ID: 973754896

View in Genome Browser
Species Human (GRCh38)
Location 4:54064749-54064771
Sequence CGGTGGCCTGGGAGCGCGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 208}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973754896_973754902 5 Left 973754896 4:54064749-54064771 CCTCGCGCGCTCCCAGGCCACCG 0: 1
1: 0
2: 3
3: 16
4: 208
Right 973754902 4:54064777-54064799 CCTCTGCTTCTACCCGCAGACGG 0: 1
1: 0
2: 0
3: 10
4: 145
973754896_973754904 13 Left 973754896 4:54064749-54064771 CCTCGCGCGCTCCCAGGCCACCG 0: 1
1: 0
2: 3
3: 16
4: 208
Right 973754904 4:54064785-54064807 TCTACCCGCAGACGGCGACCGGG 0: 1
1: 0
2: 0
3: 2
4: 13
973754896_973754908 30 Left 973754896 4:54064749-54064771 CCTCGCGCGCTCCCAGGCCACCG 0: 1
1: 0
2: 3
3: 16
4: 208
Right 973754908 4:54064802-54064824 ACCGGGGCGCGCGCTCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 136
973754896_973754905 14 Left 973754896 4:54064749-54064771 CCTCGCGCGCTCCCAGGCCACCG 0: 1
1: 0
2: 3
3: 16
4: 208
Right 973754905 4:54064786-54064808 CTACCCGCAGACGGCGACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
973754896_973754903 12 Left 973754896 4:54064749-54064771 CCTCGCGCGCTCCCAGGCCACCG 0: 1
1: 0
2: 3
3: 16
4: 208
Right 973754903 4:54064784-54064806 TTCTACCCGCAGACGGCGACCGG 0: 1
1: 0
2: 0
3: 1
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973754896 Original CRISPR CGGTGGCCTGGGAGCGCGCG AGG (reversed) Intronic