ID: 973754899

View in Genome Browser
Species Human (GRCh38)
Location 4:54064766-54064788
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 420}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973754899_973754911 17 Left 973754899 4:54064766-54064788 CCACCGTCTTTCCTCTGCTTCTA 0: 1
1: 0
2: 3
3: 35
4: 420
Right 973754911 4:54064806-54064828 GGGCGCGCGCTCCCGCCGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 238
973754899_973754910 16 Left 973754899 4:54064766-54064788 CCACCGTCTTTCCTCTGCTTCTA 0: 1
1: 0
2: 3
3: 35
4: 420
Right 973754910 4:54064805-54064827 GGGGCGCGCGCTCCCGCCGGCGG 0: 1
1: 0
2: 1
3: 20
4: 200
973754899_973754905 -3 Left 973754899 4:54064766-54064788 CCACCGTCTTTCCTCTGCTTCTA 0: 1
1: 0
2: 3
3: 35
4: 420
Right 973754905 4:54064786-54064808 CTACCCGCAGACGGCGACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
973754899_973754903 -5 Left 973754899 4:54064766-54064788 CCACCGTCTTTCCTCTGCTTCTA 0: 1
1: 0
2: 3
3: 35
4: 420
Right 973754903 4:54064784-54064806 TTCTACCCGCAGACGGCGACCGG 0: 1
1: 0
2: 0
3: 1
4: 16
973754899_973754904 -4 Left 973754899 4:54064766-54064788 CCACCGTCTTTCCTCTGCTTCTA 0: 1
1: 0
2: 3
3: 35
4: 420
Right 973754904 4:54064785-54064807 TCTACCCGCAGACGGCGACCGGG 0: 1
1: 0
2: 0
3: 2
4: 13
973754899_973754908 13 Left 973754899 4:54064766-54064788 CCACCGTCTTTCCTCTGCTTCTA 0: 1
1: 0
2: 3
3: 35
4: 420
Right 973754908 4:54064802-54064824 ACCGGGGCGCGCGCTCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973754899 Original CRISPR TAGAAGCAGAGGAAAGACGG TGG (reversed) Intronic