ID: 973754906

View in Genome Browser
Species Human (GRCh38)
Location 4:54064789-54064811
Sequence GCGCCCCGGTCGCCGTCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 83}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973754906_973754910 -7 Left 973754906 4:54064789-54064811 CCCGCAGACGGCGACCGGGGCGC 0: 1
1: 0
2: 1
3: 9
4: 83
Right 973754910 4:54064805-54064827 GGGGCGCGCGCTCCCGCCGGCGG 0: 1
1: 0
2: 1
3: 20
4: 200
973754906_973754911 -6 Left 973754906 4:54064789-54064811 CCCGCAGACGGCGACCGGGGCGC 0: 1
1: 0
2: 1
3: 9
4: 83
Right 973754911 4:54064806-54064828 GGGCGCGCGCTCCCGCCGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 238
973754906_973754927 30 Left 973754906 4:54064789-54064811 CCCGCAGACGGCGACCGGGGCGC 0: 1
1: 0
2: 1
3: 9
4: 83
Right 973754927 4:54064842-54064864 ACTTCTGGGTGGCGGACCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 96
973754906_973754916 16 Left 973754906 4:54064789-54064811 CCCGCAGACGGCGACCGGGGCGC 0: 1
1: 0
2: 1
3: 9
4: 83
Right 973754916 4:54064828-54064850 GCCCCCCTCCGCCGACTTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 103
973754906_973754923 22 Left 973754906 4:54064789-54064811 CCCGCAGACGGCGACCGGGGCGC 0: 1
1: 0
2: 1
3: 9
4: 83
Right 973754923 4:54064834-54064856 CTCCGCCGACTTCTGGGTGGCGG 0: 1
1: 0
2: 0
3: 10
4: 99
973754906_973754920 19 Left 973754906 4:54064789-54064811 CCCGCAGACGGCGACCGGGGCGC 0: 1
1: 0
2: 1
3: 9
4: 83
Right 973754920 4:54064831-54064853 CCCCTCCGCCGACTTCTGGGTGG 0: 1
1: 0
2: 1
3: 10
4: 95
973754906_973754915 15 Left 973754906 4:54064789-54064811 CCCGCAGACGGCGACCGGGGCGC 0: 1
1: 0
2: 1
3: 9
4: 83
Right 973754915 4:54064827-54064849 GGCCCCCCTCCGCCGACTTCTGG 0: 1
1: 1
2: 2
3: 7
4: 105
973754906_973754908 -10 Left 973754906 4:54064789-54064811 CCCGCAGACGGCGACCGGGGCGC 0: 1
1: 0
2: 1
3: 9
4: 83
Right 973754908 4:54064802-54064824 ACCGGGGCGCGCGCTCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 136
973754906_973754926 29 Left 973754906 4:54064789-54064811 CCCGCAGACGGCGACCGGGGCGC 0: 1
1: 0
2: 1
3: 9
4: 83
Right 973754926 4:54064841-54064863 GACTTCTGGGTGGCGGACCCTGG 0: 1
1: 0
2: 0
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973754906 Original CRISPR GCGCCCCGGTCGCCGTCTGC GGG (reversed) Intronic