ID: 973754897

View in Genome Browser
Species Human (GRCh38)
Location 4:54064760-54064782
Sequence CAGAGGAAAGACGGTGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 269}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973754897_973754905 3 Left 973754897 4:54064760-54064782 CCCAGGCCACCGTCTTTCCTCTG 0: 1
1: 0
2: 2
3: 18
4: 269
Right 973754905 4:54064786-54064808 CTACCCGCAGACGGCGACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
973754897_973754911 23 Left 973754897 4:54064760-54064782 CCCAGGCCACCGTCTTTCCTCTG 0: 1
1: 0
2: 2
3: 18
4: 269
Right 973754911 4:54064806-54064828 GGGCGCGCGCTCCCGCCGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 238
973754897_973754910 22 Left 973754897 4:54064760-54064782 CCCAGGCCACCGTCTTTCCTCTG 0: 1
1: 0
2: 2
3: 18
4: 269
Right 973754910 4:54064805-54064827 GGGGCGCGCGCTCCCGCCGGCGG 0: 1
1: 0
2: 1
3: 20
4: 200
973754897_973754903 1 Left 973754897 4:54064760-54064782 CCCAGGCCACCGTCTTTCCTCTG 0: 1
1: 0
2: 2
3: 18
4: 269
Right 973754903 4:54064784-54064806 TTCTACCCGCAGACGGCGACCGG 0: 1
1: 0
2: 0
3: 1
4: 16
973754897_973754904 2 Left 973754897 4:54064760-54064782 CCCAGGCCACCGTCTTTCCTCTG 0: 1
1: 0
2: 2
3: 18
4: 269
Right 973754904 4:54064785-54064807 TCTACCCGCAGACGGCGACCGGG 0: 1
1: 0
2: 0
3: 2
4: 13
973754897_973754902 -6 Left 973754897 4:54064760-54064782 CCCAGGCCACCGTCTTTCCTCTG 0: 1
1: 0
2: 2
3: 18
4: 269
Right 973754902 4:54064777-54064799 CCTCTGCTTCTACCCGCAGACGG 0: 1
1: 0
2: 0
3: 10
4: 145
973754897_973754908 19 Left 973754897 4:54064760-54064782 CCCAGGCCACCGTCTTTCCTCTG 0: 1
1: 0
2: 2
3: 18
4: 269
Right 973754908 4:54064802-54064824 ACCGGGGCGCGCGCTCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973754897 Original CRISPR CAGAGGAAAGACGGTGGCCT GGG (reversed) Intronic