ID: 973749292

View in Genome Browser
Species Human (GRCh38)
Location 4:53997336-53997358
Sequence ATGTAGCTGCAGAATTAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973749292 Original CRISPR ATGTAGCTGCAGAATTAGAA AGG Intronic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
902157076 1:14496811-14496833 ATGTAGCATCAGCATTTGAAAGG + Intergenic
902678566 1:18027020-18027042 ATATAAGTGCAGAATTAGGATGG - Intergenic
904961394 1:34336019-34336041 ATGTAGATGCTGGATTAGAAAGG - Intergenic
906022622 1:42643908-42643930 ATGTAGCTACAATATTTGAAGGG + Intronic
906779827 1:48563265-48563287 ATTTAGATGCAGAATTTCAAAGG + Intronic
907010810 1:50960919-50960941 ATATAACTGCAGCAGTAGAAAGG - Intronic
907129118 1:52079479-52079501 ATGCAGCTTCAGGAATAGAAAGG - Intronic
907772356 1:57478212-57478234 CAGTAGTTACAGAATTAGAAAGG + Intronic
909022109 1:70443807-70443829 ACCTACCTGCTGAATTAGAAGGG + Intergenic
909087818 1:71188229-71188251 ATGTAGCTGAAGAATAAGCTAGG - Intergenic
909258071 1:73449741-73449763 TTTTAGTTGCAGATTTAGAATGG - Intergenic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
912735518 1:112146506-112146528 AGGCAGCTTCAGAATTGGAATGG + Intergenic
912938334 1:114023289-114023311 ATTGAGCTGCAGACATAGAAAGG + Intergenic
913048934 1:115098531-115098553 GTGTTTCTGCAGAAATAGAATGG + Intergenic
913387258 1:118272160-118272182 ATCTAGCTGCAGAGGGAGAAAGG + Intergenic
915916254 1:159942643-159942665 AAGCAGTTACAGAATTAGAATGG + Intronic
916822895 1:168417016-168417038 TGGTGGCTGCAGCATTAGAAGGG - Intergenic
917643806 1:177009564-177009586 AAGAAGTTGCAGAAATAGAAGGG + Intronic
920017378 1:202923813-202923835 ATATTGCTGCTGAATCAGAATGG - Intronic
920731024 1:208484589-208484611 ATGTAGCTGCAAATTTAGAGCGG - Intergenic
921516783 1:216102857-216102879 ATGTAGATCCAGGAGTAGAACGG - Intronic
923074491 1:230597525-230597547 ATGTAGGGGCAGAAATAAAAAGG + Intergenic
923089101 1:230725427-230725449 ATGTTGCTGCAGTAGTATAAGGG - Intergenic
923410298 1:233701480-233701502 AGCTAGCAGCAGAATTGGAAAGG - Intergenic
924566880 1:245206176-245206198 AGGGAGCTGGAGAATAAGAAGGG - Intronic
924579419 1:245311061-245311083 ATGAAGCTGAAGAAGGAGAAAGG + Intronic
1064470480 10:15630192-15630214 ATGTTTGTGCAGAATGAGAATGG - Intronic
1067480494 10:46593739-46593761 ATGTAACTGGAGTCTTAGAAGGG - Intronic
1067614244 10:47748060-47748082 ATGTAACTGGAGTCTTAGAAGGG + Intergenic
1069237185 10:66091329-66091351 ATGTAGCTACAGAATAAATAGGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070693949 10:78547998-78548020 ATGTGGGTGGAGAATTAGGAGGG - Intergenic
1071786854 10:88910537-88910559 ATGTAGCATCAGAATTAGAAGGG - Intronic
1074311821 10:112328934-112328956 ATCAAGCTGCAGACATAGAAAGG + Intergenic
1075199904 10:120393983-120394005 ATGTAGTTTTAGATTTAGAAAGG + Intergenic
1076080261 10:127573733-127573755 ATGCAGATCCAGAATCAGAAAGG + Intergenic
1079725200 11:23871924-23871946 AGGTAGGTGCTGAATTATAAAGG - Intergenic
1083031269 11:59594862-59594884 AGCTGGCTTCAGAATTAGAAAGG - Intronic
1084038555 11:66528505-66528527 GTGTGGATGCAGAAATAGAATGG + Intronic
1085587279 11:77721448-77721470 ATGTAAGTGCAGCATTAAAAGGG + Intronic
1085828398 11:79872945-79872967 TTCTAGATGCAAAATTAGAAAGG + Intergenic
1085855208 11:80168548-80168570 AGGCATCTGCAGAATTAGAAGGG + Intergenic
1087167336 11:95018605-95018627 ATGTAGTTATAGAATTAAAAAGG - Intergenic
1088138699 11:106589728-106589750 AAGTCGCAGCAGATTTAGAAGGG - Intergenic
1088500124 11:110474691-110474713 AAGGAGCTGCAGATTTTGAATGG + Intergenic
1088833049 11:113554521-113554543 ATCGAGCTGCAGACATAGAAAGG + Intergenic
1091809118 12:3380128-3380150 ATGGCTCTGCAGAATTGGAAAGG + Intergenic
1093688259 12:22081108-22081130 TTGCATCTGTAGAATTAGAAGGG - Intronic
1094203499 12:27816793-27816815 AGGCAGCAGTAGAATTAGAAAGG + Intergenic
1095931567 12:47631435-47631457 ATGCAGTTGCAGAAGTAGATGGG + Intergenic
1096929461 12:55190473-55190495 ATGTAGTTGGAGAATTGGCAAGG + Intergenic
1097511968 12:60554315-60554337 AAGTAGATGCAGATTTTGAAAGG - Intergenic
1097968416 12:65606136-65606158 CAGTAGCTGTAGAATTTGAAGGG - Intergenic
1099328270 12:81247419-81247441 ATGTAACAGCAGAATGAGATAGG + Intronic
1099869592 12:88330008-88330030 GTGGAGCTGCAGACTTGGAAAGG + Intergenic
1102776863 12:115527269-115527291 ATGTATTTGTTGAATTAGAATGG + Intergenic
1103236625 12:119378334-119378356 ATCAAGCTGCAGACATAGAAAGG - Intronic
1103791219 12:123472761-123472783 ATATAGCAGCAAACTTAGAAGGG + Intronic
1105257287 13:18752416-18752438 ATGTAGATGCAGGTTCAGAAGGG - Intergenic
1106443080 13:29797494-29797516 ATGTCAGTGCAGAATTTGAAGGG - Intronic
1106565969 13:30884949-30884971 ATCAAGCTGCAGACATAGAAAGG - Intergenic
1106975378 13:35205238-35205260 ATGTAGGTGCAGAAAAAGATCGG + Intronic
1108420610 13:50245311-50245333 ATGAAGAAGCAGAATTAGAGAGG - Intronic
1108767078 13:53644444-53644466 ATATAGCTGCATAATTACATGGG + Intergenic
1109651991 13:65339256-65339278 ATGAAAGTACAGAATTAGAAAGG + Intergenic
1110619654 13:77581022-77581044 ATGTTGCAGCATAATTAGAAAGG - Intronic
1110830012 13:80019923-80019945 ATGTTGGAGCTGAATTAGAACGG - Intergenic
1110863708 13:80371693-80371715 GTGTAACTGCAGACATAGAAGGG + Intergenic
1119442137 14:74635571-74635593 ATGTGGATGCAGAATTGGAAGGG + Intergenic
1120814818 14:88844946-88844968 ATCTAGCTGAAGAAATAAAATGG + Intronic
1120901137 14:89576623-89576645 AAGCTACTGCAGAATTAGAAGGG + Intronic
1120909715 14:89655167-89655189 AGATAGCTGCACAATTAGAAAGG + Intergenic
1122726040 14:103753180-103753202 TTATAGCTGCTGAAATAGAAAGG - Exonic
1123504411 15:20925458-20925480 ATATAGCTGCTTTATTAGAATGG + Intergenic
1123561657 15:21499159-21499181 ATATAGCTGCTTTATTAGAATGG + Intergenic
1123597901 15:21936440-21936462 ATATAGCTGCTTTATTAGAATGG + Intergenic
1123949277 15:25254497-25254519 ATCTAGCTAAAGAATTAGATTGG + Intergenic
1124228292 15:27916580-27916602 ATGTTTCTGCAGATTTAGAAGGG - Intronic
1124800634 15:32829503-32829525 ATGTGGCTGCTGGAGTAGAATGG + Intronic
1127188715 15:56507093-56507115 AGGAAGCTGCAGTATGAGAAGGG - Intergenic
1127328482 15:57917151-57917173 ATGAAGCTGCTAAAGTAGAATGG + Intergenic
1128428094 15:67563743-67563765 ATGTAGCTGCAGGCTTAATATGG + Intronic
1128487219 15:68105563-68105585 AGGAAGCTGCAGACTTAGAAAGG - Intronic
1128659301 15:69486287-69486309 ATGGACCTGAATAATTAGAAAGG - Intergenic
1128989843 15:72250590-72250612 ATGTGGCTGAAGAAATAGATTGG - Intronic
1130147365 15:81284353-81284375 CTGGAGCTTCTGAATTAGAAAGG + Intronic
1202970002 15_KI270727v1_random:226284-226306 ATATAGCTGCTTTATTAGAATGG + Intergenic
1133070900 16:3246300-3246322 ATGGAGCTGCAGACTGGGAAGGG - Intronic
1133362206 16:5183367-5183389 ATCGAGCTGCAGACATAGAAAGG - Intergenic
1137279374 16:46962298-46962320 ATGTTGCTGCATAATTAAATTGG - Intronic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138727209 16:59152819-59152841 ATCAAGCTGCAGACATAGAAAGG - Intergenic
1139325779 16:66151662-66151684 ATGTTGCTGTAGCATTATAAAGG + Intergenic
1146243648 17:31256745-31256767 ATATAGCTGCTTTATTAGAATGG - Intronic
1147489789 17:40855195-40855217 ATGTAGCTGCTCAAATTGAAGGG - Intergenic
1150900629 17:69272932-69272954 ATGTAGGTGAAGTGTTAGAAAGG + Intronic
1153549396 18:6245555-6245577 ATGTAGCTTCAGAGTTAAGAAGG - Intronic
1154059990 18:11050746-11050768 TTGGAGAGGCAGAATTAGAAAGG - Intronic
1155608372 18:27634171-27634193 ATGTTGCTGCAAAATGAGCAGGG + Intergenic
1155996960 18:32340504-32340526 ATGAAGCTGCAGAATAGGCAGGG + Intronic
1156003923 18:32418047-32418069 ATGTTGGTGGAGAATTGGAATGG - Intronic
1156689472 18:39689827-39689849 ATGTAGGTGTAGAAATTGAATGG - Intergenic
1157484580 18:48077927-48077949 ATGTCTATGCAGAATTAGAGGGG + Intronic
1158338913 18:56444516-56444538 ATGTGGCTGGAAAATTAGGAAGG - Intergenic
1159064340 18:63553221-63553243 GTGTAGTGCCAGAATTAGAATGG + Intergenic
1159275635 18:66217889-66217911 ATTAAGCTAAAGAATTAGAAAGG - Intergenic
1159952182 18:74492714-74492736 TTGGAGCTGGAGAATTAGATTGG + Intergenic
1163899869 19:20091774-20091796 ATGGTGCTGCAGAATATGAAAGG + Intronic
1164153262 19:22572420-22572442 ATGGTGCTGCAGAATATGAAAGG - Intergenic
1164235345 19:23327364-23327386 ATGTATCTTCAGAAATAAAAGGG + Intronic
1164261740 19:23573778-23573800 ATGTAGCAGCAGATTTATTATGG + Intronic
1164710903 19:30356630-30356652 TTGTAGCTGCTGAATGAGATCGG + Intronic
1165508943 19:36254940-36254962 ATGTCTCTCAAGAATTAGAAAGG - Intergenic
1165631751 19:37307095-37307117 ATGTCTCTCAAGAATTAGAAAGG + Intergenic
1165984216 19:39753352-39753374 AAGCAGCTGCACAAATAGAAAGG - Intergenic
925696937 2:6590486-6590508 ATTTTACTGCAGAATTTGAAAGG + Intergenic
927604793 2:24477127-24477149 CTGTAGGAGCAGAGTTAGAAAGG - Intergenic
930262825 2:49167282-49167304 ATGAAGCTGCAGAATAAAAATGG - Intergenic
930460631 2:51670018-51670040 ACGTAGATGGAAAATTAGAAAGG - Intergenic
930669488 2:54133312-54133334 ATGCAGCTGCAGCAATAAAAAGG - Intronic
930949467 2:57121466-57121488 AGGTTGCAGCAGAGTTAGAAAGG - Intergenic
931283365 2:60812657-60812679 AAGTAGCTTCAGAATGATAAAGG - Intergenic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
935283977 2:101547143-101547165 ATGTTTCTGCAGAAGCAGAATGG - Intergenic
935409990 2:102751524-102751546 ATCAAGCTGCAGACATAGAAGGG - Intronic
935829574 2:106986954-106986976 ATTCAGCTGCAGAATTAAAAGGG + Intergenic
936626530 2:114155093-114155115 ATTGAGCTGCAGACATAGAAAGG + Intergenic
939238059 2:139522950-139522972 ATGAAGCTGCAGAAGTATAAAGG - Intergenic
940164342 2:150752826-150752848 ATGTTGCTTCAGAAAAAGAAAGG + Intergenic
943382836 2:187172283-187172305 AAGTACCTGCAGAATGATAATGG - Intergenic
943848907 2:192690488-192690510 AGGCAGATGCAGAAATAGAATGG - Intergenic
946055650 2:216899777-216899799 AGATAGCTGCAAAAATAGAAAGG + Intergenic
947233857 2:227919910-227919932 CTGTAGGTGCAGAAGCAGAAAGG - Intronic
948621542 2:239238391-239238413 ATGTAGCTGCAGTTTTCCAATGG + Intronic
1169054141 20:2606012-2606034 ATGTACATGCTGAATTAGAGAGG - Intronic
1170413332 20:16113724-16113746 ATTGAGCTGCAGACATAGAAAGG - Intergenic
1173286187 20:41673386-41673408 ATCAAGCTGCAGACATAGAAAGG + Intergenic
1173755268 20:45510250-45510272 ATGTGGCTGCAGAGTAAGAGAGG - Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
949171842 3:1009223-1009245 ATGTAGCTGCACAATGAAGAAGG - Intergenic
952910681 3:38182193-38182215 AGGCAGCTGCAGAGATAGAACGG - Intronic
955178299 3:56639652-56639674 AGGTAGCTGCAGAGATAAAATGG - Intronic
955581178 3:60424674-60424696 ATGTAGCTGAAGAGTCAGCAGGG + Intronic
955647362 3:61154374-61154396 AAGAACCTGCAGAATCAGAAAGG + Intronic
956611673 3:71130083-71130105 CTGTAGATGCAGAATTACAAAGG + Intronic
958013390 3:87910092-87910114 ATGTATATGAAGAATAAGAAGGG - Intergenic
958906379 3:99946523-99946545 ATGTAGCTGCAGCTAAAGAATGG + Intronic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
959839730 3:110960322-110960344 ATAAAGCTGCAGACTTAGACAGG - Intergenic
960926238 3:122797150-122797172 ATGTAGCTGCTAAAAAAGAAAGG + Intronic
962452398 3:135531247-135531269 ATGAAGCTGGAGAAATAGACAGG - Intergenic
962934440 3:140066748-140066770 ATGCATCTGATGAATTAGAATGG - Intronic
963625016 3:147660277-147660299 TTGAAGCTGCGGAAATAGAATGG - Intergenic
964038215 3:152224497-152224519 ATGTAGCTGCAGATCTAGTTAGG + Intergenic
964568198 3:158081513-158081535 ATTTACCAGCAGAATTAGTAAGG - Intergenic
965353013 3:167638905-167638927 ATCCAGCTGGTGAATTAGAAGGG + Intronic
966381785 3:179351883-179351905 ATGTTGCTGCAAAATTGAAATGG - Exonic
966971212 3:185047137-185047159 ATGTGGCTACAGAAACAGAAAGG - Intronic
967129937 3:186461328-186461350 ATGTATCTCCACAATGAGAACGG - Intergenic
967572400 3:191045292-191045314 AAGCAGCAGCAGAATTTGAAAGG + Intergenic
967861859 3:194158358-194158380 ATTTAACTCCTGAATTAGAATGG + Intergenic
969959247 4:10926664-10926686 ATACAGCTTCAGAATTTGAAGGG + Intergenic
973141660 4:46776692-46776714 CTGTAGCTGCTGAAATAAAATGG - Intronic
973749292 4:53997336-53997358 ATGTAGCTGCAGAATTAGAAAGG + Intronic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
974439590 4:61899088-61899110 ATGGAGCTGCAGAGGTAGAAAGG - Intronic
974671047 4:65030622-65030644 ATGTAGCTGCATAAATTGAAAGG + Intergenic
976520064 4:86016501-86016523 ATGTAGCTTCCAAATTTGAATGG - Exonic
976543676 4:86307952-86307974 CTCTAGCTGCAGAATTATAGAGG + Intronic
978406250 4:108382192-108382214 ATGCAGCTACAGAAAGAGAATGG + Intergenic
978979861 4:114929995-114930017 ATGTAGCCCCAGAATGAAAAGGG + Intronic
979184185 4:117767760-117767782 ATGTAGCTGCAGAATAATAAAGG - Intergenic
979203018 4:118002043-118002065 TTTTAGCTGCAGAGTCAGAAAGG - Intergenic
980853233 4:138409052-138409074 ATTTTGATGCAGAATTGGAATGG - Intergenic
981935041 4:150230183-150230205 ATGTTGCTGCAGTATTTGAAAGG + Intronic
981968446 4:150635171-150635193 ATCTAGGAGCAGAATTTGAAAGG - Intronic
982096958 4:151931976-151931998 ATCAAGCTGCAGACATAGAAAGG - Intergenic
983295130 4:165857273-165857295 ATGTAGATCCAGAATTATATGGG + Intergenic
984115874 4:175681097-175681119 ATGTATCTTTAGAATTAGGATGG + Intronic
985506326 5:283109-283131 TCGTAGCTGCAGAATCAGAGAGG + Intronic
985787154 5:1902523-1902545 ATGTAGCTACTGAATTGTAATGG - Intergenic
987787312 5:22518312-22518334 ATGTAGCAGAAGTATTACAATGG + Intronic
990117083 5:52402493-52402515 AAGTACTTGCAGAATCAGAAAGG + Intergenic
990120950 5:52450734-52450756 ATGTAGCTGCAGAGAGAAAAGGG - Intergenic
990895010 5:60689720-60689742 ATGTAGAAGCAGAAATATAACGG + Intronic
991035875 5:62126951-62126973 ATGCAGCAGCAGAAAAAGAATGG + Intergenic
991166366 5:63568457-63568479 ATTTTCCTGCAGAAGTAGAACGG + Intergenic
992212981 5:74498535-74498557 ATGTAGCTGCAGAATGTCAAAGG - Intergenic
992250722 5:74873466-74873488 ATGAAGCTGCAGAAATAGGCAGG + Intergenic
992266948 5:75028838-75028860 ATGGAGCTGCAGAATTAAGGTGG - Exonic
993874996 5:93296029-93296051 GTTTAGCAGCAGAATTAGAGAGG + Intergenic
999192267 5:149757170-149757192 CTGAAGCTGGAGAATCAGAAAGG + Intronic
1000628515 5:163566125-163566147 ACGTATCTGCAGAACAAGAATGG - Intergenic
1001389310 5:171366107-171366129 AATTGGCTGCAGAATCAGAAGGG - Intergenic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1005431771 6:25764912-25764934 ATGTTATTGCAGAATTAAAATGG + Intronic
1005431847 6:25765656-25765678 ATGTCACTGCAGAGTTAAAATGG + Intronic
1007503247 6:42314795-42314817 ATGTGACTGAGGAATTAGAAGGG + Intronic
1007892188 6:45305970-45305992 AGGTATATGCAGAATTAGAGAGG - Intronic
1009272770 6:61635852-61635874 TTGTAACTGATGAATTAGAATGG - Intergenic
1009642649 6:66358052-66358074 ATGTATATGTAGAATTTGAATGG + Intergenic
1013315715 6:108940693-108940715 ATCAAGCTGCAGACATAGAAAGG - Intronic
1013765992 6:113574924-113574946 ATGTGGTTGCAGAAAGAGAAAGG - Intergenic
1014410421 6:121110996-121111018 GTGTAGCTGCATCAGTAGAAAGG + Intronic
1014893863 6:126875567-126875589 ATGTGGCAGAAGAAATAGAAGGG + Intergenic
1015610141 6:135008413-135008435 AGGTAGCTGGAGGATGAGAAAGG - Intronic
1018020155 6:159755082-159755104 CTGCTGCTGCAGAACTAGAATGG - Exonic
1021002385 7:15348523-15348545 ATGTTGCTGAATAATTATAATGG - Intronic
1022634166 7:32116220-32116242 TTGTAGGTGCAGAAATAAAAGGG - Intronic
1023202155 7:37710376-37710398 ATGTAGCTGCAGGGTTGGAGGGG - Intronic
1023211023 7:37804906-37804928 ATCGAGCTGCAGACATAGAAAGG + Intronic
1028232141 7:88318558-88318580 GTGTAGCTACAGAATAAAAATGG - Intergenic
1030181807 7:106717360-106717382 AAGTAACTGAAGCATTAGAAGGG + Intergenic
1030853628 7:114522674-114522696 ATGTAGTTACAGAATTATTAAGG + Intronic
1032932494 7:136689757-136689779 CTGAAGCTGGAGAATTAGATCGG - Intergenic
1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1038924732 8:32126016-32126038 ATGCATGTGAAGAATTAGAAAGG - Intronic
1041179790 8:55235721-55235743 ATGACGCTGCAGCAATAGAAAGG + Intronic
1042240814 8:66662447-66662469 CTGTATCTGCAGAAATGGAATGG - Intronic
1044083335 8:87912286-87912308 ATGTAGAAGCTGAATTGGAAAGG + Intergenic
1046093711 8:109533656-109533678 ATGTAGCTGGAAAAACAGAAAGG - Intergenic
1047063282 8:121251576-121251598 AAGTAGGTGCAGTATGAGAAAGG - Intergenic
1048719576 8:137308296-137308318 AGGTCCCTGCAGGATTAGAATGG - Intergenic
1050344013 9:4668437-4668459 AGAAATCTGCAGAATTAGAAAGG + Intergenic
1051834319 9:21318033-21318055 ATGTAGGTGTAGAACTACAAGGG - Intergenic
1053062717 9:35044369-35044391 ATCTAGCTTCAGAATCAGACAGG - Exonic
1053526231 9:38833311-38833333 AGGCAGCTGCTGAATTGGAATGG + Intergenic
1054198457 9:62057735-62057757 AGGCAGCTGCTGAATTGGAATGG + Intergenic
1054639896 9:67530626-67530648 AGGCAGCTGCTGAATTGGAATGG - Intergenic
1054876120 9:70097993-70098015 ATCTTCCTGCTGAATTAGAAAGG - Intronic
1055434936 9:76283183-76283205 AAGTAGCAGCAGAATTTGAGAGG + Intronic
1055823023 9:80290723-80290745 TTGAAGCTGCTGAAATAGAAAGG + Intergenic
1060824896 9:126682344-126682366 ATGGGGCTGCAGCTTTAGAAGGG - Intronic
1061085838 9:128397739-128397761 CGGTAGCTGAAGAATTAGCAAGG + Intergenic
1061473838 9:130849439-130849461 ATGTATCTGCAGATTTGGCAAGG + Intronic
1187544836 X:20239444-20239466 ATGTAGCTAGAGAATGAGTATGG + Intronic
1189214531 X:39311695-39311717 TTGTAGCTCCAGAAAAAGAAAGG - Intergenic
1190256276 X:48765102-48765124 CTGAAGCTGCAGAATGGGAAAGG + Intronic
1192281287 X:69688789-69688811 ATGAAACTGCAGAAGTAGCAAGG + Intronic
1192959248 X:76109967-76109989 CTGTAGCTACAGAAATAAAATGG + Intergenic
1193835999 X:86344656-86344678 ATCTATCTGCAGGATTAGAAAGG - Intronic
1194448980 X:94018806-94018828 AAGTAGCTGCAGAATGGTAAGGG - Intergenic
1194675859 X:96793060-96793082 ATGTAACAGCAGCATTATAAAGG - Intronic
1197823131 X:130561643-130561665 ATGAAGCTGGAGAATTAGGCGGG + Intergenic
1198437370 X:136630372-136630394 ATGGGGCTGAACAATTAGAAGGG - Intergenic
1199693089 X:150323996-150324018 ATGTATGTGGAGAATTAGAGTGG + Intergenic
1199788686 X:151129451-151129473 AAGCAGCAGCAGAATTTGAAAGG - Intergenic