ID: 973754901

View in Genome Browser
Species Human (GRCh38)
Location 4:54064777-54064799
Sequence CCGTCTGCGGGTAGAAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973754901_973754910 5 Left 973754901 4:54064777-54064799 CCTCTGCTTCTACCCGCAGACGG 0: 1
1: 0
2: 1
3: 5
4: 59
Right 973754910 4:54064805-54064827 GGGGCGCGCGCTCCCGCCGGCGG 0: 1
1: 0
2: 1
3: 20
4: 200
973754901_973754915 27 Left 973754901 4:54064777-54064799 CCTCTGCTTCTACCCGCAGACGG 0: 1
1: 0
2: 1
3: 5
4: 59
Right 973754915 4:54064827-54064849 GGCCCCCCTCCGCCGACTTCTGG 0: 1
1: 1
2: 2
3: 7
4: 105
973754901_973754916 28 Left 973754901 4:54064777-54064799 CCTCTGCTTCTACCCGCAGACGG 0: 1
1: 0
2: 1
3: 5
4: 59
Right 973754916 4:54064828-54064850 GCCCCCCTCCGCCGACTTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 103
973754901_973754911 6 Left 973754901 4:54064777-54064799 CCTCTGCTTCTACCCGCAGACGG 0: 1
1: 0
2: 1
3: 5
4: 59
Right 973754911 4:54064806-54064828 GGGCGCGCGCTCCCGCCGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 238
973754901_973754908 2 Left 973754901 4:54064777-54064799 CCTCTGCTTCTACCCGCAGACGG 0: 1
1: 0
2: 1
3: 5
4: 59
Right 973754908 4:54064802-54064824 ACCGGGGCGCGCGCTCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973754901 Original CRISPR CCGTCTGCGGGTAGAAGCAG AGG (reversed) Intronic