ID: 973754898

View in Genome Browser
Species Human (GRCh38)
Location 4:54064761-54064783
Sequence GCAGAGGAAAGACGGTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 306}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973754898_973754905 2 Left 973754898 4:54064761-54064783 CCAGGCCACCGTCTTTCCTCTGC 0: 1
1: 0
2: 1
3: 20
4: 306
Right 973754905 4:54064786-54064808 CTACCCGCAGACGGCGACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
973754898_973754911 22 Left 973754898 4:54064761-54064783 CCAGGCCACCGTCTTTCCTCTGC 0: 1
1: 0
2: 1
3: 20
4: 306
Right 973754911 4:54064806-54064828 GGGCGCGCGCTCCCGCCGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 238
973754898_973754902 -7 Left 973754898 4:54064761-54064783 CCAGGCCACCGTCTTTCCTCTGC 0: 1
1: 0
2: 1
3: 20
4: 306
Right 973754902 4:54064777-54064799 CCTCTGCTTCTACCCGCAGACGG 0: 1
1: 0
2: 0
3: 10
4: 145
973754898_973754908 18 Left 973754898 4:54064761-54064783 CCAGGCCACCGTCTTTCCTCTGC 0: 1
1: 0
2: 1
3: 20
4: 306
Right 973754908 4:54064802-54064824 ACCGGGGCGCGCGCTCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 136
973754898_973754910 21 Left 973754898 4:54064761-54064783 CCAGGCCACCGTCTTTCCTCTGC 0: 1
1: 0
2: 1
3: 20
4: 306
Right 973754910 4:54064805-54064827 GGGGCGCGCGCTCCCGCCGGCGG 0: 1
1: 0
2: 1
3: 20
4: 200
973754898_973754904 1 Left 973754898 4:54064761-54064783 CCAGGCCACCGTCTTTCCTCTGC 0: 1
1: 0
2: 1
3: 20
4: 306
Right 973754904 4:54064785-54064807 TCTACCCGCAGACGGCGACCGGG 0: 1
1: 0
2: 0
3: 2
4: 13
973754898_973754903 0 Left 973754898 4:54064761-54064783 CCAGGCCACCGTCTTTCCTCTGC 0: 1
1: 0
2: 1
3: 20
4: 306
Right 973754903 4:54064784-54064806 TTCTACCCGCAGACGGCGACCGG 0: 1
1: 0
2: 0
3: 1
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973754898 Original CRISPR GCAGAGGAAAGACGGTGGCC TGG (reversed) Intronic