ID: 973747180

View in Genome Browser
Species Human (GRCh38)
Location 4:53975240-53975262
Sequence GACTCACAGTTCCCCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22190
Summary {0: 5, 1: 251, 2: 3897, 3: 9101, 4: 8936}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973747180 Original CRISPR GACTCACAGTTCCCCAGGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr