ID: 973771770

View in Genome Browser
Species Human (GRCh38)
Location 4:54213428-54213450
Sequence GCTGCGATGCTGGAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973771765_973771770 13 Left 973771765 4:54213392-54213414 CCGGGGTTCTGACCCGAACAACA 0: 1
1: 0
2: 0
3: 5
4: 62
Right 973771770 4:54213428-54213450 GCTGCGATGCTGGAGCTGCAGGG 0: 1
1: 1
2: 0
3: 18
4: 195
973771766_973771770 1 Left 973771766 4:54213404-54213426 CCCGAACAACACAATGTTGAAAG 0: 1
1: 0
2: 2
3: 19
4: 322
Right 973771770 4:54213428-54213450 GCTGCGATGCTGGAGCTGCAGGG 0: 1
1: 1
2: 0
3: 18
4: 195
973771767_973771770 0 Left 973771767 4:54213405-54213427 CCGAACAACACAATGTTGAAAGA 0: 1
1: 0
2: 2
3: 36
4: 330
Right 973771770 4:54213428-54213450 GCTGCGATGCTGGAGCTGCAGGG 0: 1
1: 1
2: 0
3: 18
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973771770 Original CRISPR GCTGCGATGCTGGAGCTGCA GGG Intronic
902457964 1:16549471-16549493 TCTGTGATGCTGGTGCTGTAAGG - Intergenic
902494194 1:16858443-16858465 TCTGTGATGCTGGTGCTGTAAGG + Intronic
902876164 1:19342180-19342202 GATGCTCTGCTGGAGCTGCCTGG - Intronic
905275338 1:36814029-36814051 TCTGGGATGCTGGGGCTTCATGG - Intronic
907291150 1:53413808-53413830 GCAGCCTGGCTGGAGCTGCAGGG + Intergenic
908253425 1:62283200-62283222 GCTGCGATGGTGGAGATGAAGGG - Intronic
908772984 1:67613007-67613029 GCTGCAATCCTGGAGGAGCAGGG - Intergenic
912130513 1:106594399-106594421 GCTCTGATGCTGGAGCAGTAAGG + Intergenic
912179954 1:107207894-107207916 GCTGCCATGCTGTGGCTGCTAGG - Intronic
912775391 1:112503422-112503444 ACTGTGTTGCAGGAGCTGCAAGG + Intronic
913081211 1:115388975-115388997 GCTGGGAAGCTCGAGCTGGACGG - Intergenic
919682852 1:200453485-200453507 ACTGCCATGCTGGAGCAGCCTGG + Intergenic
920335397 1:205241857-205241879 GCTGCCACGCTGGGGCTCCAGGG - Exonic
922818957 1:228470984-228471006 GTTGGGATGCTGGGGCTGCAGGG - Intergenic
922884556 1:229007925-229007947 GCGTCAATGCTGGAGCTGAAAGG + Intergenic
923010390 1:230083488-230083510 GCTGGGATGATGGAGCTGGGGGG + Intronic
1063541148 10:6935183-6935205 GATGGGATGCTGCAGCTACAGGG + Intergenic
1064993794 10:21278949-21278971 GCTAAGATTCTGGAGGTGCAGGG - Intergenic
1066162225 10:32746315-32746337 GCTAGGATTCTGGAGGTGCATGG - Intronic
1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG + Intergenic
1069876008 10:71563277-71563299 GCTGGAATGCAGGAGCTGGAAGG - Intronic
1070770357 10:79078924-79078946 GCTGCAATGCCTGAGCTGAAAGG - Intronic
1070963972 10:80518292-80518314 GCAGACATGCTTGAGCTGCAGGG - Exonic
1071945715 10:90642363-90642385 GCTGCTATTCTTGAGCAGCAAGG - Intergenic
1073146652 10:101285773-101285795 GCTGCAAGGCTGGAGCTGCGAGG + Intergenic
1073644357 10:105284446-105284468 GCTGGGAAGCTGGCCCTGCAAGG + Intergenic
1075120353 10:119660037-119660059 GCTGCAGGGCTGGGGCTGCAGGG + Intronic
1076283784 10:129274198-129274220 CCGGAGCTGCTGGAGCTGCAGGG + Intergenic
1076354224 10:129840415-129840437 GCTGCCATGGTGGGGCTGGACGG + Intronic
1076437427 10:130455557-130455579 GCTGCGATTCTAGAGGTGCCTGG + Intergenic
1076546058 10:131246378-131246400 GCGGCCATGCTGGACCTGGAGGG + Intronic
1077327480 11:1969988-1970010 CCTGCAGGGCTGGAGCTGCAGGG - Intronic
1077536099 11:3125018-3125040 TCTGCAGTGCTGGGGCTGCAGGG - Intronic
1081421167 11:42875740-42875762 GTTGGGACCCTGGAGCTGCATGG - Intergenic
1081989752 11:47331597-47331619 GCTGCGATGGGGGATCAGCAGGG - Exonic
1082975032 11:59062879-59062901 GCTGCCATTCTGCAGCTGCGGGG - Intergenic
1083424936 11:62578687-62578709 GCAGCAATGCTGGAGCTGGTGGG - Exonic
1083768565 11:64853937-64853959 GCTGCTAGGCTGAGGCTGCATGG - Exonic
1084170049 11:67396703-67396725 GCTGGGAGGCAGGAGCTGCCTGG + Intronic
1084860247 11:72013447-72013469 GCTGGTGTGCTCGAGCTGCAGGG + Exonic
1086697622 11:89863929-89863951 GCTCCGCTGCAGGCGCTGCAGGG + Intergenic
1086708537 11:89980559-89980581 GCTCCGCTGCAGGCGCTGCAGGG - Intergenic
1087529835 11:99366035-99366057 GATGGGATGCTGGAGCCTCAGGG - Intronic
1089296523 11:117472211-117472233 TCTCCCAAGCTGGAGCTGCATGG - Intronic
1089525719 11:119095192-119095214 GCTGAGATCCTGGAGCTGGCGGG - Exonic
1202810462 11_KI270721v1_random:25168-25190 CCTGCAGGGCTGGAGCTGCAGGG - Intergenic
1092065845 12:5589207-5589229 GCTGCGATCTTTGAACTGCATGG + Intronic
1092780895 12:11985861-11985883 GCTCTGAGGCTGGAGCTGCTTGG - Intergenic
1095951427 12:47783904-47783926 GGTGGGATGCTGGAGCACCAGGG + Intronic
1098048354 12:66426066-66426088 GTTGTGGTGCTGGAGCAGCAGGG - Intronic
1101894964 12:108749448-108749470 CCTGAGATGCTGGAGCTCCGAGG + Intergenic
1102529735 12:113537296-113537318 GCTGATATGCTGGAGCTGCCAGG - Intergenic
1103925099 12:124419301-124419323 GCTGCTCTGGTGGAGTTGCATGG - Intronic
1105804758 13:23946502-23946524 GCTGGGGGCCTGGAGCTGCAGGG - Intergenic
1105862202 13:24425717-24425739 TCAGGGATGCTGGAGTTGCAGGG - Intronic
1107431950 13:40348240-40348262 GCTGCATGGCTGGAGCTGCCAGG + Intergenic
1108001494 13:45909411-45909433 GCTGGTATACTGGAGCAGCAGGG - Intergenic
1109033853 13:57230234-57230256 CCTGGGATGCTCGAGCTTCATGG + Intergenic
1110575610 13:77051874-77051896 GCTGCGATGCTGAGGCTGGACGG - Exonic
1112202897 13:97294638-97294660 TCTCCAATGCTGTAGCTGCATGG + Intronic
1112576706 13:100642720-100642742 GCTGCCATGATGGAGCTGCTGGG + Intronic
1114484671 14:23055679-23055701 GCTGGGTGGCTGGGGCTGCATGG - Exonic
1114655013 14:24310752-24310774 GCGGCGCTGCTGGGGCTGCCTGG + Exonic
1119571505 14:75677872-75677894 GATGGGAGGCTGGAGCTGGAGGG - Intronic
1119585622 14:75832227-75832249 GCTGCTATGCTGGAGGAGAAGGG + Intronic
1119765178 14:77183300-77183322 GCTGAGAAGCTGAGGCTGCAAGG + Intronic
1121253557 14:92516084-92516106 GTTGCTATGGTGGGGCTGCATGG - Intronic
1122193500 14:100067186-100067208 GCAGCGTTCGTGGAGCTGCAAGG + Intronic
1122276216 14:100592089-100592111 GCTGCAATGCAGGAGATGAAAGG - Intergenic
1122602275 14:102927839-102927861 TCTGTGGTGCGGGAGCTGCACGG + Intronic
1122784454 14:104157411-104157433 GCTGCGATTCTGGAGTTTGATGG + Intronic
1122984950 14:105207743-105207765 GCTGTGACGCTGCAGCTGCACGG - Intergenic
1202853955 14_GL000225v1_random:38129-38151 GCTGTGAAGCTGGAGGGGCACGG - Intergenic
1202856518 14_GL000225v1_random:54594-54616 GCTGGGATGCTGCAGGGGCATGG - Intergenic
1123491571 15:20785696-20785718 GCTGCCCTGCTGCAGCTGCTGGG - Intergenic
1123548074 15:21354790-21354812 GCTGCCCTGCTGCAGCTGCTGGG - Intergenic
1124235753 15:27988227-27988249 TCTGTGATTCTGGAACTGCAGGG - Intronic
1126075604 15:44906276-44906298 GCTGGGATGTTGAGGCTGCAGGG - Intergenic
1127055225 15:55124724-55124746 GCTGGGATGCAGAAGATGCAGGG + Intergenic
1127570619 15:60237565-60237587 CCTGTGATGCTGCAGCTGGATGG + Intergenic
1127834478 15:62779604-62779626 GCCAGGATGCTGGAGCTGAAGGG - Intronic
1128567457 15:68710780-68710802 GAGGCGCTCCTGGAGCTGCACGG + Exonic
1202956405 15_KI270727v1_random:82020-82042 GCTGCCCTGCTGCAGCTGCTGGG - Intergenic
1132933478 16:2470110-2470132 GCCTCGATGCTGGCCCTGCACGG + Intergenic
1133072768 16:3257358-3257380 GCCAAGATGCTGGAGCTACACGG + Intergenic
1133113203 16:3561877-3561899 GCTGCGGTGATAGCGCTGCATGG - Intronic
1136413671 16:30091278-30091300 GCTGTGATCCTGGATCTGGAAGG - Intronic
1137726021 16:50657333-50657355 GCTGTGAGCCTGGAGCTGCAGGG - Intergenic
1140122946 16:72099109-72099131 GCTGCCCTTCTGGAGCTGCATGG + Intronic
1141193459 16:81841926-81841948 GCTGGGAAGCTGGTGTTGCAAGG + Intronic
1142717679 17:1755819-1755841 GCTTCCCTGCTGGAGGTGCAGGG + Intergenic
1142854367 17:2721728-2721750 GCTGAGGTGCTGGAGGTGCCTGG - Intergenic
1143061932 17:4209171-4209193 ACTGTGCTGCTGAAGCTGCAGGG + Intronic
1144729786 17:17519712-17519734 GCTGTGCTGCTGGACCAGCAGGG + Intronic
1146182231 17:30705828-30705850 GCTGGGATGCTGGAGGTGCTAGG + Intergenic
1147412801 17:40265685-40265707 GTTGGAAAGCTGGAGCTGCAGGG + Intronic
1149863260 17:60136089-60136111 GCAGCGATCCTGGATTTGCAGGG - Intergenic
1151577277 17:74959092-74959114 GCTGGGAAACTGGAGCTGCAGGG - Intronic
1153757953 18:8302356-8302378 GCTGGGTGGCTGGAGCTGGAAGG + Intronic
1158735534 18:60075191-60075213 GGTGCCATGCTGTAGCTGCTTGG - Intergenic
1162009568 19:7804105-7804127 GCTTAGATGCTGGGGCAGCAGGG + Intergenic
1162976601 19:14209974-14209996 GCTGGGATGCTGGAGGTGCTAGG - Intergenic
1166209455 19:41296799-41296821 GCTGAGATCCAGGAACTGCAGGG - Intronic
1167376353 19:49114408-49114430 GCTGCGCTGGTGGAGCCGCTGGG + Exonic
1168170538 19:54585515-54585537 CCTGCGATGCTGCAGCTGGATGG - Intronic
1168444281 19:56398354-56398376 GCTGCGATGTTGGACATGCCTGG + Intronic
1168594454 19:57664274-57664296 GCGGCGATGCCGCAGCTGCGGGG + Intergenic
1168707766 19:58479688-58479710 GATGCGATGCTGGAGAAGTACGG + Exonic
925662017 2:6212773-6212795 GCTGCGGTGCTGAAGGAGCATGG - Intergenic
927750623 2:25666862-25666884 GCAATGATGCTGGAGCTGAAAGG + Intronic
927978104 2:27355665-27355687 GCTGGCATCCTGGAGCAGCATGG - Intronic
930101463 2:47606696-47606718 GCTGAGAGCCTCGAGCTGCAGGG + Intergenic
930261430 2:49151246-49151268 TCTGCCATCCAGGAGCTGCAGGG + Intronic
931721673 2:65071673-65071695 GCAGAGATGCTGCAGCTGGAAGG - Exonic
936649865 2:114413724-114413746 CCTGCGATGCTGCAGCTGGATGG - Intergenic
937251906 2:120529228-120529250 GCAGCAAAGCAGGAGCTGCAGGG + Intergenic
938759625 2:134412241-134412263 GCTGTGTTGCTGAATCTGCAAGG - Intronic
939628507 2:144508166-144508188 ACTGTGATGCTGGCGCTGCCCGG + Intronic
944595204 2:201254880-201254902 GAGGTGTTGCTGGAGCTGCAGGG - Intronic
947440589 2:230117840-230117862 CCTGCGATGCTGCAGCTTGATGG - Intergenic
948503066 2:238408864-238408886 GCTGTTTTGTTGGAGCTGCAGGG + Intergenic
948896712 2:240931070-240931092 GGGGAGATGCTGCAGCTGCAGGG + Exonic
949073548 2:242040956-242040978 GCAGCGATCCTGGAGCACCATGG + Intergenic
1169065811 20:2693535-2693557 GCTGCGCTGCTGGAGGCGCCTGG + Intronic
1170622598 20:18008100-18008122 GCTGTGCTGCAGGAGCAGCAAGG + Intronic
1171124123 20:22586911-22586933 GCTCCGGTGCCGGAGCTGCGGGG - Intergenic
1172812423 20:37658378-37658400 TCAGCAAGGCTGGAGCTGCAGGG - Intergenic
1174549910 20:51354842-51354864 GCTGTGGAGCTGGAGGTGCAGGG + Intergenic
1175916107 20:62426843-62426865 GCTGCTGTGCCTGAGCTGCAGGG - Intronic
1176696970 21:9989784-9989806 GCTGTACTACTGGAGCTGCAGGG - Intergenic
1177903641 21:26948480-26948502 GCTGGGATTATGGAGGTGCACGG + Intronic
1178285092 21:31318969-31318991 GCTGGGAGGCTGGAGCAGGAGGG - Intronic
1179778923 21:43687167-43687189 GCAGGGAAGCAGGAGCTGCAGGG + Intronic
1180159769 21:45993824-45993846 GCCGGGAAGCTGGAGCTGCGTGG - Intronic
1180982785 22:19886749-19886771 GCTTCGAGGACGGAGCTGCAGGG - Intronic
1182645407 22:31804834-31804856 ACTCCGATTATGGAGCTGCAAGG - Exonic
1182806775 22:33078998-33079020 GCATGGATGCTGGAGCTGGATGG + Intergenic
1183463466 22:37967109-37967131 CCTGTGATGGTGGAGCTGGAGGG + Exonic
1185239497 22:49735113-49735135 GCTGGGCTGCTGGGGCTGCAGGG + Intergenic
950386433 3:12663943-12663965 GCTACGATGCGGGGGCTGCTCGG - Exonic
951183176 3:19682507-19682529 ACTGGGATGCTGGAGCTGGGCGG - Intergenic
956247035 3:67195348-67195370 GCTGCGATGCTGGAGATGCAGGG - Intergenic
957040102 3:75329812-75329834 GCTGCTGGGCTGGAGCTGCCAGG + Intergenic
957813275 3:85256162-85256184 GCTGCTAACCAGGAGCTGCAGGG - Intronic
961044889 3:123701355-123701377 GCTGCTGGGCTGGAGCTGCCGGG + Intronic
961380614 3:126494412-126494434 ACTCGGAGGCTGGAGCTGCAGGG - Intronic
964304950 3:155329779-155329801 GGTGTGATGCTGGAGATACAAGG - Intergenic
964771313 3:160226258-160226280 GCTGAGCTGCTGCAGCCGCATGG - Exonic
965973266 3:174589021-174589043 GCTGGGAAGCTGGAACTGGATGG - Intronic
969108401 4:4825682-4825704 GCTGCAATGCTGCTGCAGCATGG + Intergenic
969665183 4:8553354-8553376 GCCTAGATTCTGGAGCTGCAGGG + Intergenic
973771770 4:54213428-54213450 GCTGCGATGCTGGAGCTGCAGGG + Intronic
973882710 4:55289997-55290019 GCTGGCAGGCTGGAGATGCAGGG - Intergenic
974566911 4:63589999-63590021 CCTGCGATGCTGCAGCTTGATGG + Intergenic
977771710 4:100868526-100868548 CCTGCTATGCTGCAGCTGGAAGG - Intronic
978298984 4:107243506-107243528 GCAGCCAACCTGGAGCTGCAGGG + Intronic
980369576 4:131849961-131849983 GCTGTACTACTGGAGCTGCAGGG - Intergenic
987480935 5:18457033-18457055 ACTGAGGTGCTGCAGCTGCAAGG + Intergenic
990168233 5:53018367-53018389 GCTAGGATGCTGGAGGTCCATGG + Intronic
990207959 5:53450616-53450638 ACTGCTATGCTGGAGGTGGAGGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997465344 5:134084373-134084395 GCTGAGCTACTGGAGCTGCATGG + Intergenic
1001347792 5:170922540-170922562 ACTGCGATGCTGCAGCTTGACGG - Intronic
1005571216 6:27147309-27147331 GCTGAGATCCTGGAGCTGGCTGG + Exonic
1006308179 6:33237734-33237756 GCTGCTCTGCTGGGCCTGCAAGG - Intergenic
1014282292 6:119455361-119455383 GCTGCCATTCTGGATCTTCAAGG + Intergenic
1015383879 6:132600501-132600523 ACAGCAATGCTGGAGCTCCATGG + Intergenic
1017870859 6:158485515-158485537 GCTGGGATGATGGAGCTGTTTGG + Intronic
1018206166 6:161439161-161439183 CCTGCGATGCCGCAGCTGAAAGG + Intronic
1018621515 6:165733415-165733437 GCTGCCACGCTTGAGCTGCCCGG + Intronic
1018901580 6:168054363-168054385 GCTGTGATGCTGGAGGTCCTTGG + Intergenic
1018942619 6:168319533-168319555 GCGGGGCTGCAGGAGCTGCAGGG - Exonic
1019911594 7:4103688-4103710 GGAGAGATGCTGGAGGTGCAGGG + Intronic
1023051752 7:36258673-36258695 CCTGGGATGCTGGAGCTGGTGGG - Intronic
1024056387 7:45662233-45662255 CCTGCCATGCTGGAGCTGCCAGG + Intronic
1035595148 8:851838-851860 GCTGGGTGGCGGGAGCTGCAGGG + Intergenic
1037579911 8:20238968-20238990 GCTGCCATGCTGGAGCAGGGGGG - Intergenic
1037947672 8:22999447-22999469 GCTGCGAGGCGGGATCTGCGGGG + Intronic
1039885883 8:41653797-41653819 GCTGCGTCGGAGGAGCTGCAGGG - Intronic
1042497050 8:69466826-69466848 GCTGCCTTGCTGGAGCTGTGTGG + Exonic
1044994056 8:97822061-97822083 GCGGAGGAGCTGGAGCTGCAAGG - Intronic
1046233341 8:111387368-111387390 GCTGCCCTGCTGGAGCTGTGTGG - Intergenic
1046479117 8:114791692-114791714 GCTGCGGTGATGGAGCCTCATGG + Intergenic
1047132512 8:122037007-122037029 GCTGCAATGCTGTCTCTGCAAGG + Intergenic
1047502768 8:125454692-125454714 GCTGGGAAGCTGAATCTGCAAGG + Intergenic
1048550028 8:135425580-135425602 GAAGTGAGGCTGGAGCTGCAGGG + Intergenic
1048764710 8:137831479-137831501 GGGACGATGCTGGAGCTCCAAGG - Intergenic
1049224266 8:141442088-141442110 GCTGCCATCCTTGAGCTGAAGGG - Intergenic
1051339985 9:16102264-16102286 ACTGAGATGTTGGGGCTGCAGGG - Intergenic
1053297794 9:36927288-36927310 GCTGGGCTGCTGGGTCTGCAAGG + Intronic
1053633952 9:39975621-39975643 GCTGTACTACTGGAGCTGCAGGG - Intergenic
1053656602 9:40222985-40223007 CCTGCGATCCTGGGGCTGCCCGG + Intergenic
1053771793 9:41487883-41487905 GCTGTACTACTGGAGCTGCAGGG + Intergenic
1054209935 9:62275076-62275098 GCTGTACTACTGGAGCTGCAGGG + Intergenic
1054315058 9:63573878-63573900 GCTGTACTACTGGAGCTGCAGGG - Intergenic
1056795455 9:89655773-89655795 GTTGTGATGCTGCAGCTGAATGG - Intergenic
1057276911 9:93680918-93680940 GCTGCGGGGCTGAAGGTGCAGGG - Intergenic
1057972721 9:99572880-99572902 CCTGGGATGCTGGGGCAGCAGGG + Intergenic
1059145592 9:111896824-111896846 GCTGCGGCGGTGGAGCTGCTCGG + Exonic
1059993695 9:119889146-119889168 GAAGTGATGCTGGAGCTGCCTGG + Intergenic
1060225189 9:121786152-121786174 CCTGAGATGCTGAAGATGCAGGG - Intergenic
1061319400 9:129818629-129818651 GCAGCAATGCTGGAGCAGAAAGG - Exonic
1062091672 9:134681626-134681648 GGTGCCATGCTGGGGCTGCAAGG - Intronic
1062534303 9:137014796-137014818 GCTGCGCTCCAGGTGCTGCAGGG + Exonic
1186812706 X:13205959-13205981 GCACAGATGATGGAGCTGCATGG + Intergenic
1191975525 X:66867125-66867147 GCTACGGTGCTGGGGCTCCATGG + Intergenic
1192360359 X:70435064-70435086 GCTGAGAGGTTGGGGCTGCAGGG - Intergenic
1198973806 X:142312153-142312175 GCTTCCATGCTGGAGCAGAATGG - Intergenic
1199489957 X:148387311-148387333 GGTGCCATGCTGGAGCTTCTTGG - Intergenic
1199832699 X:151561366-151561388 GTTGGGACCCTGGAGCTGCATGG + Intergenic
1200154673 X:153969195-153969217 GGTGGGAAGCTGGAGCTGCCTGG - Intronic
1200703091 Y:6418812-6418834 GTGGCTCTGCTGGAGCTGCAGGG - Intergenic
1201031019 Y:9745885-9745907 GTGGCTCTGCTGGAGCTGCAGGG + Intergenic
1202177792 Y:22113625-22113647 GTGGCTCTGCTGGAGCTGCAGGG - Intergenic
1202213569 Y:22472770-22472792 GTGGCTCTGCTGGAGCTGCAGGG + Intergenic