ID: 973761258

View in Genome Browser
Species Human (GRCh38)
Location 4:54117710-54117732
Sequence GCTTCCAGCCATACTCAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973761258_973761262 9 Left 973761258 4:54117710-54117732 CCCTATTGAGTATGGCTGGAAGC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 973761262 4:54117742-54117764 AATCATTTGACCATATGAGAGGG No data
973761258_973761261 8 Left 973761258 4:54117710-54117732 CCCTATTGAGTATGGCTGGAAGC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 973761261 4:54117741-54117763 AAATCATTTGACCATATGAGAGG 0: 1
1: 1
2: 6
3: 47
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973761258 Original CRISPR GCTTCCAGCCATACTCAATA GGG (reversed) Intronic
900540102 1:3198300-3198322 GCTTGCAGCCATTCTCCAAAGGG - Intronic
901231915 1:7646268-7646290 GCCTCCAACCACACTCACTATGG - Intronic
901231944 1:7646374-7646396 GCCTCCAACCACACTCACTATGG - Intronic
906651223 1:47514317-47514339 CCTTCCAGCCATCCCCAACAAGG + Intergenic
908148613 1:61275104-61275126 GCATCCAGCCAAACTGAAAACGG - Intronic
909362829 1:74784291-74784313 GGTGCCAGCCACACTCAAAAGGG + Intergenic
909683624 1:78320881-78320903 TCTTCCAGGCCTCCTCAATATGG + Intronic
920855647 1:209659065-209659087 GCTTCCAGCCTTGCTGGATAGGG + Intergenic
921211535 1:212903577-212903599 ACATCCAGCCAAAATCAATAAGG + Intergenic
1065876082 10:29998639-29998661 GCTTCCAGCCATGATAAAAACGG + Intergenic
1067063843 10:43092673-43092695 GCTGCCAGCCAGACTCACTCGGG - Intronic
1068505844 10:57898277-57898299 GCTTCCAGGCATATCCAACATGG + Intergenic
1069719024 10:70538404-70538426 ACTGCCAGTCATACTCACTAGGG - Exonic
1071083142 10:81836901-81836923 GCACCCAGCCATACTCAGTCAGG + Intergenic
1075079539 10:119374055-119374077 GTTTCCATCCAACCTCAATAGGG - Intronic
1076279590 10:129234517-129234539 GCAGCCAGCCATGCTCAAGAAGG + Intergenic
1078380432 11:10835121-10835143 GCCTCCTCCCATACTCATTAGGG + Intronic
1078776149 11:14395163-14395185 GTTTCCACCAATACTCAATTTGG - Intergenic
1079611485 11:22437631-22437653 GCTTCCATCCATACCCATTAGGG - Intergenic
1086561985 11:88178431-88178453 GTTTCCAGCCGTACTCATTTAGG + Intergenic
1094288020 12:28816332-28816354 GCTTCCTTCTATACTCAAGACGG - Intergenic
1095593671 12:43935396-43935418 TCTTCCAGCCATAAGAAATAGGG + Intronic
1100665363 12:96746308-96746330 CCTTCCAGCCAGACTCCTTAAGG + Intronic
1101632531 12:106509459-106509481 GCTTGCAGGCATACGGAATACGG - Exonic
1101957399 12:109223181-109223203 GCTTCCAGATATGCTCCATATGG - Intronic
1109269912 13:60243927-60243949 GCATCCAGTCTTACTCAACAGGG + Intergenic
1125122236 15:36175513-36175535 AATTCCAGCCATAAACAATATGG + Intergenic
1136144806 16:28310221-28310243 GCATCCACCCACACTCAAGAGGG - Intronic
1138588632 16:57987285-57987307 GCTTCCAGCCAGCCTCTATGTGG - Intronic
1141307088 16:82874994-82875016 GCTTTTGGCCATACTCAAGAGGG + Intronic
1142075579 16:88115749-88115771 CCTTCCAGCCATACTCCCTCCGG + Intronic
1143833947 17:9675018-9675040 ACTTCCATCCTTACTCATTACGG + Intronic
1146369839 17:32258788-32258810 GCCTCTTGCCATACTGAATATGG + Intergenic
1150159059 17:62878907-62878929 GCCTCCAGCCATCCTTAGTAGGG - Intergenic
1151785088 17:76271535-76271557 GCTTCCAGCTCTTCTCACTAGGG - Intergenic
1153046101 18:856973-856995 GCTGCCAGGCATACTCAACTTGG - Intergenic
1159121026 18:64170955-64170977 GCTTCCACCTTTACTCCATAGGG + Intergenic
1163563871 19:18038064-18038086 GGTTACAGCCATACTGAATCAGG + Intergenic
1165285430 19:34838125-34838147 GCTTCCAGACACTCTCAAGAAGG - Intergenic
1167318346 19:48779799-48779821 ACTTCCAGCCACACCCATTAGGG - Intergenic
927249242 2:20983048-20983070 GCTTCCAGCCACACTTCAGATGG - Intergenic
927740581 2:25565967-25565989 GCTTCCACCCACACTCAAAGGGG - Intronic
932541312 2:72656629-72656651 ACTTTCACCCTTACTCAATAAGG - Intronic
933977069 2:87520215-87520237 ATTTCCAGCCATATTCACTATGG - Intergenic
936316748 2:111430590-111430612 ATTTCCAGCCATATTCACTATGG + Intergenic
945794773 2:214348648-214348670 CCTTCCAGCCATCCCCAACAAGG + Intronic
946326403 2:218986661-218986683 GTTTCCAGCCATCCTCAATCAGG - Intergenic
947762939 2:232616983-232617005 CCTTCCAGCCCTACTCACTAGGG - Intronic
947952928 2:234163556-234163578 CCCTCCAGCAATACTCAATCTGG - Intergenic
1178720999 21:35008771-35008793 GCTTCTAACCATACTGATTATGG + Intronic
1179392063 21:41003017-41003039 GCTTCCAGTCATGCTGGATATGG + Intergenic
1182232408 22:28848714-28848736 GCAACCAGCCATATTCAAAATGG + Intergenic
955497801 3:59554165-59554187 TCGCCCAACCATACTCAATAAGG - Intergenic
957727228 3:84083410-84083432 GATTCTAGCCATATTAAATAAGG - Intergenic
963036224 3:141031508-141031530 CCTTCCAGCCATCCTCAGCAAGG - Intergenic
973761258 4:54117710-54117732 GCTTCCAGCCATACTCAATAGGG - Intronic
976068923 4:81219500-81219522 GGTTCCAGCATCACTCAATATGG + Intergenic
981963665 4:150574787-150574809 GATTCCAACCATACTTAATTGGG - Intronic
986865529 5:11982029-11982051 GGTTCTACCCATACTCAAAAAGG + Intergenic
987903589 5:24047440-24047462 GCTTCCTGCCAGATTGAATATGG - Intronic
992127010 5:73652529-73652551 GCTTCCAGCCCTCCTGAATGTGG - Intronic
998383819 5:141744474-141744496 CCTTCCAGGCATACTCTATCAGG + Intergenic
1005470459 6:26157492-26157514 ACTGCCTGCCATACTCGATAGGG - Intergenic
1007699170 6:43756147-43756169 GGGTCCTGCCTTACTCAATAGGG - Intergenic
1010603152 6:77855494-77855516 TCTTCCAAGCATACTCATTAAGG - Intronic
1011037323 6:82991883-82991905 GCTGCCACACATAATCAATAAGG + Intronic
1022440735 7:30430844-30430866 GCTCCCAGCCATACCCCACAAGG + Intronic
1023746906 7:43330333-43330355 GTTTCCAGCCATCCTCAACCAGG + Intronic
1028214564 7:88115565-88115587 GGTACCAGCTATACTGAATAAGG + Intronic
1030766034 7:113410905-113410927 GCTTCCAACCCTCCTCACTAAGG + Intergenic
1031856515 7:126929034-126929056 GCTTTCACACATACTCAGTATGG + Intronic
1036948717 8:13120789-13120811 GTTCCCAGCCATACACAAAAGGG - Intronic
1037602826 8:20412514-20412536 CTTTCCAGCCATGCTCAACAAGG - Intergenic
1038727876 8:30097315-30097337 TCTTCCAGTCATACCGAATAAGG - Intronic
1041477252 8:58280012-58280034 GCTTCCAGCCAAAGACAAGAAGG + Intergenic
1044249407 8:89988589-89988611 GTTTCCAGCCCTACATAATATGG + Intronic
1044937256 8:97305023-97305045 GCTTCCAGCCATACTGGAGGTGG + Intergenic
1047019348 8:120758349-120758371 ACCTCCAGACATATTCAATAAGG + Intronic
1047406618 8:124590688-124590710 GCTTCCAGGCATCCAGAATAGGG - Intronic
1048539523 8:135330056-135330078 GCTTCCAGCCATCCACACCAAGG - Intergenic
1057414806 9:94851698-94851720 GCTGACAGCCATTCTCAACAAGG - Intronic
1057421408 9:94915962-94915984 GCTTGCAGCCATTCTCAGCAAGG - Intronic
1193825953 X:86227452-86227474 TCTTTCAGCCATACTCTCTATGG + Intronic
1201578586 Y:15487458-15487480 GCTACCATCTATACTCACTATGG + Intergenic