ID: 973758640

View in Genome Browser
Species Human (GRCh38)
Location 4:54098321-54098343
Sequence TTGGAGCCACTGATGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 229}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973758640_973758643 -9 Left 973758640 4:54098321-54098343 CCATTCTCCATCAGTGGCTCCAA 0: 1
1: 0
2: 2
3: 36
4: 229
Right 973758643 4:54098335-54098357 TGGCTCCAAGCCTTCTTCTTGGG 0: 1
1: 0
2: 1
3: 13
4: 155
973758640_973758649 9 Left 973758640 4:54098321-54098343 CCATTCTCCATCAGTGGCTCCAA 0: 1
1: 0
2: 2
3: 36
4: 229
Right 973758649 4:54098353-54098375 TTGGGGCTGAAATGATTTCGGGG 0: 1
1: 0
2: 0
3: 5
4: 107
973758640_973758647 7 Left 973758640 4:54098321-54098343 CCATTCTCCATCAGTGGCTCCAA 0: 1
1: 0
2: 2
3: 36
4: 229
Right 973758647 4:54098351-54098373 TCTTGGGGCTGAAATGATTTCGG 0: 1
1: 0
2: 0
3: 17
4: 228
973758640_973758648 8 Left 973758640 4:54098321-54098343 CCATTCTCCATCAGTGGCTCCAA 0: 1
1: 0
2: 2
3: 36
4: 229
Right 973758648 4:54098352-54098374 CTTGGGGCTGAAATGATTTCGGG No data
973758640_973758642 -10 Left 973758640 4:54098321-54098343 CCATTCTCCATCAGTGGCTCCAA 0: 1
1: 0
2: 2
3: 36
4: 229
Right 973758642 4:54098334-54098356 GTGGCTCCAAGCCTTCTTCTTGG 0: 1
1: 0
2: 0
3: 10
4: 139
973758640_973758644 -8 Left 973758640 4:54098321-54098343 CCATTCTCCATCAGTGGCTCCAA 0: 1
1: 0
2: 2
3: 36
4: 229
Right 973758644 4:54098336-54098358 GGCTCCAAGCCTTCTTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973758640 Original CRISPR TTGGAGCCACTGATGGAGAA TGG (reversed) Intronic
905133924 1:35783332-35783354 TTGGAGTCCCAGATGGAGAGGGG - Intergenic
905199141 1:36304756-36304778 CTGGAGCTGCTGGTGGAGAACGG - Exonic
907158319 1:52354133-52354155 TTGGAGCCACTGAGGGTGGTTGG - Intronic
907775128 1:57506753-57506775 TTGGAGCCATTGATAGAAACTGG - Intronic
908150368 1:61295041-61295063 TTGCTGCCAGTGAGGGAGAAAGG + Intronic
909465971 1:75974418-75974440 TTGGAGCCACCCATGGAGGAAGG - Intergenic
910730056 1:90385319-90385341 CTGCAGCCACTGGTGGAGAATGG - Intergenic
912802686 1:112730366-112730388 TAGGAGGGTCTGATGGAGAAGGG + Intergenic
913078633 1:115361290-115361312 CTGGAGCCACTGCTGCAGAAGGG + Intergenic
913931660 1:124974179-124974201 TTGAAGCCTATGATGGAAAAGGG - Intergenic
914684228 1:149964283-149964305 TTGTATGCACTGATGGAGAAGGG - Exonic
915301346 1:154953300-154953322 TTGGAGCCAGTGTTGGAGTGAGG - Intronic
915734156 1:158074217-158074239 GAGGAGCCACTCATGGAGTATGG + Intronic
916997428 1:170315794-170315816 TTGGAGACAATGATGAAGAAAGG - Intergenic
917508266 1:175648654-175648676 TTGCTGCCACAGAAGGAGAAAGG - Intronic
918587256 1:186202409-186202431 TTGGAACCACTGGTGGCCAAAGG - Intergenic
919455759 1:197818217-197818239 ATGCAGCCACTGCTGGAGGATGG - Intergenic
919643283 1:200066321-200066343 TGGGAGCCATTTGTGGAGAAGGG + Intronic
919818565 1:201457971-201457993 TTGGTGGCAGTGATGGAGAAGGG - Intergenic
920877732 1:209852947-209852969 TGGGAGCCACTGTCTGAGAAAGG - Exonic
921643675 1:217587030-217587052 TTGGAACTACTGATGGTGTATGG + Intronic
923736643 1:236615518-236615540 TTGGAGCAAGTGATGGAGTTTGG + Intergenic
923861968 1:237900318-237900340 TTGGAGGCATTGATTTAGAAAGG - Intergenic
924168995 1:241317437-241317459 TTGGAGCCAAATATGGGGAAAGG + Intronic
1062798696 10:363366-363388 ATGGAGCCCCTGATGGCGGAGGG - Intronic
1063255577 10:4323689-4323711 TTGAAGATACTGAGGGAGAAGGG + Intergenic
1063836692 10:10022615-10022637 CTGGAGCATCTGATGGAAAAGGG - Intergenic
1065229514 10:23582943-23582965 TGGTACCCACTGATGGAGAAAGG + Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067432151 10:46251814-46251836 TGGAAGCCACAGATGGACAAGGG - Intergenic
1067729005 10:48795650-48795672 TTGGAGCCATTGATGGGGAATGG + Intronic
1073519305 10:104111675-104111697 TTGAAGCCAGGGATGGAGATAGG - Intergenic
1074570787 10:114622178-114622200 TTGGAGTATCTGATGGGGAATGG - Intronic
1074851800 10:117445109-117445131 TTGGCCTTACTGATGGAGAAAGG - Intergenic
1075041780 10:119113583-119113605 TTGGGGGCACTGAGGGTGAAGGG + Intronic
1075141644 10:119842587-119842609 TTGAAACAACTGAAGGAGAAAGG + Exonic
1075632636 10:124010491-124010513 TTGGAAGCACTGAGGGAGGAAGG + Intronic
1076519617 10:131073505-131073527 TTGGAGGCCCTGATGGAGGCAGG - Intergenic
1076910884 10:133388762-133388784 AAGGAACCACTGATGGAGCAGGG - Intronic
1077553186 11:3212939-3212961 CTGGATCAACTTATGGAGAACGG - Intergenic
1078133177 11:8630260-8630282 TTGGTGCCACCCATGCAGAAGGG + Intronic
1078271400 11:9798361-9798383 AAGGAGCCAGTGATGGAGAGGGG + Intronic
1079539648 11:21557499-21557521 TTGTAGCCACTGGTGGTGGATGG + Intronic
1081893225 11:46562606-46562628 GTGGAGACACTTATTGAGAAGGG + Intronic
1082305792 11:50572818-50572840 TTGGGGCCAATGGTGAAGAAAGG - Intergenic
1082988484 11:59187392-59187414 TTGGAGCCACTGTTGGGGGGAGG + Intronic
1083016265 11:59457453-59457475 TTGGGGCCACAGAAGGGGAATGG - Exonic
1083127634 11:60587560-60587582 TTGGAGACACTGAGAGGGAAAGG - Intergenic
1083609175 11:63997027-63997049 CTGCAGCCACGGAGGGAGAAAGG - Intronic
1085687035 11:78632921-78632943 TCTGAGCCACAGAAGGAGAAGGG + Intergenic
1087598540 11:100284116-100284138 GTGGGGCCACTGCTGGGGAATGG + Intronic
1088697882 11:112383899-112383921 TTGGAGTAACTGAAGGAGATGGG + Intergenic
1088972819 11:114788388-114788410 TTGCAGACACTGCTGGAGGAAGG + Intergenic
1089644598 11:119870414-119870436 TTAGTGCCTCTGATTGAGAAAGG - Intergenic
1089809550 11:121120589-121120611 ATGGAGACAGTGCTGGAGAAGGG - Intronic
1090408560 11:126492256-126492278 TTGGAGACACAGCTGGGGAAGGG + Intronic
1093012064 12:14117855-14117877 TTGGAGTCCCAGAAGGAGAAGGG + Intergenic
1096298190 12:50401448-50401470 GTGGGGCCACGGATGGAGAAAGG + Intronic
1096699486 12:53372708-53372730 TTGAAGGCCCTGAAGGAGAAAGG - Intergenic
1098455795 12:70672041-70672063 TTGGGCCCAGAGATGGAGAATGG + Intronic
1098522471 12:71449111-71449133 TTGAAGCGAGGGATGGAGAAAGG - Intronic
1099047910 12:77746600-77746622 TTGGAGGAAGAGATGGAGAAAGG + Intergenic
1099825317 12:87769520-87769542 TTAGAGATGCTGATGGAGAAAGG - Intergenic
1102418252 12:112783243-112783265 TTGGAGTCAGTGCTGGAGTAGGG + Intronic
1104649823 12:130523539-130523561 CTGGAGCTCCTGATGGGGAAGGG - Intronic
1106404638 13:29463124-29463146 TTGGTGCATCTGATGGAGGAAGG + Intronic
1109069103 13:57740142-57740164 TTGGAGCCACTGAATGACAGAGG - Intergenic
1109864296 13:68242629-68242651 GGGAAGCCACTGAAGGAGAATGG - Intergenic
1110154483 13:72297916-72297938 GTAGAGCCATAGATGGAGAAGGG - Intergenic
1110944402 13:81395061-81395083 TTGGAGCCACTGACACACAAAGG + Intergenic
1111541000 13:89667199-89667221 CTGGAGTACCTGATGGAGAATGG - Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1114262623 14:21049146-21049168 TTGCAGCAATTGATGGAGACAGG + Intronic
1115344450 14:32327464-32327486 TTGGAGGCAGTGGTTGAGAATGG + Intergenic
1115959529 14:38819916-38819938 TTGGACCCACTGTGGGAAAAAGG - Intergenic
1116345612 14:43789549-43789571 TTGGACTAACTGATGGAGATTGG - Intergenic
1117331047 14:54712193-54712215 TTGGAGCCACTGTTGTAGTCTGG + Intronic
1121170249 14:91847765-91847787 TTTGAGCCACTGTTTGGGAAAGG + Intronic
1121300550 14:92867324-92867346 TTGCAACCACTGTGGGAGAAGGG - Intergenic
1121365317 14:93303787-93303809 TTGAAGCAACAGATGGAAAATGG + Intronic
1123106777 14:105845442-105845464 TTGGCGCCACTGCTGGAGGGGGG + Intergenic
1124672124 15:31649821-31649843 TTGGAGGTGCTGATGCAGAAAGG + Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125934009 15:43619001-43619023 TAGGAGCCAGTGATGCAGAAAGG + Intergenic
1125947106 15:43718463-43718485 TAGGAGCCAGTGATGCAGAAAGG + Intergenic
1126259528 15:46672047-46672069 TTTGAACCACTGATGGAATATGG + Intergenic
1127766221 15:62187711-62187733 TTGCAGCCACTCATGGATTAGGG + Intergenic
1129743327 15:78000863-78000885 GTGGTCCCACAGATGGAGAAGGG - Intronic
1130926586 15:88390044-88390066 TTGGAGCCAGTGCTGGTGAAAGG - Intergenic
1132710336 16:1263499-1263521 TGGGAGCCACTGGTGTAGACAGG - Intergenic
1132761106 16:1509050-1509072 GTGGAGCCACTGATGGGGCTGGG + Intronic
1132866189 16:2093803-2093825 TGGGAGCCACTGAAGGTGAGGGG - Exonic
1134261805 16:12656929-12656951 TTGTAGGCACTGAAGGAGAGCGG - Intergenic
1136617356 16:31406632-31406654 TTGGAGGCACCCATGGAGGAAGG - Intronic
1137043732 16:35637925-35637947 TTGGAGCCAAGGAAGTAGAAGGG - Intergenic
1138884840 16:61064125-61064147 TTGGAGCCAATGAAGAAAAATGG + Intergenic
1139532371 16:67548722-67548744 TTCAAGCCACTGATGGAGAGAGG - Intergenic
1140164185 16:72531821-72531843 TTGGACGCACAGATAGAGAACGG - Intergenic
1142210409 16:88805848-88805870 ATCGAGCCACTGCTGGAGCAGGG + Exonic
1144736611 17:17559188-17559210 TTGGAGCCAGGCGTGGAGAAGGG - Intronic
1145018200 17:19412361-19412383 ATGGAGGCACTGATGGAAATTGG + Intronic
1145764603 17:27449701-27449723 TTGGAGGCTCTGATGAAGCATGG + Intergenic
1149174606 17:53854293-53854315 TTGGAGTAACAGAAGGAGAAGGG + Intergenic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1149544972 17:57496664-57496686 CTGGAGCCAGGGATGGGGAAGGG - Intronic
1151241687 17:72763181-72763203 TGGGAGGCAATGAGGGAGAAGGG - Intronic
1152139259 17:78526673-78526695 TTGGGGTCGCTGAAGGAGAACGG + Exonic
1153039478 18:798492-798514 TTGGAGTGACTGATGGGGTAGGG + Intronic
1155412040 18:25557113-25557135 TAAGAGCCAGTGATTGAGAAGGG - Intergenic
1156581704 18:38384567-38384589 TTGGCCTCACTGATGGAGTAAGG - Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1161487620 19:4544205-4544227 CTGGCGCCCCTGATGCAGAACGG - Exonic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1164507243 19:28870295-28870317 TAGGAGCCCCTGACAGAGAAGGG - Intergenic
1164590292 19:29503131-29503153 CTGGAGCCCCTGATGGGAAATGG + Intergenic
1164770880 19:30808032-30808054 GTGAGGCCAATGATGGAGAAGGG - Intergenic
1164875643 19:31684840-31684862 TTGGAATCACTAAGGGAGAAAGG - Intergenic
1166939079 19:46352063-46352085 CTGGAGCCACTCATGGAGCCTGG + Intronic
1167426046 19:49430259-49430281 TTGAAACCACTGAGGCAGAACGG + Exonic
925054425 2:846246-846268 ATAGAGCCACTGCTGGAGGATGG - Intergenic
925216874 2:2103989-2104011 TGAGAGCCCCTGATAGAGAAAGG - Intronic
925689281 2:6504873-6504895 TTGCAGCCACCTATGGAGATGGG - Intergenic
927619040 2:24632585-24632607 TGGGAGCCAATAATGGAGAAGGG - Intronic
930019710 2:46994182-46994204 TTGGAGGGACTGAAGGAGCAAGG + Intronic
931094015 2:58919450-58919472 TGGGACCCACTGATGGAAGAGGG + Intergenic
931690915 2:64834264-64834286 TTGGAGCCACACATTGATAATGG + Intergenic
931940954 2:67252013-67252035 TTTGAGCCCCTGAGGGAGAAAGG + Intergenic
934544820 2:95206126-95206148 TTGGAGATTCTGCTGGAGAAAGG + Intergenic
935744545 2:106179101-106179123 ATGGAGCCACAGAGGGAGACTGG - Intronic
937686621 2:124705000-124705022 TAGGAGACACTGAGGGAGATTGG - Intronic
938307021 2:130263501-130263523 TGAAGGCCACTGATGGAGAAGGG - Intergenic
940144700 2:150533736-150533758 TGTGAGCCATTGATAGAGAAAGG - Intronic
940368094 2:152871155-152871177 TAGGAGGCACTGGTGGAAAACGG - Intergenic
941002184 2:160213738-160213760 CTGGAGGCTCTGAGGGAGAAGGG + Intronic
941394609 2:164959299-164959321 TTGAAACCACCTATGGAGAAAGG + Intergenic
941428661 2:165384289-165384311 TTGGAGCAAATGAAGGACAAAGG + Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
946665473 2:222045265-222045287 TTTCAGAGACTGATGGAGAATGG + Intergenic
948003452 2:234588000-234588022 TTGGATCCACTGTTGGCTAAGGG - Intergenic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
949058399 2:241942335-241942357 ATGGGACCCCTGATGGAGAACGG + Intergenic
1168836412 20:880732-880754 TGGGAGCCACTGATTGAAAATGG + Intronic
1169303515 20:4468196-4468218 TTGGAGTGAAAGATGGAGAAAGG + Intergenic
1170915309 20:20618267-20618289 ATGGAGCTACTGAGGGACAAAGG + Intronic
1172620144 20:36313301-36313323 TGGCAGCCACGGAGGGAGAAAGG - Intronic
1172845081 20:37925449-37925471 TGGGAGCCAAGGATGGAGGACGG - Intronic
1173812273 20:45963390-45963412 CTGGTGCCACTGAGGGAGAATGG - Intronic
1173819452 20:46011129-46011151 TTGGAACCACTGCAGGAGGAGGG - Exonic
1176760869 21:10786941-10786963 TTGCAGCCTGTGGTGGAGAAAGG + Intergenic
1177736058 21:25091819-25091841 ATGAAGCCAGTGATGGAGTAGGG + Intergenic
1179357890 21:40678468-40678490 TCGGAGCCAGTGATAGAGATGGG + Intronic
1179547426 21:42122169-42122191 ATGGAGCCACTGCTGAAGGAGGG + Intronic
1181479124 22:23186577-23186599 TCAGAGACACAGATGGAGAATGG - Intronic
1181830378 22:25555715-25555737 TTGGGGCCAGTGTTGGAGCATGG - Intergenic
1182118069 22:27768992-27769014 TGGCAGCCACTGATGCAGACTGG - Intronic
1182373773 22:29830967-29830989 ATGGAAACACTGATGGAGACTGG - Intronic
1182424666 22:30265817-30265839 AAGGAGCCACTTATGGAGAGAGG - Intronic
1183335757 22:37244920-37244942 TGGGGTCCGCTGATGGAGAAGGG + Intergenic
1185298672 22:50067610-50067632 ATGGAGTCACTGATGGGGGATGG - Intronic
949540478 3:5027976-5027998 TGGGATGCAGTGATGGAGAAAGG - Intergenic
949866849 3:8553874-8553896 TTGGCCTCACTGATGGAAAAGGG - Intronic
952435553 3:33269498-33269520 TTGCAGCCACTGTGGGAGATGGG + Intergenic
953586314 3:44204401-44204423 ATGGAGCCACAGCTGGAGAATGG + Intergenic
954804263 3:53206841-53206863 TTGGAATCACTGAAGGAGGAAGG + Intergenic
956058909 3:65330107-65330129 TTTGAACCACTGAGGGAGAAGGG + Intergenic
958407365 3:93765478-93765500 TTGAAGCCAATGTTGGAAAATGG - Intergenic
959829131 3:110839532-110839554 TTGGAAACATTGATGAAGAAAGG + Intergenic
959979695 3:112502283-112502305 TTGCATCCAATGATGGAGCAAGG + Intergenic
960058898 3:113298392-113298414 TTGGATCTAGAGATGGAGAAAGG + Intronic
964117782 3:153154831-153154853 CTGGAGCCACTGCTGCAGAAGGG + Intergenic
966315958 3:178645581-178645603 TGGGAGCCAGTGTAGGAGAATGG + Intronic
966631311 3:182078388-182078410 TTGGGGCCACTTATGCAGGATGG + Intergenic
968052663 3:195666108-195666130 TTGGATCTCCTGATGGAGAATGG + Intergenic
968103148 3:195982246-195982268 TTGGATCTCCTGATGGAGAATGG - Intergenic
968347386 3:198021306-198021328 TTGGTGCCATTGATGAAGAAAGG + Intronic
969522944 4:7689341-7689363 TTGGAGGAACGGATGGAGGATGG - Intronic
969987061 4:11223358-11223380 TTGGGGCAACTGCTGGAGCAGGG + Intergenic
973758640 4:54098321-54098343 TTGGAGCCACTGATGGAGAATGG - Intronic
974874992 4:67692955-67692977 TTGGTGCCCCTGTTGTAGAAGGG - Intronic
978514132 4:109553312-109553334 TAGAAGACACTGATGAAGAAGGG - Intergenic
980050206 4:128032295-128032317 TTGAAGTGACTGATGGGGAATGG - Intronic
981058714 4:140395945-140395967 ATGAAGACACGGATGGAGAATGG - Exonic
981713151 4:147728557-147728579 TTGGAACACCTGATGGAGATTGG - Intergenic
982278235 4:153658671-153658693 GTGGAGCCCTTGATGGAGAAGGG + Intergenic
983912764 4:173258504-173258526 TTGCAGCAGCTGATGGAGATGGG + Intronic
984434979 4:179698134-179698156 TTGGAACCACTTATGAAGAAAGG - Intergenic
985498913 5:228227-228249 TTGGATCTCCTGATGGAGAATGG + Exonic
985812648 5:2101418-2101440 GTGGAGCCAGTGATGCAGAGAGG + Intergenic
986776123 5:11015764-11015786 CTGGAGCCACTGATTCAGAATGG + Intronic
987410159 5:17606835-17606857 TTGGAAGAACTGATGGAGATGGG + Intergenic
987410816 5:17613041-17613063 TTGGAAGAACTGATGGAGATGGG + Intergenic
987856092 5:23422731-23422753 TTGCAGCTGCTGATGGAGAGAGG - Intergenic
988433064 5:31142230-31142252 ATGGAGGCCCTGATGGATAAAGG - Intergenic
989257038 5:39377043-39377065 TGGGTGCCACAGATGCAGAAGGG + Exonic
989944211 5:50198399-50198421 TTGAGGCCTCTGATGGAAAAGGG - Intergenic
990516256 5:56533659-56533681 TTGGTGCAACAGTTGGAGAAAGG + Intronic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
992828468 5:80571278-80571300 TTGGAGGGTCTGGTGGAGAAAGG + Intergenic
993629823 5:90272411-90272433 TTGGAAGTACTGTTGGAGAAGGG + Intergenic
995396088 5:111688698-111688720 TGGGAACCACTGATAGAGAGAGG - Intronic
995729573 5:115223549-115223571 CTGGAGACACTGTTGGCGAAAGG + Intronic
997417182 5:133738106-133738128 TGGGAGCCACGGATGAAGACAGG - Intergenic
998519304 5:142785282-142785304 TTGGATGCACTGAAGGAAAAGGG - Intronic
1004252198 6:14032004-14032026 TTGGACCCACGCATGGATAAGGG - Intergenic
1004638809 6:17494337-17494359 ATGGAGCGACTGAGGGAGAAAGG - Intronic
1005826794 6:29637043-29637065 TTGTAGCTACTGGTGGAAAAAGG - Intergenic
1006175984 6:32121860-32121882 GAGGAGCCACTAAAGGAGAAAGG - Intronic
1008021001 6:46577013-46577035 TTAGAGCCAGCAATGGAGAAGGG + Intronic
1008583641 6:52929336-52929358 CTGGAGCCACTAATGGAGAGGGG + Intergenic
1008878147 6:56351728-56351750 TTGGAACCACTGCTGGAAGAAGG + Intronic
1009937340 6:70249436-70249458 TGGGAGACACTGGTAGAGAAAGG + Intronic
1015081332 6:129228789-129228811 TTAGAGCCACAGCTGGAGAAAGG - Intronic
1015614810 6:135063663-135063685 TTGGAGGCAGAGAAGGAGAAAGG + Intronic
1015988894 6:138914714-138914736 TTGGAGGCACTGCAGGAGGATGG + Exonic
1017026771 6:150188072-150188094 TTTTAGTCACTGTTGGAGAAAGG + Intronic
1017082344 6:150681866-150681888 TTGCAGCCGCTGATGAAGTATGG + Intronic
1018372899 6:163185116-163185138 TTGTAGCCAGGGATGGGGAAAGG + Intronic
1018373198 6:163187078-163187100 TGGGAGCCACTGATAGGGAAGGG - Intronic
1020741753 7:12028656-12028678 TTGGAGGCTGTGAGGGAGAATGG - Intergenic
1020929201 7:14372056-14372078 TTGGAGGCGCTGAAAGAGAAAGG - Intronic
1021519429 7:21524498-21524520 TTAGAGCCCCTGAAGGAAAAAGG - Intergenic
1021587493 7:22224727-22224749 TTGGAGCCAGTGCCGGTGAAAGG - Intronic
1022897164 7:34762114-34762136 TTGGGGGAACTAATGGAGAAAGG + Intronic
1023168164 7:37363530-37363552 CTGGAGCCACTGATGTGGGATGG - Intronic
1025871083 7:65434876-65434898 TCGGAGCCACTAGTGTAGAAAGG - Intergenic
1027141629 7:75661790-75661812 TTGGAGCCACTGGGGGAGGATGG + Intronic
1028049064 7:86159665-86159687 TTCGAGCAACTGAAGGAGACAGG + Intergenic
1028382500 7:90214283-90214305 TTGGAGCAACTGGTGGATAATGG + Intronic
1028493902 7:91443161-91443183 TTGAAGCCATTGATGCAAAATGG + Intergenic
1030565015 7:111142751-111142773 TTTAAGCCATTGAGGGAGAAGGG - Intronic
1033764046 7:144468305-144468327 TTGGAGACAGGGATGGAGAGTGG + Intronic
1035482533 7:159198781-159198803 TTAGAGCCACGGACAGAGAACGG + Intergenic
1035766898 8:2113565-2113587 TTGCAGCCAGGGATGGAGGAAGG + Intronic
1036598209 8:10233186-10233208 TTGTAGCCACTGCTGCAGCAGGG + Intronic
1037435722 8:18861215-18861237 ATCGACCCACTGCTGGAGAAGGG + Intronic
1039974711 8:42352655-42352677 TTGTATCTACTGATTGAGAATGG - Intronic
1041602982 8:59744134-59744156 TTGAATCCACTAATGAAGAATGG + Intergenic
1042977984 8:74492200-74492222 TTTAACCCAGTGATGGAGAAGGG - Intergenic
1045440411 8:102203102-102203124 GGGGAGCCACTGAAGGAGATAGG + Intergenic
1045771293 8:105743268-105743290 TTGGGGCAACTGGTGGAGAATGG + Intronic
1045977192 8:108142843-108142865 TGGGAGCCACTGATTTATAATGG + Intergenic
1046517023 8:115276021-115276043 TTAGTGTCACTGTTGGAGAAAGG - Intergenic
1046759887 8:118010043-118010065 ATGAAGACACTGATGGACAAAGG - Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047011022 8:120672897-120672919 TAGGAGGCACTGAAGGAGACTGG + Intronic
1047459754 8:125051537-125051559 GTGGAGCAACTGAAGGTGAAAGG + Intronic
1047773428 8:128049283-128049305 TTGGAGCCACTGATAGAAGCAGG + Intergenic
1047989975 8:130275960-130275982 TTGGAGCCGCTGATGAAGTCCGG - Intronic
1048440924 8:134458467-134458489 TTTGTGCCCCTGATGGAGAGGGG + Intergenic
1048754025 8:137714800-137714822 TTTCAGCCACTGCTGGAGAATGG + Intergenic
1050389998 9:5132478-5132500 TTGGAGCAACTGTGAGAGAATGG - Intronic
1050530111 9:6581261-6581283 TTGGGGGCACTGAGGGAGACTGG - Intronic
1052038912 9:23715596-23715618 CTGAAGCCATTGCTGGAGAATGG - Intronic
1055893276 9:81145877-81145899 TTGGAGCCACTGCACGAGAGAGG + Intergenic
1055908620 9:81321574-81321596 TTGGAGTGAATGAAGGAGAAAGG + Intergenic
1056429693 9:86514943-86514965 AGGGGGTCACTGATGGAGAAAGG - Intergenic
1060306977 9:122422226-122422248 TTGGATCCATTGCTGGAGGAGGG + Intergenic
1060493980 9:124104609-124104631 GTGGATCCACTGATGCAGAAAGG - Intergenic
1060765745 9:126294013-126294035 TGGGAGCCACAGATGGGTAAAGG + Intergenic
1061464725 9:130768574-130768596 TTAGAGCCAGTGAAGAAGAACGG + Intronic
1203400358 Un_KI270519v1:84992-85014 TTGCAGCCTATGGTGGAGAAAGG + Intergenic
1203415007 Un_KI270584v1:710-732 TTGGAGCCTATGGTGGAAAAGGG - Intergenic
1187077448 X:15949035-15949057 TTATAGCCACTGATGAAGCAGGG + Intergenic
1190305170 X:49077845-49077867 GTGGAGCCCTTGATGGAGAAGGG - Exonic
1190808487 X:53861723-53861745 TTGCAGCCACTGCTGGGGGATGG + Intergenic
1195113146 X:101667313-101667335 TTTGAGACACTGTTGGAGTAGGG + Intergenic
1198162058 X:134017735-134017757 TTGGAGCCACTAGGGTAGAAAGG + Intergenic
1198708178 X:139472208-139472230 TTGGGGCCAGAGATGAAGAAGGG - Intergenic