAGAGAGGGCAGG - Intronic
1011350954 6:86423334-86423356 GTAGAACCTGTAGGGAGGGCAGG - Intergenic
1013256803 6:108395752-108395774 GAATGACCTTGAGGGAGGGAGGG + Intronic
1013352155 6:109315548-109315570 GAATGGGCTGGAGGGAGGGCAGG + Intergenic
1013624712 6:111925692-111925714 AAATGAATTGGAGGGAGGGAGGG + Intergenic
1015491482 6:133831235-133831257 AAATGACTTCTATTGAGGGCAGG + Intergenic
1018178416 6:161199267-161199289 GAAAGAATTGTAGGAGGGGCGGG - Intronic
1018973487 6:168545681-168545703 GAATGGCAGGCAGGGAGGGCAGG - Intronic
1019752244 7:2738608-2738630 AAATGACTTCTAGGGAGGGAGGG + Intronic
1023741601 7:43286152-43286174 GGATGACTTGGAGGGAGGGCAGG + Intronic
1024750253 7:52456505-52456527 GAATTGTTTGTATGGAGGGCAGG - Intergenic
1027480804 7:78694217-78694239 GAATGATTTTTAGGGAGACCTGG - Intronic
1029597595 7:101545918-101545940 GAATGACCTGCAGTGAGGGCGGG - Intronic
1033250115 7:139751525-139751547 GAATGATTTGGAGGGAGGGAGGG + Intronic
1035290570 7:157835571-157835593 GAATGACTAGTAGGAAGAACAGG + Intronic
1036497556 8:9283227-9283249 GAAAGTCTGGTAGGGAGGTCTGG - Intergenic
1039581154 8:38667859-38667881 GAATGGCTTGGAGAGTGGGCTGG - Intergenic
1039806486 8:41004414-41004436 TTAAGACATGTAGGGAGGGCAGG - Intergenic
1039990258 8:42481689-42481711 GATTGTCCTGTAGGGAGGGGTGG + Intronic
1040538105 8:48327155-48327177 GGAAGACTTGTAGGAAGAGCTGG + Intergenic
1040560436 8:48518787-48518809 AACTGGCTTGTAGGGAGTGCTGG - Intergenic
1041426067 8:57721948-57721970 GAATGAATGGTAGGGAGGAAAGG - Intergenic
1041724581 8:61006151-61006173 GAGTCACTTGAAGGGAGGGAAGG + Intergenic
1045016785 8:98007374-98007396 GCATGCCTTCGAGGGAGGGCGGG + Intronic
1045954014 8:107885650-107885672 CTATGTTTTGTAGGGAGGGCAGG + Intergenic
1049616861 8:143579293-143579315 GAATGAGGTGAGGGGAGGGCCGG + Intergenic
1052494541 9:29211595-29211617 GAAATACTTGGAGGGAGGGAGGG - Intergenic
1052746080 9:32442283-32442305 GAATGTCTTGCAGGGAGCGTGGG - Intronic
1053515257 9:38725036-38725058 GAGGGACTTGTAGGGAGTGGTGG + Intergenic
1056641871 9:88378459-88378481 AAATGACCTGTAGGGAGGTGGGG + Intergenic
1062091557 9:134681148-134681170 GCCTGCCTTGCAGGGAGGGCTGG + Intronic
1062334095 9:136057355-136057377 GAATGACTCGAAGGGTGGGGAGG + Intronic
1186168447 X:6852208-6852230 CAATGTCTTGCAGGGAGAGCTGG - Intergenic
1190463800 X:50705721-50705743 AAATGCCTTGTTGGCAGGGCAGG - Intronic
1191058823 X:56272729-56272751 GAATGAATTGTAGTGAGGAAAGG - Intronic
1195057496 X:101160251-101160273 CAATGATTTGGAGGGAGGGAGGG + Intronic
1195766688 X:108303651-108303673 GAATGACTCCTAGGCAAGGCAGG + Intronic
1197720639 X:129742400-129742422 GAATGAATGGGAGGGAGGGGAGG - Intronic