ID: 973752177

View in Genome Browser
Species Human (GRCh38)
Location 4:54032289-54032311
Sequence CATCAGAGGGAGACCGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 87, 2: 25, 3: 15, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973752177_973752181 -8 Left 973752177 4:54032289-54032311 CCCTCTACGGTCTCCCTCTGATG 0: 1
1: 87
2: 25
3: 15
4: 113
Right 973752181 4:54032304-54032326 CTCTGATGCCGAGCCGAAGCTGG 0: 419
1: 561
2: 478
3: 168
4: 133
973752177_973752184 13 Left 973752177 4:54032289-54032311 CCCTCTACGGTCTCCCTCTGATG 0: 1
1: 87
2: 25
3: 15
4: 113
Right 973752184 4:54032325-54032347 GGACTGTACTGCTGCCATCTCGG 0: 791
1: 492
2: 154
3: 345
4: 7246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973752177 Original CRISPR CATCAGAGGGAGACCGTAGA GGG (reversed) Intronic
900146319 1:1160401-1160423 CAAGGGAGGGAGACAGTAGAGGG + Intergenic
901108485 1:6776377-6776399 CATCAGAGTGAGACTTGAGATGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901669434 1:10847004-10847026 CATCAGATGGAGACCCCAGAAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915528482 1:156490227-156490249 CATGAGAAGGAGACCCGAGAGGG - Intronic
915627320 1:157122966-157122988 CAGGTGAGGGAGACAGTAGATGG - Exonic
916320666 1:163499733-163499755 CAAGAGAGGGAGACCGTAGAAGG + Intergenic
917219749 1:172716344-172716366 CATCAGAGTGAGCCCCTGGAGGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
917596557 1:176535024-176535046 AACCAGAGGGAGACTGTAGAAGG + Intronic
918015349 1:180628328-180628350 CAACAGAGGGAGAAGGAAGAAGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923486210 1:234433824-234433846 CCTATGAGGGAGACCTTAGATGG + Intronic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069741622 10:70688829-70688851 CATGAGAGGGAGACCGGAGGGGG + Intronic
1070013310 10:72498253-72498275 TATCAGTGGGAGAAAGTAGATGG - Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1074897711 10:117791464-117791486 GGTCAGAGGGAGACTGAAGAAGG - Intergenic
1074944498 10:118268254-118268276 CATCAGAGGATGACCGGAAATGG - Intergenic
1074984123 10:118642251-118642273 CCTCAGAGGGAGACAGTCCATGG + Intergenic
1076284680 10:129282000-129282022 CATAGGAGGGAGAGGGTAGAGGG - Intergenic
1077593790 11:3514007-3514029 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1081746010 11:45473095-45473117 CCACAGAGGGAGACCGTTGGTGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1084249602 11:67886735-67886757 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088184103 11:107144246-107144268 CAGCAGTGGGAGACTGTAGAGGG - Intergenic
1089526025 11:119097245-119097267 CACCAGAGTGAGACTGAAGATGG - Exonic
1089742773 11:120596456-120596478 CTTCAGAGAGAGACTGGAGAAGG + Intronic
1090596418 11:128325332-128325354 CTTCTGAGGGAGAAGGTAGATGG + Intergenic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1092419889 12:8322134-8322156 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1097689856 12:62724526-62724548 CCTCAGAGGGAGAGGGTAGGTGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1100371754 12:93975136-93975158 GATCAGAGAGAGACAGTACATGG - Intergenic
1101397696 12:104363028-104363050 CAGCAGAGGGAGATGGTAAAGGG + Intergenic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1106434264 13:29709832-29709854 CATCAGAAGGAGACTGCAGGAGG + Intergenic
1107737880 13:43417187-43417209 CAACAGAGGGAGACGGGAGACGG + Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116108250 14:40540042-40540064 CATTAGAGGGACCCAGTAGAGGG - Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1120432095 14:84432187-84432209 CAAGAGAATGAGACCGTAGATGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1125534658 15:40436302-40436324 CTCCAGAGGGAGAGCGTGGAGGG - Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127946947 15:63764925-63764947 CAACAGAGCAAGACCCTAGAAGG - Intronic
1129285742 15:74523094-74523116 AATCAGAGGGAGACAGTCTATGG + Intergenic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140340598 16:74155907-74155929 CAGCAGAGAGACACCATAGAAGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143814031 17:9496760-9496782 CATCAGAGGGAGTATGAAGAAGG + Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1151536508 17:74741914-74741936 CAGGAGAGGGAGACCGAAGTGGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG + Intergenic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153492875 18:5667707-5667729 GAGAAGAGGGAGACCCTAGAGGG + Intergenic
1161727255 19:5936765-5936787 CATCAGTGGGTGACCGTCTATGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163928157 19:20364702-20364724 CTTCAGAGGGAGGCAGTACAGGG - Intergenic
1164196820 19:22974877-22974899 CAACAGAGGGAGACTGTCTAGGG - Intergenic
1164219909 19:23184025-23184047 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
924970799 2:126228-126250 CATGAGAGGGAAACTGTGGAAGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928009654 2:27595107-27595129 CAACAGAGGGAGACCGAAGAAGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
939278086 2:140027702-140027724 CATCTGGGGGTGACGGTAGACGG - Intergenic
940161176 2:150715159-150715181 CATCAGAGGGACCTGGTAGAAGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941663178 2:168216250-168216272 AATCAGAGGGAGACAGATGAAGG + Intronic
942783279 2:179671603-179671625 CATCATAGGCACACAGTAGAAGG + Intronic
942937431 2:181575115-181575137 CATCAGTGGGAGAAGGGAGAAGG - Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945140599 2:206682583-206682605 CATCAAAGAGAGAGTGTAGAGGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
948550579 2:238770007-238770029 AATCAGAGGGAGTCCTCAGAAGG - Intergenic
1168917580 20:1503782-1503804 CATCATAGGCAGACACTAGAGGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169454682 20:5741838-5741860 CAACAGAGTGAGACCGTATCCGG + Intergenic
1170786353 20:19470974-19470996 CCTCAGAGGGAGACGGCACAAGG + Intronic
1173965452 20:47109138-47109160 CTTCAGGGGGAGACCCTGGATGG - Intronic
1175743577 20:61437393-61437415 CGTCACAGGGAGACAGAAGATGG - Intronic
1178584193 21:33859121-33859143 CGTCCGAGGGAAAGCGTAGAGGG - Intronic
1179614562 21:42573391-42573413 CCTCAGAGGGAGACAGCACAGGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183270122 22:36856720-36856742 CAGCAGAGGGAGACAGAAAAGGG + Intergenic
1183310338 22:37106331-37106353 CATTAGAGGAAGCCCGAAGAGGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1185283869 22:49990568-49990590 CAACAGAGGGAGACCAGAGAGGG + Intergenic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950715062 3:14842135-14842157 CCTCAGAGGGAAATGGTAGAAGG - Intronic
951793713 3:26515481-26515503 CAACAGAGGGAGACGGGAGAGGG - Intergenic
954166627 3:48764604-48764626 CAACAGTGGGAGAACATAGAAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954882961 3:53847894-53847916 CATCAAAAGGAGATCTTAGAAGG + Intronic
957063843 3:75504691-75504713 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960814426 3:121658345-121658367 CATCTGAGAGTGACCGGAGATGG + Exonic
961897577 3:130181327-130181349 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963525403 3:146409360-146409382 CTTCAGAGGGAGGCAGTACAGGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967984058 3:195082380-195082402 CACCAGAGGGAGAGAGAAGATGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
969007743 4:4034893-4034915 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
969745870 4:9071169-9071191 CTTCAGAGGGAGGCAGTACAGGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG + Intergenic
975070177 4:70125768-70125790 AAGCAGAGGGAGACCTTAGGTGG - Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG + Intronic
977474605 4:97489765-97489787 CTTCAGAAGGAGACCTTTGAAGG - Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
986122756 5:4857429-4857451 CATCAGAGGGTGATGGGAGATGG - Intergenic
986659029 5:10042468-10042490 CAGCAGAGGAGGACTGTAGAGGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990190112 5:53250051-53250073 CAGCTGAGGGAGAGTGTAGAGGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
993923542 5:93837347-93837369 CATCAGTGGTAGACTGCAGAAGG - Intronic
994081392 5:95711685-95711707 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
998714940 5:144872440-144872462 CATGATGAGGAGACCGTAGAAGG + Intergenic
998875812 5:146597945-146597967 CATTAGAGAGAGACCGCTGAAGG - Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000372896 5:160554273-160554295 TATGAGAGGGAGACAGAAGAAGG - Intergenic
1001131985 5:169071924-169071946 CGTCACAGAGAGACAGTAGAAGG + Intronic
1001316403 5:170644092-170644114 CAGCAGAGGAAGCCCATAGAGGG + Intronic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1005167764 6:22944738-22944760 CATCAGAGGAAGATGGAAGAGGG + Intergenic
1005303987 6:24496090-24496112 CTTCAGAGGGAGAGCTTTGAAGG - Intronic
1005738939 6:28773362-28773384 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1007694001 6:43720109-43720131 CATCAAAGGCAGAGCGCAGAGGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009392613 6:63163369-63163391 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1012710821 6:102602119-102602141 CATCAGTGAAAGACCGGAGAAGG + Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1013661818 6:112305801-112305823 CATCACTGGGAGGCCGAAGAGGG - Intergenic
1013751705 6:113414693-113414715 CAACAGAGGGAGCCTGGAGATGG + Intergenic
1014987443 6:128029202-128029224 CAAGAGAGGGAGACAGGAGAGGG - Intronic
1015240074 6:131012183-131012205 CAACTGAGGGAGACTCTAGATGG + Intronic
1017375712 6:153765742-153765764 GATGAGAGGGATAGCGTAGATGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020328267 7:6993024-6993046 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1025775000 7:64553609-64553631 CATCAGAGGGAGACAGGAGAGGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026535214 7:71233443-71233465 CAACAGAAGTAGACCTTAGAAGG + Intronic
1028283180 7:88959568-88959590 TATCAGAGGAAGAGCTTAGAAGG - Intronic
1031003596 7:116446586-116446608 CATCAGAGGGAGACGTAAGGAGG - Intronic
1033185542 7:139224890-139224912 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034571598 7:151960577-151960599 AATCAGAGGAAGAGCCTAGATGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1036368358 8:8141091-8141113 CTTCAGAGGGAGGCAGTACAGGG - Intergenic
1036882530 8:12524551-12524573 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1038538641 8:28373004-28373026 CATCAGCTGGAGACCAAAGAGGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038687715 8:29733800-29733822 CATCAGAGGGTGAAGGGAGAGGG - Intergenic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1043821528 8:84871683-84871705 CCTCAGAGGGATACTCTAGAGGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046703444 8:117426195-117426217 CAACAGAGGGAGACCAAAGAAGG - Intergenic
1048104714 8:131395451-131395473 CATCACAGGCAGAACGGAGAGGG - Intergenic
1050021055 9:1284945-1284967 CATCAGAGAGAGAACCAAGAAGG - Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051269988 9:15346141-15346163 CCCCAGTGGGAGACCCTAGAAGG - Intergenic
1052552596 9:29970025-29970047 CATGGGAGGGAGACCGAAGGTGG - Intergenic
1055294567 9:74820953-74820975 AAGCAGAGGGAGATGGTAGAGGG + Intronic
1060396340 9:123319441-123319463 CCTCGGAGGGAGAGCATAGAGGG - Intergenic
1062385877 9:136311358-136311380 CCTCAGAGGGAGCCCCTAGGTGG + Intergenic
1062407898 9:136406110-136406132 CTACAGAGGGAGACCACAGACGG + Intronic
1203548804 Un_KI270743v1:151842-151864 CTTCAGCGGGAGTCCGTTGAAGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192350313 X:70350463-70350485 CAACAGAGGGAGACGGGAGAGGG + Intronic
1194713379 X:97262467-97262489 CAAGTGAGGGAGAACGTAGAAGG + Intronic
1199491783 X:148407949-148407971 TATCAAAGGGAGAATGTAGATGG - Intergenic
1202028601 Y:20551023-20551045 CAACAGAGGGAGACCGAAGAAGG - Intergenic