ID: 973737399

View in Genome Browser
Species Human (GRCh38)
Location 4:53885902-53885924
Sequence CTGGAGTCTGGACTGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 340}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973737385_973737399 24 Left 973737385 4:53885855-53885877 CCAGGCTGGCTTAGCCCTGGGCC 0: 1
1: 0
2: 2
3: 40
4: 360
Right 973737399 4:53885902-53885924 CTGGAGTCTGGACTGGCAGTGGG 0: 1
1: 0
2: 1
3: 29
4: 340
973737392_973737399 3 Left 973737392 4:53885876-53885898 CCAAAAGGCTCCCTGAGGAGGGC 0: 1
1: 0
2: 4
3: 16
4: 174
Right 973737399 4:53885902-53885924 CTGGAGTCTGGACTGGCAGTGGG 0: 1
1: 0
2: 1
3: 29
4: 340
973737395_973737399 -8 Left 973737395 4:53885887-53885909 CCTGAGGAGGGCTCTCTGGAGTC 0: 1
1: 0
2: 2
3: 13
4: 204
Right 973737399 4:53885902-53885924 CTGGAGTCTGGACTGGCAGTGGG 0: 1
1: 0
2: 1
3: 29
4: 340
973737387_973737399 10 Left 973737387 4:53885869-53885891 CCCTGGGCCAAAAGGCTCCCTGA 0: 1
1: 0
2: 1
3: 18
4: 164
Right 973737399 4:53885902-53885924 CTGGAGTCTGGACTGGCAGTGGG 0: 1
1: 0
2: 1
3: 29
4: 340
973737394_973737399 -7 Left 973737394 4:53885886-53885908 CCCTGAGGAGGGCTCTCTGGAGT 0: 1
1: 0
2: 1
3: 20
4: 208
Right 973737399 4:53885902-53885924 CTGGAGTCTGGACTGGCAGTGGG 0: 1
1: 0
2: 1
3: 29
4: 340
973737388_973737399 9 Left 973737388 4:53885870-53885892 CCTGGGCCAAAAGGCTCCCTGAG 0: 1
1: 0
2: 0
3: 19
4: 201
Right 973737399 4:53885902-53885924 CTGGAGTCTGGACTGGCAGTGGG 0: 1
1: 0
2: 1
3: 29
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973737399 Original CRISPR CTGGAGTCTGGACTGGCAGT GGG Intronic
900105396 1:978842-978864 CTGGGATCTGGACGGGCTGTGGG + Intronic
900189002 1:1345453-1345475 CTGGAGGCTGGCCAGGCATTGGG + Intronic
900547160 1:3235588-3235610 CTGGTGTGGGGACTGGCAGGAGG - Intronic
900609486 1:3538477-3538499 CTGCAGTCAGGAATGGCAGCTGG - Intronic
901447663 1:9318147-9318169 CTGGGGTCTGGGCTGACAGCAGG + Intronic
901456210 1:9364321-9364343 CTGTGGTCTGGCCTGGCTGTCGG - Intronic
901678228 1:10898996-10899018 CAGGGGTCTTGACTGGCGGTGGG + Intergenic
902159499 1:14518681-14518703 CTGGAGCCTGGACGGGAAGCCGG - Intergenic
902235865 1:15057025-15057047 CTGCAGGCTGGGCTGGCTGTTGG + Intronic
902413519 1:16225910-16225932 CTGGGGTGGGGACTGGGAGTGGG - Intergenic
902771655 1:18648700-18648722 GATGAGTCTGGACCGGCAGTGGG - Intronic
902788791 1:18751002-18751024 CTGGAATCTGTACTGTCAGGAGG - Intergenic
905013949 1:34764419-34764441 CTCTAGTCTGGATTGGAAGTGGG - Intronic
905301574 1:36989549-36989571 TTGGAGTCTGGCATGGCAGAGGG + Intronic
905483167 1:38275445-38275467 CAGGAGTCTGGCCTTGCAGGGGG + Intergenic
905571073 1:39006212-39006234 GTGGAGGCTGGACTGGTAATGGG + Intergenic
906369490 1:45240715-45240737 CTGGATTCTGGACTTGCATGGGG - Intronic
906570119 1:46830780-46830802 CTGGAGTCTACAGAGGCAGTAGG + Intergenic
907603640 1:55794309-55794331 CTGGGGTCATGAATGGCAGTGGG + Intergenic
909054496 1:70806096-70806118 CTGAAGTCTGGACTCCCAGAAGG + Intergenic
910525838 1:88177300-88177322 CTGGAGTCTTGTCTGGAGGTGGG - Intergenic
911242178 1:95478740-95478762 CTGGAGTTTGGACTTGCATGGGG + Intergenic
912281060 1:108314322-108314344 CTGGAGTGTGCACAAGCAGTAGG + Intergenic
916531416 1:165660221-165660243 CAGAAGCCTGGACTTGCAGTTGG - Intronic
918871173 1:189977103-189977125 CTGGATTTTGGACTGGCATGAGG - Intergenic
918904886 1:190478680-190478702 CTGGGGTTTGGACTTGCAGAGGG - Intergenic
921893591 1:220376883-220376905 CTGGAGTCAGGAATGCCAGCTGG - Intergenic
922410392 1:225368319-225368341 CTGGAGTCAGTACTGACATTTGG - Intronic
922876238 1:228941911-228941933 CTGAAGTCTGCCCTGGCATTTGG - Intergenic
923876783 1:238058342-238058364 CTGGATTCTGGACTTGCATGGGG - Intergenic
924768024 1:247052388-247052410 CTGGACTCTGGGCTGGTACTGGG + Intronic
1062843422 10:688334-688356 CAGAAGTCTGGAAAGGCAGTTGG + Intronic
1063157019 10:3389307-3389329 CTGGAGTCTTGATTTGCAGACGG + Intergenic
1063519618 10:6729209-6729231 CTGGAATCTGGACGGGAACTTGG - Intergenic
1066996612 10:42570123-42570145 CTGGAGCCTGGCCATGCAGTAGG + Intergenic
1067852168 10:49761185-49761207 CTGGAGTCTGGACTGGGCAGGGG - Intronic
1067905898 10:50290613-50290635 CTGCAGTCTGGAGTAGAAGTAGG + Intergenic
1069189363 10:65467519-65467541 CTGGATTTTGGACTTGCATTGGG + Intergenic
1069757479 10:70782065-70782087 ATGGAGTCTCCTCTGGCAGTGGG + Intronic
1070651529 10:78240269-78240291 TCGGAGGCTGGCCTGGCAGTGGG + Intergenic
1070745235 10:78929790-78929812 CTGAAATCTGGAGTGGGAGTTGG + Intergenic
1072021751 10:91409999-91410021 CTGGACTAAGGACGGGCAGTCGG - Intergenic
1072544455 10:96424147-96424169 CTGGAGGCTGGAAGGGTAGTGGG + Intronic
1073420845 10:103422477-103422499 TTTGACTCTGGACTGGCAGTGGG - Intronic
1073636730 10:105206903-105206925 CTGGAATCTCAACTGGCAGATGG + Intronic
1073994080 10:109295482-109295504 CTGGATTTTGGACTTGCAGGGGG + Intergenic
1075153930 10:119958531-119958553 CTGGAGCCTGGTCTGTCACTGGG + Intergenic
1075723302 10:124599481-124599503 CTGGAGGCGGGACTGGCAGAGGG - Intronic
1075977259 10:126706577-126706599 TGGGTGTCTGGACTGGCTGTGGG - Intergenic
1076172868 10:128337427-128337449 ATAGAGTCTGTACCGGCAGTGGG + Intergenic
1076608761 10:131707203-131707225 CTGGTGGCTTGACGGGCAGTTGG - Intergenic
1076985536 11:233343-233365 CTGAAGTCTGGAATGCCACTGGG + Exonic
1077025808 11:439388-439410 CTGGAGGCTGGACTGGGAAGAGG - Intronic
1078117286 11:8466413-8466435 CTGGATTTTGGACTTGCATTGGG - Intronic
1078134188 11:8638595-8638617 CTGGGGTCTTGGCTGGCAGTGGG + Intronic
1078690027 11:13570354-13570376 GTGGAGTCTAGAGAGGCAGTAGG - Intergenic
1079143921 11:17833767-17833789 CTGGATTCTGGACTTGCATGGGG + Intronic
1079253954 11:18810345-18810367 CTGAAGGCTGGAGTGACAGTAGG - Intergenic
1079673575 11:23198567-23198589 CTGGATTCTGGACTTGCATAGGG - Intergenic
1080458282 11:32434271-32434293 CTGGACTCTGGATTCGGAGTGGG - Intronic
1081581998 11:44359031-44359053 GTGGAGGCGGGGCTGGCAGTGGG - Intergenic
1081693460 11:45093948-45093970 CTGGAGTCAGGGCTGGCACTGGG + Intergenic
1081760333 11:45572423-45572445 CTGGAGGGTGAAGTGGCAGTGGG - Intergenic
1083174554 11:60941358-60941380 CTGGACTCTAGACTGGCCCTGGG + Intronic
1083445806 11:62707436-62707458 GTGGAGTCTGTACTGGCTGCGGG - Intronic
1083924291 11:65796639-65796661 CTGGGGTTTGGAGTGGCTGTGGG + Exonic
1083995847 11:66271899-66271921 CTGGGGTCCTGACTGGCAGCTGG + Intronic
1084080522 11:66820981-66821003 TTTGAGTCAGGACTGGGAGTGGG - Intronic
1084173805 11:67413110-67413132 CTGGAGCCTGGACCAGCTGTAGG + Intronic
1084625419 11:70302444-70302466 GTGGAGTCTGGGCGGGCAGAGGG + Intronic
1084952883 11:72676433-72676455 GTGGAGTCTGGTGTGGCAGTGGG - Intergenic
1086933747 11:92722277-92722299 CTGGATTCTGGACTTGCAGGGGG - Intronic
1087606073 11:100379887-100379909 CTGGAGTCAGGACTGGTAGAGGG + Intergenic
1087804387 11:102539700-102539722 CTGGGCTCTGGGCTGGTAGTGGG - Intergenic
1087898303 11:103611848-103611870 GTGGAGTCTATACAGGCAGTAGG - Intergenic
1089300899 11:117498035-117498057 CTGGAATCTGGACTGGCTGACGG - Intronic
1095477368 12:42599329-42599351 ATGGATTCAGGACTGGCACTTGG + Intergenic
1097486787 12:60213139-60213161 CTGGATTCTGGACTTGCATAGGG + Intergenic
1097912138 12:64981967-64981989 GTGGAGTCTAGAGAGGCAGTGGG + Intergenic
1097938663 12:65279440-65279462 CTGGAGTCTGGCCCAGCAGCGGG - Intronic
1101220274 12:102631792-102631814 ATGGAGGCAGGACTGGCAATAGG + Intergenic
1102600644 12:114027255-114027277 CCTGAGTCTGGACTGGCCCTGGG - Intergenic
1104131176 12:125895811-125895833 CTGGAGTCTGGAGTAGCTGGGGG + Intergenic
1104945108 12:132412220-132412242 CTGGGGTCTGGGGTGTCAGTGGG + Intergenic
1105227401 13:18448758-18448780 CTGGATTCTGGACTTGCATGGGG + Intergenic
1105701256 13:22937313-22937335 CTGGGTGCTGGCCTGGCAGTGGG + Intergenic
1105854091 13:24360368-24360390 CTGGGTGCTGGCCTGGCAGTGGG + Intergenic
1108803487 13:54128413-54128435 CTGGAGTCTGGAATGAGACTGGG + Intergenic
1109480339 13:62944750-62944772 CTGGATTTTGGACTGGCATGGGG - Intergenic
1110797808 13:79660111-79660133 CTGGAGTCTGGGGTGAAAGTTGG + Intergenic
1114011849 14:18377211-18377233 CTGGATTCTGGACTTGCATGGGG + Intergenic
1114602941 14:23970505-23970527 GTGGAATCTGGAGAGGCAGTAGG - Intronic
1114607303 14:24007631-24007653 GTGGAATCTGGAGAGGCAGTAGG - Intergenic
1115112546 14:29841042-29841064 CTGGATTCTGGACTTGCATGGGG + Intronic
1115820388 14:37206805-37206827 CTGGATTTTGGACTTGCATTGGG + Intronic
1116099272 14:40411408-40411430 CTGGAGACTCAACTGGCAGCTGG + Intergenic
1116366836 14:44077177-44077199 CTGGAATCTGGTTGGGCAGTAGG - Intergenic
1116950829 14:50877120-50877142 CTGGAGCCTGGTCAGGGAGTGGG - Intronic
1117161790 14:52996698-52996720 CTGGAATCTGGGCTGGCCCTGGG + Intergenic
1118559856 14:67067560-67067582 GTGGAGTCTGTAGAGGCAGTAGG + Intronic
1118591552 14:67405830-67405852 CTGAAGGCTTGACTGGCTGTAGG - Intronic
1119429602 14:74557879-74557901 CTGGGGTCTGGGCTGGTTGTCGG - Intronic
1121322191 14:92998413-92998435 CTGGAGCCTGGGCTGCCGGTGGG - Intronic
1121605677 14:95238155-95238177 CAGGAGTAAGGAGTGGCAGTGGG - Intronic
1122772466 14:104103504-104103526 CTGGGGTCTCGGCTGGCAGGAGG + Intronic
1122986325 14:105213264-105213286 CAGGAGGCAGGCCTGGCAGTTGG + Intronic
1123138322 14:106050914-106050936 CTGGATTTTGGACTTGCAGAGGG + Intergenic
1202860431 14_GL000225v1_random:78563-78585 CTGGTATCTGGACTGGCTCTGGG + Intergenic
1123404258 15:20010815-20010837 CTGGAGTCTGCTCTGGATGTGGG + Intergenic
1123513597 15:21017461-21017483 CTGGAGTCTGCTCTGGATGTGGG + Intergenic
1124233112 15:27964027-27964049 CTTGAGTGTTGACTGGTAGTTGG - Intronic
1124667351 15:31604862-31604884 CTGGAGTCCAGACTGGCTATTGG + Intronic
1125238918 15:37550515-37550537 CTGGGGCCTTGAATGGCAGTGGG - Intergenic
1126372340 15:47960835-47960857 CTGGAGTCTCCACTGCCTGTTGG + Intergenic
1126539245 15:49803983-49804005 CTGGATTTTGGACTTGCAGAGGG - Intergenic
1127339568 15:58026907-58026929 GTGGAGTCTAGAGAGGCAGTAGG - Intronic
1128744446 15:70103641-70103663 CTGGAGCCTGAAATGGGAGTCGG - Intergenic
1131589250 15:93730815-93730837 GGGGAGTCTAGAGTGGCAGTAGG + Intergenic
1132846065 16:2001462-2001484 CTGGGGTCCTGAGTGGCAGTAGG - Intronic
1132892296 16:2210270-2210292 CTGCAGCCTTGGCTGGCAGTGGG + Exonic
1134590413 16:15448333-15448355 CTGGAGTCTGCAGGAGCAGTGGG + Intronic
1135574893 16:23577907-23577929 CTGGAGACAGGACTGGGACTGGG + Intergenic
1137703491 16:50517557-50517579 CTGGTCACTGGACTGGCAGGTGG + Intergenic
1137899134 16:52246108-52246130 CTGGACTCTGCACTGGCTGAAGG - Intergenic
1138282691 16:55784062-55784084 GAGGAGTCTGGAGAGGCAGTCGG + Intergenic
1139088693 16:63618179-63618201 CTGGGGGCTGGGCTGTCAGTTGG - Intergenic
1139352785 16:66347758-66347780 CTGGAATCTGGACTGGAGGTAGG + Intergenic
1140479301 16:75253807-75253829 CGGGAGGCTGGACTGGGGGTGGG - Intronic
1141149395 16:81553511-81553533 CTGGCGCCGGGACAGGCAGTGGG - Intronic
1141502438 16:84453244-84453266 CCGGAGGCTTGGCTGGCAGTGGG + Intronic
1141991206 16:87611355-87611377 GTTGAGTCTGGAAGGGCAGTAGG + Intronic
1142903460 17:3027322-3027344 GAGGAGTCGGGATTGGCAGTGGG + Intronic
1145358219 17:22182972-22182994 CTGCATTCTGGACTGGCATGGGG + Intergenic
1146652141 17:34613520-34613542 CTGGAGTCAGGGGAGGCAGTGGG - Intronic
1146677111 17:34781310-34781332 TTGGAGCCTGGGCTGGCAGTTGG - Intergenic
1148588921 17:48801018-48801040 CTGGAGCCTGTACGTGCAGTTGG - Intronic
1148950346 17:51305456-51305478 GTGGAGTCTGTAGAGGCAGTAGG - Intergenic
1149141460 17:53437322-53437344 CTGGAGGCTGGACTGGAAGGAGG - Intergenic
1151086551 17:71387559-71387581 CTGGATTCTGGGCTTGCACTGGG - Intergenic
1151346900 17:73507846-73507868 CTGGAGTGTGGGCTGGCAGCAGG - Intronic
1152096357 17:78274090-78274112 CTGGCGTCTGGGCTGTGAGTTGG + Intergenic
1152289720 17:79433015-79433037 CTGGAGTCTGTGCTGGGAGAGGG - Intronic
1153613995 18:6917444-6917466 CTGGAGTCTGGTAGGGCAGAAGG - Intergenic
1154525977 18:15290718-15290740 CTGGATTCTGGACTTGCATGGGG - Intergenic
1156583854 18:38410031-38410053 CTGGATTTTGGACTGGCATGAGG + Intergenic
1156607054 18:38679383-38679405 CTGGGCTCTGGGCCGGCAGTGGG + Intergenic
1157948280 18:52005399-52005421 CTGTAGTTCTGACTGGCAGTGGG - Intergenic
1160244605 18:77146964-77146986 CAGGAGTCTGGGCAGGAAGTGGG - Intergenic
1161714983 19:5870717-5870739 CAGGAGGCGGAACTGGCAGTGGG + Intronic
1161869136 19:6856986-6857008 CTGGTGTGTGGAGGGGCAGTAGG + Intronic
1162461558 19:10816917-10816939 CTGGAGTCTGGAGCAGCAGTGGG + Intronic
1162597377 19:11639832-11639854 CTGGAACCTGTACTGGCAGCCGG + Intergenic
1165003731 19:32787530-32787552 GTGGAATCTGGAGAGGCAGTAGG + Intronic
1165460883 19:35943746-35943768 CTGGAGAGATGACTGGCAGTGGG + Intronic
1167768391 19:51499328-51499350 CTGGAATCTTGGCTGGGAGTTGG - Intronic
1168081950 19:54016483-54016505 CTGAAGCCTGAACTGGCCGTGGG - Intergenic
924988979 2:295094-295116 CTGGAGTCTGGACGGAGTGTAGG + Intergenic
925808276 2:7673697-7673719 CTGGGGTCTGGGCTGGTAGCCGG + Intergenic
926598135 2:14813073-14813095 CTGTAGTCTGTACAGGCAGCAGG - Intergenic
927154919 2:20215998-20216020 CTGGAGGCTGGGCATGCAGTGGG - Intronic
928222303 2:29414396-29414418 CTGGAGACTGAACTGGGATTAGG + Intronic
930251580 2:49040691-49040713 GGGGAGTCTGGCCTGGCAGCAGG + Intronic
931535881 2:63276071-63276093 CTGGGCTCTGGGCTGGTAGTGGG - Intronic
931813407 2:65876848-65876870 CTGGAGCCTGGAATTACAGTAGG + Intergenic
932490079 2:72114784-72114806 CTGGGTCCTGGACTGGCTGTTGG + Intergenic
932573368 2:72949963-72949985 ATGGAGTCTGGGGTGCCAGTGGG + Intronic
933770502 2:85741226-85741248 ATGGAGTCTGCAGTGGCTGTCGG - Intergenic
934960565 2:98668874-98668896 CTGGATTCTGGACTTGCATGGGG + Intronic
936288139 2:111197575-111197597 CCTGAGTCTGGACTGGCCCTGGG + Intergenic
936909903 2:117579746-117579768 GTGGAGTCTGTAGAGGCAGTAGG - Intergenic
937036378 2:118785968-118785990 AGGAAGTCTGGACTGGGAGTGGG - Intergenic
938244508 2:129766305-129766327 CTGGAGGCTGCACAGGCAGGTGG - Intergenic
938765464 2:134458231-134458253 GTGGAGGCAGGACTGGCATTTGG - Intronic
941142738 2:161805599-161805621 CTGGATTTTGGACTTGCATTGGG - Intronic
942733289 2:179082341-179082363 CTGGATTCTGGACTTGCATGGGG - Intergenic
942981810 2:182092697-182092719 CTGGATTTTGGACTTGCATTGGG - Intronic
943417865 2:187630897-187630919 CTGGATTTTGGACTTGCATTGGG + Intergenic
946026784 2:216676696-216676718 CTGGAGTCGGGGCTGGGGGTGGG + Exonic
946334604 2:219028682-219028704 CAGGCCTCTGGGCTGGCAGTAGG - Intronic
946374553 2:219300165-219300187 CTGGAGGTAGGGCTGGCAGTGGG + Exonic
947436011 2:230072777-230072799 CTGGAGGCTGGTTTGGCAGCAGG - Intergenic
948865173 2:240771514-240771536 CTGTAGGGTGGCCTGGCAGTGGG - Intronic
948884628 2:240876603-240876625 CTGGACTCTGGACTGGTGGCTGG - Intronic
948922430 2:241071973-241071995 CTGGAGACTGCGCTGGCGGTGGG - Intronic
1169569195 20:6888195-6888217 CTGCCGTCTAGACTGGAAGTGGG + Intergenic
1170503588 20:17000311-17000333 CTGGACTCTTGGCTGGCACTGGG + Intergenic
1170878561 20:20273836-20273858 CTGGAGGCTGGACAGTCTGTGGG + Intronic
1170964112 20:21051167-21051189 CTGGACTCTGGACTGGAATGAGG + Intergenic
1172037284 20:32019070-32019092 CTGCAGCCTGGACTGGCGGATGG + Exonic
1175290659 20:57873015-57873037 CTGGCAGCTGGAGTGGCAGTGGG + Intergenic
1176254322 20:64143071-64143093 CAGGAGTCAGGCCAGGCAGTTGG - Intergenic
1176687381 21:9862780-9862802 CTGGAGTTTGGACTTGCATGGGG + Intergenic
1176771446 21:13077770-13077792 CTGGATTCTGGACTTGCATGGGG + Intergenic
1179507612 21:41852297-41852319 CTGCAGTCTGGGCTGGCCGTGGG + Intronic
1179955044 21:44733885-44733907 CTGGAGCTGGGCCTGGCAGTGGG + Intergenic
1180200684 21:46222320-46222342 CTTGACTCTGGGCTGGCAGCAGG - Intronic
1180436342 22:15308019-15308041 CTGGATTCTGGACTTGCATGGGG + Intergenic
1180518583 22:16172216-16172238 CTGGATTCTGGACTTGCATGGGG + Intergenic
1180904159 22:19396816-19396838 GAGGACGCTGGACTGGCAGTTGG - Exonic
1180968329 22:19802009-19802031 CTGGAGCCTGGACTGGCAGCAGG - Exonic
1180969803 22:19809292-19809314 GTGGAATCTGGCCGGGCAGTTGG + Intronic
1182085525 22:27558503-27558525 GTGGAGTCTGGCCAGGGAGTGGG - Intergenic
1183357687 22:37368350-37368372 CTGGAGTGTGGAGTGGCAGAGGG + Exonic
1183847457 22:40554009-40554031 CTGGATTCTGGACTTGCATGGGG + Intronic
1183977835 22:41523491-41523513 CTGAAGCCTGGGCTGGCAGGAGG + Intronic
1184331298 22:43829572-43829594 CTGGCGTCTGGGCTGGCCCTTGG + Intronic
1184552591 22:45212444-45212466 CTGGTGTCTGGGCTGGAAGCCGG + Exonic
949529341 3:4938853-4938875 CTTGAATCTGGACTGGCCCTGGG - Intergenic
949632545 3:5944180-5944202 GTGGAGTCTGTACAGGCAGTAGG + Intergenic
952195682 3:31073384-31073406 CTGGTTTCTGCACTGTCAGTTGG - Intergenic
953219032 3:40950878-40950900 GTGGAGTCTAGAGAGGCAGTAGG + Intergenic
956373225 3:68586750-68586772 GTGGAGTCTGTAGAGGCAGTAGG + Intergenic
957917835 3:86708973-86708995 GTGGAGTCTAGAGAGGCAGTAGG + Intergenic
958037014 3:88182457-88182479 GTGGAGTCTAGAGAGGCAGTAGG - Intergenic
960156029 3:114297862-114297884 CTGGAGTCTGCAATGGCAAAAGG - Intronic
961025079 3:123548376-123548398 CTGCAGACTGGACTGGAACTGGG - Intronic
961978021 3:131047574-131047596 CTGGGCTCTGGACTGCTAGTGGG + Intronic
962054784 3:131859555-131859577 CTGGAGTGTGGCCTGGGTGTTGG - Intronic
962805616 3:138924956-138924978 CTTGAGACTGGACTGCCAATGGG - Intergenic
963027469 3:140933823-140933845 CAGGAATCTGGAGAGGCAGTTGG - Intergenic
963850151 3:150202992-150203014 CTGGAGTCTGGAATGGTTTTTGG - Intergenic
967811592 3:193765630-193765652 CTGGATTCTGGACTTGCAAAAGG + Intergenic
968289318 3:197526513-197526535 CCTGCGTCTGGAGTGGCAGTCGG - Intronic
968993719 4:3932049-3932071 CTGGTGTCTGGAATGACACTGGG - Intergenic
969392394 4:6900564-6900586 CTGGAGGCTGGGTTGGCTGTGGG + Intergenic
969499563 4:7544541-7544563 CTGGAATCTGCAATGGCAGGGGG - Intronic
969926490 4:10590511-10590533 CTGAATTCTGGACTAACAGTCGG - Intronic
972756871 4:42056926-42056948 CTGGATTCTGGACTTGCATGGGG - Intronic
973737399 4:53885902-53885924 CTGGAGTCTGGACTGGCAGTGGG + Intronic
974654349 4:64800005-64800027 CTGGAATCTAGAGAGGCAGTAGG - Intergenic
975807259 4:78125988-78126010 GTGGAATCTGGACAGGCAGTAGG + Intronic
979078469 4:116304121-116304143 CTGGATTTTGGACTTGCATTGGG + Intergenic
979171010 4:117601183-117601205 CTGGTGTCTGGAATGACACTGGG + Intergenic
979487210 4:121283349-121283371 CTGGGGACTGGCCTGGCACTGGG - Intergenic
980913843 4:139016274-139016296 GTGGAGTCTGGCCTGAAAGTGGG + Intronic
980983301 4:139672058-139672080 CTTGGGGCTGGACTGGGAGTAGG + Intronic
984407304 4:179349876-179349898 CTGGAGTCTGGGCTGTGTGTGGG - Intergenic
985551271 5:534756-534778 CAGGAGTCTGGACAAGCAGCTGG - Intergenic
985576780 5:677328-677350 CTGGAGCCTGGAGGGGCAGGTGG - Intronic
986084784 5:4433593-4433615 TTGGATTCTGGACTGGCATGGGG - Intergenic
986212464 5:5686998-5687020 CTGGGGTTTGGACATGCAGTTGG - Intergenic
986364769 5:7019355-7019377 ATGGAGTTTGGCCAGGCAGTTGG - Intergenic
986627635 5:9737534-9737556 CTGGAGGCTGGACCTGCAGAAGG - Intergenic
986641873 5:9879873-9879895 CTAGAGGCTGGGTTGGCAGTGGG + Intergenic
986877203 5:12126167-12126189 GTGGAGTCTGTAGAGGCAGTAGG - Intergenic
987252349 5:16112435-16112457 CTGGATTCTGGACTTGCATGGGG + Intronic
987954048 5:24714936-24714958 CTGGAGTCTGCGGTGGCAGCTGG + Intergenic
988770350 5:34426984-34427006 CTGGATTTTGGACTGGCATGGGG - Intergenic
989395564 5:40952347-40952369 CTGGGGTCTTGACTTGCATTGGG + Intronic
990260765 5:54020198-54020220 CAGGAACCTGGACTGGCACTGGG + Intronic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
990892894 5:60666565-60666587 CTGGGCTCTGGACTGGTACTGGG + Intronic
991942007 5:71862349-71862371 CTGGAGCCTGGGCTGGCAAGAGG + Intergenic
992659641 5:78945715-78945737 CTGGAGCCTGGACTGCAAGGTGG - Intronic
994677719 5:102846214-102846236 CTGGAGGCTGAAATGGAAGTTGG - Intronic
994832833 5:104808774-104808796 CTAGAGTCTGGAAAGGTAGTGGG + Intergenic
994900355 5:105762308-105762330 CTGGATTTTGGACTGGCATGGGG - Intergenic
995374964 5:111463684-111463706 CTGGGGTCTGGGCTGGTAGTGGG - Intronic
996210981 5:120809529-120809551 CTGGATCCTGGACTGGGAGCAGG - Intergenic
996517872 5:124393790-124393812 CTGGAGGCTGAGATGGCAGTTGG - Intergenic
996918086 5:128734563-128734585 CTGGTGTCTGGAATGAGAGTGGG - Intronic
997234633 5:132265725-132265747 ATGGACCCTGGACTGGCAGGTGG - Intronic
998003025 5:138639556-138639578 CTGGAGGCTGGATTAGCAGCAGG + Intronic
998216719 5:140243097-140243119 CCTGAGTCTGGAGTGGCAGGAGG + Intronic
998378333 5:141706265-141706287 CTGGATTCTGGAGTGACAGAGGG + Intergenic
998613066 5:143710474-143710496 CAGGAATCAGGACTGGCATTGGG + Intergenic
1000935284 5:167298956-167298978 CTGGTGTCTGGACTGAGACTGGG + Intronic
1001389223 5:171365459-171365481 CTGGAGACTGAACTGGGAGCCGG + Intergenic
1002261576 5:177996909-177996931 CTGGAGTCTGGAGTGGGTTTGGG - Intergenic
1002469312 5:179426038-179426060 CTGGAATCTGGATAGGCAATGGG - Intergenic
1002541463 5:179908733-179908755 ATGGGGTCTGGACTGGCCCTGGG + Intergenic
1002764130 6:225196-225218 CTGGAGTCTGCCCTGGCTCTGGG + Intergenic
1003349570 6:5303374-5303396 CTGGTGCCTGGACTGGCACAGGG + Intronic
1003840806 6:10117327-10117349 CAGGTGCGTGGACTGGCAGTGGG + Intronic
1005002706 6:21259162-21259184 CTGGGGTGTGATCTGGCAGTGGG - Intergenic
1005008372 6:21312416-21312438 CTGCAGTCTGGCCTGGCTCTTGG + Intergenic
1006750505 6:36373730-36373752 CAGGAGGCTGGGCTGGCAATGGG + Intronic
1006833198 6:36981349-36981371 CTGCTGTCTGGGCTGGCAGCTGG + Intronic
1006922785 6:37637413-37637435 CTGTGGGCTGGACTGGCAGGGGG + Exonic
1007212546 6:40206881-40206903 CAAGTGTCTGCACTGGCAGTGGG + Intergenic
1008279085 6:49573967-49573989 TTAGAGTCTGGGCTGGGAGTGGG + Intergenic
1012273492 6:97243859-97243881 CTGGGGTCTGGGCTGGTACTGGG + Intronic
1014707424 6:124764786-124764808 CTGGAGTCAGAACAGGCAGGAGG + Intronic
1016094563 6:140020042-140020064 CTGGATTTTGGACTTGCAGGGGG - Intergenic
1016249248 6:142020700-142020722 CTGGTGTCTGGAATGGGACTGGG - Intergenic
1016281707 6:142426341-142426363 CTGGATTCTGGACTTGCACTGGG - Intronic
1017685075 6:156905337-156905359 CTGCAGTATGGGCTGGCAGGTGG + Intronic
1018435283 6:163753366-163753388 CTGCAGTTAGGACTGGAAGTGGG + Intergenic
1018726470 6:166616661-166616683 CTGGGCTCTGGCCTGGCAGAGGG - Intronic
1019123401 6:169823525-169823547 CTGGACTCTGGAATGGTACTGGG + Intergenic
1019293571 7:262085-262107 CCGGAGTCTGGACTGATAGAGGG + Intergenic
1019411721 7:909526-909548 CTGAGGTCTGGACTGGGCGTGGG - Intronic
1020685383 7:11287301-11287323 CTTGAGTATGGCCTAGCAGTTGG + Intergenic
1020869380 7:13608105-13608127 CTGGAGTTTGGACTTGCATGGGG + Intergenic
1020918707 7:14233497-14233519 GTGGAGCGTGGACTGCCAGTGGG - Intronic
1021230571 7:18082491-18082513 CTGGAAACTGGTCTGGCACTGGG + Intergenic
1021282674 7:18739875-18739897 GTGGAGTCTGTAGAGGCAGTAGG + Intronic
1024480061 7:49853360-49853382 CTGAAGTCTGGACTGGTCTTTGG + Intronic
1025715611 7:63952994-63953016 CTGGACTCTGGAATGCCAGTTGG + Intergenic
1025963404 7:66245245-66245267 CTGCAGTCGGGTCTTGCAGTGGG + Intronic
1027230480 7:76268996-76269018 CTGAAGTCAGGGCTGGAAGTGGG + Intronic
1027624836 7:80532520-80532542 CTGGATTTTGGACTGGCAGGGGG + Intronic
1027996839 7:85435079-85435101 CTGGATTTTGGACTTGCATTGGG + Intergenic
1029948229 7:104555925-104555947 CTGGATTCTGGACTTGCATGGGG - Intronic
1030227290 7:107168267-107168289 CTGGGGGCTGCACTGGCAGTGGG - Intergenic
1030577001 7:111300628-111300650 CCGGAGTCAGGACTTGGAGTTGG - Intronic
1031357119 7:120800670-120800692 CTGCAGTGTGGTCTTGCAGTGGG - Intronic
1032475815 7:132210902-132210924 CTGGGGCCTGGTTTGGCAGTGGG + Intronic
1033243769 7:139702104-139702126 CTGGAGTCTGGAGCAGCACTGGG - Intronic
1034700873 7:153094737-153094759 CTGGTGTCTGTGCTGGCAGTGGG + Intergenic
1035037793 7:155906711-155906733 CTGGAGTCTGGACCTGCTGGTGG + Intergenic
1038518839 8:28211554-28211576 CTGGGCTCTGGACTGTCAGTTGG - Intergenic
1039080536 8:33729852-33729874 CTGGAGTGAGGATTGGAAGTAGG - Intergenic
1039131336 8:34267722-34267744 CTGGATTCTTGCCTGGCAGTAGG + Intergenic
1039396232 8:37227546-37227568 CTTGCCTCAGGACTGGCAGTGGG + Intergenic
1040006782 8:42627862-42627884 CTGGAGTCTGAACACGGAGTGGG - Intergenic
1040372933 8:46794903-46794925 CTGGACTCTGGAATTCCAGTTGG - Intergenic
1040380161 8:46864786-46864808 CTGGACTCCGGAATGCCAGTTGG + Intergenic
1040587474 8:48757157-48757179 CTTGAGTCTGGGCTGGCCTTGGG - Intergenic
1043556698 8:81438857-81438879 CTGGGTTCTGGGCTGGCACTAGG + Intergenic
1043961006 8:86418530-86418552 CTGGATTCTGGCCTGTCAGTGGG + Intronic
1045157433 8:99492474-99492496 GTGGAGTCTAGAGAGGCAGTAGG + Intronic
1045300148 8:100903723-100903745 CTGGAGCCTGGATTGGAAGGAGG - Intergenic
1046002263 8:108435116-108435138 CTGTACTCTGGACTGCCAGAAGG - Intronic
1046844516 8:118900952-118900974 CTGGAGTCTGGACTTCATGTAGG + Intergenic
1047255141 8:123208422-123208444 CTGGAGTCTAGACTGGACCTAGG + Exonic
1048710539 8:137205418-137205440 CTGCAGTCTGCAAGGGCAGTTGG + Intergenic
1048768345 8:137868196-137868218 CTGGATTTTGGACTTGCAGGGGG + Intergenic
1048912605 8:139150434-139150456 CTGGAGCCTGGCCTTGCAGAAGG - Intergenic
1048920843 8:139228680-139228702 CTGAAGTTGGGTCTGGCAGTAGG + Intergenic
1049031863 8:140043954-140043976 CTGGAGTCTGACCTGGCTGTAGG - Intronic
1052938037 9:34109765-34109787 CTGGTGTCTGCACTGTGAGTGGG - Intronic
1053703791 9:40729535-40729557 CTGGATTCTGGACTTGCATGGGG - Intergenic
1053781924 9:41618822-41618844 CTGGAGTTTGGACTTGCATGCGG - Intergenic
1054169874 9:61828976-61828998 CTGGAGTTTGGACTTGCATGCGG - Intergenic
1054413874 9:64853144-64853166 CTGGATTCTGGACTTGCATGGGG - Intergenic
1054667664 9:67751839-67751861 CTGGAGTTTGGACTTGCATGCGG + Intergenic
1054926849 9:70598151-70598173 CTGGACACTGGACTAGGAGTTGG - Intronic
1055125943 9:72718502-72718524 CTGGTCTCTGGGCTGGCACTGGG + Intronic
1057542335 9:95987456-95987478 CTGGATTCTGGACTTGCATGGGG - Intronic
1057561373 9:96130521-96130543 GTGGAGTCTGGGCTGGAAGATGG + Intergenic
1057576615 9:96247461-96247483 CTGGGGCCTGGCCTGGGAGTGGG - Intronic
1059348624 9:113649094-113649116 CTGGTGTCTGGGCTGGGAGCAGG + Intergenic
1059796177 9:117699401-117699423 ATGGATTCTGGACTGGTAATGGG + Intergenic
1061054476 9:128215130-128215152 CTCACGTCTGGACTGACAGTGGG - Intronic
1061821281 9:133228328-133228350 CAGGAGTCTGGGCTGGGAGGGGG - Intergenic
1062589176 9:137265771-137265793 CTGAATTCAGGACTGGCAGCGGG - Intronic
1185437253 X:107807-107829 TTAGAGTCTGCACTGGCACTAGG - Intergenic
1185437908 X:114150-114172 TTAGAGTCTGCACTGGCACTAGG - Intergenic
1185438928 X:124091-124113 TTAGAGTCTGCACTGGCACTAGG - Intergenic
1185439363 X:128418-128440 TTAGAGTCTGCACTGGCACTAGG - Intergenic
1185611250 X:1394836-1394858 CTGGAGGCTGGAGTGGCTGCTGG + Intergenic
1185988397 X:4863070-4863092 CTGGAGGATGGAGTGGCATTAGG + Intergenic
1189567268 X:42255490-42255512 CTGGACTCTGGGCTGGTACTGGG - Intergenic
1190097303 X:47491983-47492005 CTGGTCTGTGGACTGGCAGTTGG + Intergenic
1190931014 X:54949834-54949856 CCAGAGTATGGACTGGAAGTAGG + Intronic
1191784584 X:64903742-64903764 CTGGAGCCTGTGCTGGCAGAGGG - Intergenic
1192771421 X:74195704-74195726 ATGGGGCCTGGCCTGGCAGTGGG + Intergenic
1193290005 X:79761829-79761851 CTGGGCTCTGGGCTGGCACTAGG + Intergenic
1193419887 X:81270836-81270858 GTGGAGTCTAGAGAGGCAGTAGG + Intronic
1194084110 X:89505317-89505339 CTGGATTTTGGACTTGCATTGGG - Intergenic
1196540309 X:116900020-116900042 CTGGATTTTGGACTGGCATGGGG - Intergenic
1197040491 X:121930326-121930348 CTGGATTCTGGACTTGCATGGGG + Intergenic
1197561168 X:128024234-128024256 CTGGATTCTGGACTTGCATGGGG - Intergenic
1197728199 X:129790384-129790406 CTGGAGTCTGGCTTGGTTGTGGG + Intronic
1198139774 X:133791156-133791178 CTGGACTCTGTACTGGCCATGGG - Intronic
1199852579 X:151736266-151736288 CTGGGGTCTGGACTGGAGGTGGG - Intergenic
1200436753 Y:3161203-3161225 CTGGATTTTGGACTTGCATTGGG - Intergenic
1202266826 Y:23028348-23028370 CTGGACTCTGGAATTCCAGTTGG - Intergenic
1202419819 Y:24662093-24662115 CTGGACTCTGGAATTCCAGTTGG - Intergenic
1202450967 Y:25007991-25008013 CTGGACTCTGGAATTCCAGTTGG + Intergenic