ID: 973754908

View in Genome Browser
Species Human (GRCh38)
Location 4:54064802-54064824
Sequence ACCGGGGCGCGCGCTCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 136}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973754896_973754908 30 Left 973754896 4:54064749-54064771 CCTCGCGCGCTCCCAGGCCACCG 0: 1
1: 0
2: 3
3: 16
4: 208
Right 973754908 4:54064802-54064824 ACCGGGGCGCGCGCTCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 136
973754906_973754908 -10 Left 973754906 4:54064789-54064811 CCCGCAGACGGCGACCGGGGCGC 0: 1
1: 0
2: 1
3: 9
4: 83
Right 973754908 4:54064802-54064824 ACCGGGGCGCGCGCTCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 136
973754898_973754908 18 Left 973754898 4:54064761-54064783 CCAGGCCACCGTCTTTCCTCTGC 0: 1
1: 0
2: 1
3: 20
4: 306
Right 973754908 4:54064802-54064824 ACCGGGGCGCGCGCTCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 136
973754901_973754908 2 Left 973754901 4:54064777-54064799 CCTCTGCTTCTACCCGCAGACGG 0: 1
1: 0
2: 1
3: 5
4: 59
Right 973754908 4:54064802-54064824 ACCGGGGCGCGCGCTCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 136
973754899_973754908 13 Left 973754899 4:54064766-54064788 CCACCGTCTTTCCTCTGCTTCTA 0: 1
1: 0
2: 3
3: 35
4: 420
Right 973754908 4:54064802-54064824 ACCGGGGCGCGCGCTCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 136
973754897_973754908 19 Left 973754897 4:54064760-54064782 CCCAGGCCACCGTCTTTCCTCTG 0: 1
1: 0
2: 2
3: 18
4: 269
Right 973754908 4:54064802-54064824 ACCGGGGCGCGCGCTCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 136
973754900_973754908 10 Left 973754900 4:54064769-54064791 CCGTCTTTCCTCTGCTTCTACCC 0: 1
1: 1
2: 2
3: 106
4: 864
Right 973754908 4:54064802-54064824 ACCGGGGCGCGCGCTCCCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973754908 Original CRISPR ACCGGGGCGCGCGCTCCCGC CGG Intronic