ID: 973754900

View in Genome Browser
Species Human (GRCh38)
Location 4:54064769-54064791
Sequence GGGTAGAAGCAGAGGAAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 974
Summary {0: 1, 1: 1, 2: 2, 3: 106, 4: 864}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973754900_973754903 -8 Left 973754900 4:54064769-54064791 CCGTCTTTCCTCTGCTTCTACCC 0: 1
1: 1
2: 2
3: 106
4: 864
Right 973754903 4:54064784-54064806 TTCTACCCGCAGACGGCGACCGG 0: 1
1: 0
2: 0
3: 1
4: 16
973754900_973754904 -7 Left 973754900 4:54064769-54064791 CCGTCTTTCCTCTGCTTCTACCC 0: 1
1: 1
2: 2
3: 106
4: 864
Right 973754904 4:54064785-54064807 TCTACCCGCAGACGGCGACCGGG 0: 1
1: 0
2: 0
3: 2
4: 13
973754900_973754905 -6 Left 973754900 4:54064769-54064791 CCGTCTTTCCTCTGCTTCTACCC 0: 1
1: 1
2: 2
3: 106
4: 864
Right 973754905 4:54064786-54064808 CTACCCGCAGACGGCGACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
973754900_973754908 10 Left 973754900 4:54064769-54064791 CCGTCTTTCCTCTGCTTCTACCC 0: 1
1: 1
2: 2
3: 106
4: 864
Right 973754908 4:54064802-54064824 ACCGGGGCGCGCGCTCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 136
973754900_973754910 13 Left 973754900 4:54064769-54064791 CCGTCTTTCCTCTGCTTCTACCC 0: 1
1: 1
2: 2
3: 106
4: 864
Right 973754910 4:54064805-54064827 GGGGCGCGCGCTCCCGCCGGCGG 0: 1
1: 0
2: 1
3: 20
4: 200
973754900_973754911 14 Left 973754900 4:54064769-54064791 CCGTCTTTCCTCTGCTTCTACCC 0: 1
1: 1
2: 2
3: 106
4: 864
Right 973754911 4:54064806-54064828 GGGCGCGCGCTCCCGCCGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973754900 Original CRISPR GGGTAGAAGCAGAGGAAAGA CGG (reversed) Intronic