ID: 973736279

View in Genome Browser
Species Human (GRCh38)
Location 4:53874749-53874771
Sequence GGCGGAGTCCCCTTTCCTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973736276_973736279 20 Left 973736276 4:53874706-53874728 CCTAGACTTGGCAACTTCACACT 0: 1
1: 0
2: 1
3: 17
4: 175
Right 973736279 4:53874749-53874771 GGCGGAGTCCCCTTTCCTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973736279 Original CRISPR GGCGGAGTCCCCTTTCCTAC CGG Intronic
No off target data available for this crispr