ID: 973774948

View in Genome Browser
Species Human (GRCh38)
Location 4:54233728-54233750
Sequence CAGGGGAGTGTGGAGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1666
Summary {0: 1, 1: 0, 2: 12, 3: 181, 4: 1472}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973774941_973774948 1 Left 973774941 4:54233704-54233726 CCTTGTAATTCAATGTGGGAGAA 0: 1
1: 0
2: 0
3: 10
4: 174
Right 973774948 4:54233728-54233750 CAGGGGAGTGTGGAGGAGGACGG 0: 1
1: 0
2: 12
3: 181
4: 1472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973774948 Original CRISPR CAGGGGAGTGTGGAGGAGGA CGG Intronic
900083534 1:876038-876060 TGGGGGAGTGTGGGGGAGTATGG - Intergenic
900083646 1:876402-876424 TGGGGGAGTGTGGGGGAGTATGG - Intergenic
900124340 1:1062846-1062868 CGGGGGCGTGTGGAGAAGGAGGG + Intergenic
900158920 1:1214218-1214240 CAGAGGAGGCGGGAGGAGGAAGG + Intergenic
900166153 1:1245055-1245077 GAGGGGGGAGTGGGGGAGGAGGG - Intronic
900408727 1:2503552-2503574 CAGGGGGGTCTGGAGGGGCAGGG - Intronic
900437974 1:2640509-2640531 GAGGGGCCTGTGGAGGAGGGAGG + Intronic
900475199 1:2873199-2873221 CAGGGAGTTGGGGAGGAGGAAGG - Intergenic
900624529 1:3602206-3602228 GAGGGGTGTGTGGAGGAGGAGGG - Intronic
900640137 1:3684575-3684597 TGGGGGAGTGTAGAGGTGGAGGG + Intronic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
900807996 1:4780504-4780526 CCGGGGAATGTGGAAGAGGTGGG + Intronic
900966363 1:5961628-5961650 TGGGGGACAGTGGAGGAGGATGG - Intronic
901301084 1:8200526-8200548 GCGGGGAGTGGGGAGGAGAAAGG + Intergenic
901403981 1:9033825-9033847 AAGGGGGTTGGGGAGGAGGAAGG - Intergenic
901441790 1:9282518-9282540 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
901526336 1:9825122-9825144 CAGGTGGGGGTGGAGGAGGCTGG + Intergenic
901644494 1:10709265-10709287 CAGTGGAGTGCGGGGGCGGATGG - Intronic
902155622 1:14483283-14483305 CAGGGTTGCATGGAGGAGGAGGG - Intergenic
902239567 1:15079607-15079629 CATGGGTGCGTGGAGAAGGATGG + Intronic
902320340 1:15658941-15658963 AAGGGGAATGTGGAGGGAGATGG - Intronic
902389772 1:16096397-16096419 GAGTGGAGTGTGAGGGAGGAGGG - Intergenic
902517633 1:16997875-16997897 AAGGGGAGGGGGAAGGAGGAGGG + Intronic
903287483 1:22285967-22285989 CGGGGGAATGTGTAGGAGGGAGG - Intergenic
903420359 1:23214635-23214657 CAGGGTGATGTGGTGGAGGAGGG - Intergenic
903654785 1:24942632-24942654 CAGAGGAGTGGGGAGAAGGCAGG - Intronic
903669139 1:25025217-25025239 GGGGGGAGTGGGGAGAAGGAGGG + Intergenic
903751490 1:25624206-25624228 AGGGGGAGTGAGGAGGAAGACGG - Intronic
903966802 1:27095851-27095873 ATGGGGAGTGTGGATGTGGAAGG - Intergenic
904348725 1:29891157-29891179 GAGGAGGGTGTGGAGGTGGAGGG + Intergenic
904417334 1:30371396-30371418 CAGGAGAGAGTGGAGCAGGCTGG + Intergenic
904441400 1:30534356-30534378 TAGGGGGGTGGGGAGGAGAATGG - Intergenic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
904548815 1:31298015-31298037 CAGTGGGGTGTGGTGGAGGAGGG + Intronic
904909300 1:33922101-33922123 CATGGGAGTGGGGAAGAGCAGGG - Intronic
904912973 1:33949286-33949308 CAGGGCAGTGTGGGAGAGGCTGG + Intronic
905237601 1:36560813-36560835 AAGAGGAGTGTGGAGGAGGCTGG + Intergenic
905261471 1:36722094-36722116 CAGGGGTGTGGGGCAGAGGAGGG + Intergenic
905414498 1:37794776-37794798 CTGGGGTGTGGGAAGGAGGAAGG - Intronic
905520322 1:38594009-38594031 CAGGTCAGTCTGGAGCAGGATGG + Intergenic
905656870 1:39691224-39691246 GAAGGGAGAGTGGAGGGGGAGGG + Intronic
905852781 1:41286546-41286568 CAGTGGGGTGGGGAGGAGAAAGG + Intergenic
905975709 1:42172230-42172252 TAGGGGAATTTGCAGGAGGAGGG - Intergenic
906159473 1:43637137-43637159 AAGGGGAGAGTGGGGCAGGATGG + Intergenic
906195412 1:43927529-43927551 CAGAGGAGTGATGAGGACGAGGG + Intronic
906220053 1:44071476-44071498 CAGGGAAGGCTGGAGAAGGAAGG - Intergenic
906581877 1:46941530-46941552 GTGGGGAGAGTGAAGGAGGAGGG + Intergenic
906592171 1:47035597-47035619 CAGCGGAGTGAGAAGGAGCATGG - Intronic
906648767 1:47495272-47495294 GAAGGGAGTGTGGTGGAGGCTGG + Intergenic
906747781 1:48233802-48233824 CAGTGGAGATTGGAGGAGGCTGG - Intronic
906782675 1:48586460-48586482 CAGGTGAGGAGGGAGGAGGAGGG + Intronic
907076347 1:51582662-51582684 CAAGTGAGTGTAGAGAAGGAGGG - Intronic
907328028 1:53653604-53653626 CAGTGGGGTGAGGGGGAGGAGGG - Intronic
907383808 1:54112578-54112600 CATGGGAGTGCAGAGGAGGCAGG - Intergenic
907536663 1:55167656-55167678 CAGCTGTGTGTGGAGAAGGATGG + Intronic
907974997 1:59423069-59423091 CAGAGGATTGTGTAGCAGGAGGG + Intronic
907994866 1:59619875-59619897 CAGCTGAGTGAGGAGGATGATGG + Intronic
908121928 1:60993988-60994010 CAGGGGCAAGTGGAGGTGGAAGG + Intronic
908598651 1:65715133-65715155 TAGGGGATTGTGGGGGAGGTGGG + Intergenic
908884541 1:68773311-68773333 CAGGAGAGTGATGAGGAGGATGG - Intergenic
909433694 1:75616584-75616606 GAGGAGGCTGTGGAGGAGGACGG - Intergenic
909480583 1:76125468-76125490 GAGGGGAGAGAGGTGGAGGAGGG - Intronic
909546562 1:76854643-76854665 GAGGTGGGGGTGGAGGAGGATGG - Intergenic
909594163 1:77386423-77386445 CAGAGGAGTGTGGAGGACTGTGG + Intronic
910326489 1:86013960-86013982 AAGGGGACTGTGCAGGAGAAAGG - Intronic
911272175 1:95815498-95815520 CAGGAGAGCCTGGAGAAGGAAGG + Intergenic
912469222 1:109895192-109895214 CTGGGGAGTGAGTAGGAGGTAGG - Intergenic
912635214 1:111285607-111285629 AAGGGGTGAGTGGAGCAGGAAGG + Intergenic
912710867 1:111948798-111948820 CAGGGAAGTGGGGAAGATGAGGG + Intronic
912877028 1:113370557-113370579 CAGGGCAGAGTGGGGAAGGATGG + Intergenic
913158958 1:116128337-116128359 CAGGTGAGTGTGGGGCAGGTTGG + Exonic
913209519 1:116571102-116571124 CCGCGGAGGGTGGGGGAGGAAGG - Intergenic
913494398 1:119415040-119415062 AAAGGGATTCTGGAGGAGGAGGG + Exonic
913667282 1:121059997-121060019 AAGGGGATTGTGGAGGGTGAGGG + Intergenic
914018972 1:143847140-143847162 AAGGGGATTGTGGAGGGTGAGGG + Intergenic
914657523 1:149755347-149755369 AAGGGGATTGTGGAGGGTGAGGG + Intergenic
914665923 1:149832499-149832521 CTGAGCAGAGTGGAGGAGGAGGG + Intergenic
914669842 1:149861295-149861317 CTGAGCAGAGTGGAGGAGGAGGG - Intronic
914815638 1:151060004-151060026 GAGGCGAGTCTGGAGGAGCAGGG + Exonic
914902208 1:151716802-151716824 GAGGGGGGTGTGGAGGGGGGAGG - Exonic
915004423 1:152623298-152623320 CAGGGGAGAGGGCCGGAGGAAGG - Intergenic
915076193 1:153309684-153309706 CAGAGGACTGGGGAGGGGGAGGG + Intronic
915084298 1:153374656-153374678 GAGGGGAGAGTGGAGGTTGAGGG - Intronic
915110455 1:153561572-153561594 CAGGAGAAAGTGGATGAGGAGGG - Exonic
915167441 1:153956239-153956261 CAGGGAAGCCTGGAGAAGGAGGG + Intronic
915267942 1:154732142-154732164 CAGGGGAAAGTGGAGATGGAGGG - Intronic
915273417 1:154771909-154771931 CAGGGAAGGGAGGAGGAGTAGGG - Intronic
915472964 1:156136793-156136815 CAGGGGTGTGTGTAGATGGAAGG + Intronic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915611209 1:156994612-156994634 CAGGTGTGTGTGGAGAAGGGAGG + Intronic
915724531 1:158008156-158008178 GAGGGGGGTGGGGAGGAAGAGGG + Intronic
916046926 1:161006804-161006826 AAGGGGAATGTGGACCAGGATGG - Intronic
916242921 1:162657827-162657849 CTGGGGAGTGGGGAGGGGAAGGG - Intronic
916336151 1:163673164-163673186 CTGGGGAGTGAGGAGGAAAAGGG - Intergenic
916693783 1:167217006-167217028 AAGGGAAGTTTGGAGGAGGGGGG - Intergenic
916755416 1:167764971-167764993 CAGGGGTGTGGGGGGAAGGACGG + Intronic
916932447 1:169592831-169592853 AAGGGGATTATGGAGGAGGCAGG - Intronic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917731180 1:177876622-177876644 CTGGGCAGTGGGGAGGAGGCTGG + Intergenic
917840416 1:178973065-178973087 CTACAGAGTGTGGAGGAGGAGGG + Intergenic
917962859 1:180158205-180158227 GAGAGGTGGGTGGAGGAGGAAGG + Intronic
918187911 1:182144067-182144089 CAGGGCAGTGTGGTTGAGGCTGG - Intergenic
918188005 1:182144497-182144519 CCAGGGGGAGTGGAGGAGGAAGG + Intergenic
919481583 1:198096624-198096646 GAGGGTAGGGTGGAGAAGGAGGG + Intergenic
920070028 1:203296129-203296151 CCTGGGAGTGAGGATGAGGAGGG + Intergenic
920101855 1:203521876-203521898 CAGGGGAGTGGGGAGGACGCTGG + Intergenic
920195632 1:204224488-204224510 CAGGGTAGGGTGGGGGACGAGGG - Intronic
920255611 1:204652219-204652241 AAGGGGAGAGAGGAGGGGGAAGG - Intronic
920420150 1:205827696-205827718 CAAGGGAAAGTGGAGGAGGAGGG - Intergenic
920919736 1:210288667-210288689 CAGGGAAGGGTCCAGGAGGAGGG - Intergenic
921396428 1:214673522-214673544 CAGGGAGGTGTGGAGGGAGAGGG - Intergenic
921826594 1:219678966-219678988 CAGGGCAGTGGGGTGGGGGATGG + Intergenic
921983720 1:221286030-221286052 CAGGGAGGTGTGGAGGGAGAGGG - Intergenic
922060802 1:222089401-222089423 CAGTGGAGTGAGGAGGCTGAGGG + Intergenic
922319291 1:224471382-224471404 TGGGGGAGTGGGGAGGAAGAGGG - Intronic
922339650 1:224645218-224645240 CAGGGCAGTGGGGAGGTGGTGGG - Intronic
922350216 1:224729068-224729090 CAGGGGAGGGTGGAGGAACAAGG + Intronic
922427667 1:225514709-225514731 CAGGAGGTGGTGGAGGAGGAGGG + Exonic
922496741 1:226063050-226063072 CAGGGGCGCGGGGAGGAGGAGGG - Intronic
922506679 1:226130128-226130150 CAGGGAAGGGTGGTGGAGAAGGG + Intergenic
922594451 1:226803215-226803237 CACGGGGGTCTGGAGGAAGAAGG - Intergenic
922767572 1:228163860-228163882 CAGGTGATGGTGGAGGATGAGGG - Intergenic
922770962 1:228182697-228182719 ATGGGGTGTGTGGGGGAGGACGG + Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
923022505 1:230175648-230175670 GAGGACAGTGAGGAGGAGGAGGG - Intronic
924035370 1:239930719-239930741 AAGGGGATTATGGAGGATGAAGG + Intergenic
924603580 1:245513132-245513154 GAGGAGGGTGTGGAGGAGGGTGG - Intronic
1062763591 10:45543-45565 TGGGGGAGTGTGGGGGAGTATGG + Intergenic
1062823841 10:554610-554632 CAGGGCAGTGGGGAGGAGAAGGG - Intronic
1062898667 10:1125051-1125073 CAGGGCACAGTGGAGGAGGACGG + Intronic
1062913620 10:1230754-1230776 CTGGAGAGCGTGGAGAAGGAAGG - Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1062960742 10:1572052-1572074 CAGGGGAGTGTGCAGGTGAGTGG + Intronic
1063087337 10:2831693-2831715 CAGGGGAGTGTGGCGGCCGTGGG - Intergenic
1063353119 10:5374229-5374251 CAGCGGGGTGGGGAGGGGGAGGG + Exonic
1063424962 10:5943669-5943691 CACGGGCGTGCGGAGGAGGCTGG + Intronic
1063780454 10:9316576-9316598 CAGGAGTGTGAGGAGGAGAATGG + Intergenic
1063919858 10:10921626-10921648 CAGGAGAGAGGGGAAGAGGACGG + Intergenic
1064178688 10:13097241-13097263 CATGGAAGTGTGCAGGAAGATGG + Intronic
1064657569 10:17570957-17570979 CGGGGGAGTGGGGTGGAGGGAGG + Intergenic
1064962258 10:20978201-20978223 CAGGGAAGTGTTGGGGAAGATGG - Intronic
1065297330 10:24289437-24289459 GAGGAGAAGGTGGAGGAGGAGGG + Intronic
1065320207 10:24502192-24502214 CCGTTCAGTGTGGAGGAGGATGG - Intronic
1066235643 10:33481624-33481646 TAGGGGAGCCTGCAGGAGGAGGG + Intergenic
1066280497 10:33912921-33912943 CAGTGGATTGTGCAGGAGGAGGG + Intergenic
1066400727 10:35073267-35073289 AAGGTGAGAGTGGAGGAGGTGGG + Intronic
1066446767 10:35491033-35491055 TTGGGGTGTGTGGAGGAGGGTGG + Intronic
1066555480 10:36608163-36608185 CAGGGGTGTGTGGGGAAGGAGGG - Intergenic
1067030358 10:42875476-42875498 CAGGGAAGGCTGGAGGAAGAGGG - Intergenic
1067044205 10:42975281-42975303 CAGGGGAGGCTGGAGGGGGTGGG - Intergenic
1067045514 10:42983086-42983108 CAGGGGTGTTTAGAGGAGGGAGG - Intergenic
1067048950 10:43001114-43001136 CAGGGTGGTGTGCAGGGGGAGGG - Intergenic
1067051768 10:43025527-43025549 CAGGGGCAGGTGGAGGAGGAGGG - Intergenic
1067415389 10:46098157-46098179 CAGGGGAGTGTGAAGTAGGGAGG + Intergenic
1067662530 10:48247156-48247178 GAGGAAAGTGTGCAGGAGGAAGG + Intronic
1067666762 10:48285849-48285871 CAGGGGAGGGTGAAGAGGGATGG - Intergenic
1067844767 10:49710867-49710889 CTGGGGAATGGGGAGAAGGAGGG - Intergenic
1068866922 10:61903888-61903910 CCGGGGAGGGTGGAGGGGGGAGG - Intronic
1069062758 10:63911556-63911578 TGGGGGAGTGTGGAGGAAGGAGG - Intergenic
1069215385 10:65812429-65812451 CAGGGAGGTGTGGAGGGAGAGGG - Intergenic
1069640558 10:69952705-69952727 CTGGGGGGTGGGGAGGAGGTGGG + Intronic
1069761865 10:70816443-70816465 GAAGGGAGTGCGGAGGAGGCAGG + Intronic
1069789670 10:71011591-71011613 CTGGGGAGGGTGTGGGAGGATGG + Intergenic
1070279409 10:75037849-75037871 CAGGACGGTGAGGAGGAGGATGG - Exonic
1070629843 10:78076666-78076688 GAGGGGAGAGGGGAGGGGGAGGG + Intergenic
1070729214 10:78813768-78813790 CAGGGGAGAGAGGAAGGGGAAGG - Intergenic
1070776398 10:79112369-79112391 CATGGGTGTGTGCAGGAGCAGGG + Intronic
1070776623 10:79113527-79113549 AAGTGGAGTGTGGAGCAGGCTGG - Intronic
1070793469 10:79203426-79203448 GGAGGGAGTGTGGGGGAGGAGGG - Intronic
1071377520 10:85024007-85024029 CAAGGGAATGGGGAGTAGGAGGG - Intergenic
1071494049 10:86155665-86155687 CAGGGGAGTGGAGACGAGAATGG - Intronic
1071815640 10:89229859-89229881 CAGGGGAGTGTGGGGGCAGAGGG + Intronic
1072223851 10:93349880-93349902 TTGTGGAGTGTGGAGGAGAAAGG - Exonic
1072472914 10:95731211-95731233 CAGAGCAGGGTGGAGGAGAATGG - Intronic
1072603898 10:96961042-96961064 GTGGGGAGGGTGGAGTAGGATGG + Intronic
1072904458 10:99439535-99439557 CAGGGGTGGGAGTAGGAGGAAGG + Intergenic
1072985236 10:100133907-100133929 CAGGGGGATGGAGAGGAGGAAGG - Intergenic
1073053433 10:100684034-100684056 CAGGGGGGAGGGGAGGAGCAGGG + Intergenic
1073054568 10:100690851-100690873 CAGGAGGATGTGAAGGAGGAAGG + Intergenic
1073072549 10:100803732-100803754 GAGGGAAGTGGGGAGGAGAAAGG - Intronic
1073266118 10:102229484-102229506 GATGGGAGTGGGGCGGAGGAGGG + Exonic
1073340915 10:102743990-102744012 GAGGAGAGGGAGGAGGAGGAGGG + Exonic
1073936669 10:108640660-108640682 CAGGGGAGTTTGGTGGGGGTAGG + Intergenic
1074046512 10:109844414-109844436 CAAGGGAGTGTGGGAGAGGAAGG + Intergenic
1074060563 10:109961779-109961801 TTGGGGAGGGTGGGGGAGGAAGG + Intergenic
1074103864 10:110374614-110374636 GAGGTGAGAGTGGAGGAAGAGGG - Intergenic
1074130317 10:110567951-110567973 GCGGGGACTGTGGGGGAGGAGGG + Intronic
1074444950 10:113514050-113514072 AAGGGGAGCGTTCAGGAGGAAGG + Intergenic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074578872 10:114697072-114697094 CAGGGCACTCTGGGGGAGGAAGG + Intergenic
1074612419 10:115034969-115034991 CAGGTGGGAGTGGAGAAGGATGG - Intergenic
1074765057 10:116694533-116694555 AAGGGGAGGGAGGAGGTGGAGGG - Intronic
1075010544 10:118866121-118866143 CAGGGGGTGGTGGAGGAGGCAGG - Intergenic
1075062695 10:119267839-119267861 GTGGGGAGTGTGGAGGAGCTGGG - Intronic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075223375 10:120603355-120603377 AAGGGGATTGTGGAGGATGAGGG + Intergenic
1075628697 10:123985919-123985941 AAGGGGATTATGGAGGATGAGGG + Intergenic
1075688507 10:124380006-124380028 CAGGGGAGTCGGGAGGAGCAGGG - Intergenic
1075688595 10:124380375-124380397 CTGGGGAGTCGGGAGGAGCACGG - Intergenic
1075709048 10:124521045-124521067 AAGGGGACAGTGCAGGAGGAGGG - Intronic
1075793575 10:125103236-125103258 CAGGGGGGTGTGGAGTGGGCTGG - Intronic
1075924515 10:126239976-126239998 CACGGAAGGATGGAGGAGGAGGG - Intronic
1076029369 10:127144306-127144328 CAGAGGTGTGTGGATGAGGCAGG - Intronic
1076071168 10:127490970-127490992 AAGGGGACTGGGGAGGGGGAGGG - Intergenic
1076099271 10:127761825-127761847 AAGGGGATTGTGGAGGATGAGGG - Intergenic
1076252348 10:128994583-128994605 CAGGGGGAGGTGGAGGAGAAAGG + Intergenic
1076437300 10:130454908-130454930 CAGGGAAGTGTGGACAGGGAAGG - Intergenic
1076500590 10:130933289-130933311 CAGGTGAGCGTGGATGCGGAGGG + Intergenic
1076619199 10:131776092-131776114 CTGGAGAGAGTTGAGGAGGAAGG - Intergenic
1076806789 10:132862791-132862813 CAGGAGAGGCTGGAGGGGGACGG + Intronic
1076829192 10:132985781-132985803 CAGGTGAGGGTGCAGGAGGTTGG + Intergenic
1076850340 10:133089282-133089304 CAGGGTGGCGTGGAGGAGGCCGG - Intronic
1076902643 10:133347531-133347553 CAGGGGAGTGTGCGGGTGGGAGG + Intronic
1077052073 11:571494-571516 CAGGGGTGGCTGGAGGAGGTGGG - Intergenic
1077065096 11:637540-637562 CAGGAGAGCGAGGAGGAGGTCGG - Exonic
1077204556 11:1336363-1336385 CAGGGGAGGTGGGAGGAGGGAGG - Intergenic
1077368486 11:2170812-2170834 TAGGGGAGGGCGGGGGAGGACGG + Intronic
1077479077 11:2804686-2804708 CAGGAGAGTGTGGAGAATGGTGG - Intronic
1077615536 11:3671100-3671122 TTGGGGAGTGTGGAGGAGAGGGG - Intronic
1077701102 11:4443476-4443498 GAGGGGAGGGTGGAGAAGGAAGG + Intergenic
1077701110 11:4443495-4443517 AAGGGGAGGGTGGAGAGGGAAGG + Intergenic
1077701125 11:4443533-4443555 AAGGGGAGGGTGGAGAGGGAAGG + Intergenic
1077701133 11:4443552-4443574 AAGGGGAGGGTGGAGAGGGAAGG + Intergenic
1077701140 11:4443571-4443593 AAGGGGAGGGTGGAGAAGGAAGG + Intergenic
1077701147 11:4443590-4443612 AAGGGGAGGGTGGAGAAGGAAGG + Intergenic
1077761751 11:5107726-5107748 AGGGGGAGGGGGGAGGAGGAAGG + Intergenic
1077815575 11:5682932-5682954 CAGGGAGGTGTGGAGGGAGAGGG + Intronic
1078708034 11:13764213-13764235 CTGGGGAGTGGGGCAGAGGATGG - Intergenic
1078840529 11:15072951-15072973 CAGAGGAGTGAGGTGGAGAAGGG + Intronic
1078958902 11:16239794-16239816 GAGGGGAGTGTGGAGCAAAAGGG - Intronic
1079036057 11:17021134-17021156 AAGGGGATTGTGGAGGGTGAGGG - Intergenic
1079099770 11:17533908-17533930 CAGGGGCCTGGGGAGGGGGAAGG - Intronic
1079247275 11:18761844-18761866 GAGGTGAGTGTGCAAGAGGAAGG + Intronic
1079365663 11:19807311-19807333 AAGGTGAGGGTGGAGGAGGCCGG - Intronic
1079517194 11:21283034-21283056 TGGGGGAGTGTGGGGGAGGTGGG + Intronic
1079655373 11:22980257-22980279 AAGGGGATTGTGGAGGATAAGGG + Intergenic
1080575706 11:33597371-33597393 GAGGGGAGAAGGGAGGAGGAGGG + Intronic
1080947926 11:36995889-36995911 GAGAGGAGTGAGGAGGATGAGGG - Intergenic
1081556554 11:44167956-44167978 CGGGGGAGTGGGGAGGGGGGAGG - Intronic
1081596162 11:44460953-44460975 CAGAGCAGTGTGGAGAAGGGTGG + Intergenic
1081613120 11:44575351-44575373 CAGGAGACTGTTGGGGAGGAAGG - Intronic
1081634367 11:44711163-44711185 CAGGGTAGAGAGGAGGAGGGAGG + Intergenic
1081873456 11:46393379-46393401 GTGGGGGTTGTGGAGGAGGAAGG + Intergenic
1081875207 11:46403839-46403861 AAGGGGAGTGGGGAGGGGCAGGG + Intronic
1081966949 11:47176047-47176069 CAGGGTAGTGTGGAGGAAATGGG - Intronic
1081984111 11:47289218-47289240 CATGGCAATGTGGAGGAGGTGGG - Intronic
1082804780 11:57440878-57440900 CAGGGCAGTGAGGAGCAGAAAGG - Intergenic
1083437054 11:62649749-62649771 CATGAGAGGGTGGAGGTGGACGG + Exonic
1083593267 11:63907457-63907479 CTGGGGATTGCAGAGGAGGAAGG - Intronic
1083637414 11:64128110-64128132 GAGGTGAGGATGGAGGAGGAGGG - Intronic
1083656936 11:64234435-64234457 AGGGGGTGTGTGGAGGAGGCGGG + Intergenic
1083728399 11:64640355-64640377 GAAGAGAGTGTGGAAGAGGAAGG - Intronic
1083996299 11:66274742-66274764 TGGGGGAGTGGGGAGGAGAAAGG - Intronic
1084026312 11:66452287-66452309 CAGGATAGTGTGGGGCAGGAGGG + Intronic
1084067696 11:66714794-66714816 CTGGGGCATGAGGAGGAGGAGGG + Intronic
1084149107 11:67279908-67279930 CAGGGAAGTGTGGGAGAGGAAGG + Intronic
1084170511 11:67398702-67398724 CAGGTGAGTGTGGGGAAGAAAGG - Exonic
1084267581 11:68012782-68012804 CAGGGGACTGTGAGGGAGGTGGG + Intronic
1084517713 11:69645468-69645490 CAGCGGTGGGTGAAGGAGGAGGG + Intronic
1084651088 11:70489935-70489957 CAGGGCAGGGTGGGGGAGGGGGG + Intronic
1084956791 11:72695864-72695886 CACTGGAGAGGGGAGGAGGAGGG + Exonic
1085470141 11:76752542-76752564 CAGAGGTGTGTGGAGGAGGTGGG + Intergenic
1085554677 11:77409787-77409809 AAAGGGAGTGAGGAGGATGAAGG + Intronic
1085801433 11:79593644-79593666 CAGGGAAGGGTCAAGGAGGAAGG - Intergenic
1085845620 11:80061313-80061335 CAGGCGAATGTGGAGAGGGAGGG + Intergenic
1087203721 11:95372322-95372344 CAGGAGGATGTGAAGGAGGAGGG + Intergenic
1087230241 11:95653048-95653070 CAGGGGAATGGGGAGGAGAGTGG + Intergenic
1087850285 11:103019843-103019865 AAGGGGAGTGAGAAGGAAGAAGG + Intergenic
1087951572 11:104227172-104227194 GGGGGGAGTGAGGGGGAGGAAGG + Intergenic
1088376947 11:109151726-109151748 GAGGGGAGAGGGGAGGGGGAGGG - Intergenic
1088645476 11:111913320-111913342 GAGGGGAGTCAGGAGGAGTAGGG - Intronic
1088881281 11:113975357-113975379 CAGGAGTGTGGGGAGGAGCAAGG - Exonic
1089063752 11:115646395-115646417 CAGGGGTGTCTGGTTGAGGAGGG + Intergenic
1089182163 11:116590543-116590565 CTAGGGGGTGAGGAGGAGGAGGG - Intergenic
1089257756 11:117202973-117202995 CAGGCCAGGGTGGAGGAGGGAGG - Exonic
1089432611 11:118436446-118436468 CAGGGGGGCGGGGAGGCGGAGGG - Intergenic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089624676 11:119743487-119743509 CAGGTGAGGGAGGAGGGGGAAGG - Intergenic
1089652824 11:119925799-119925821 CAGGGGAGTGAGGCAGAGAAAGG + Intergenic
1089705326 11:120273609-120273631 GAGGGGAGTGTGGGTGAGAAGGG + Intronic
1090359229 11:126161118-126161140 CAGTGAAGTGTGGAAGGGGAGGG - Intergenic
1090442666 11:126737221-126737243 GAAGGGAGTGGGGAGGAGCAGGG + Intronic
1090473944 11:127003399-127003421 CGGGGGAGGGAGGAGGAGGGAGG + Intronic
1090868993 11:130726315-130726337 AAGGGGAGTGTGGAGGGAGATGG + Intergenic
1091195923 11:133730690-133730712 AAGGTGAGTGTGGAGAAGCAAGG - Intergenic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091241130 11:134053146-134053168 GGGGGGGGGGTGGAGGAGGAGGG + Intergenic
1091304733 11:134530223-134530245 CGGAGGAGGGTGGGGGAGGAGGG - Intergenic
1091304789 11:134530355-134530377 CAGAGGAGGGTGGGGGAGGAGGG - Intergenic
1091304802 11:134530385-134530407 CGGAGGAGGGTGGGGGAGGAGGG - Intergenic
1091304816 11:134530415-134530437 CGGAGGAGGGTGGGGGAGGAGGG - Intergenic
1091304830 11:134530445-134530467 CGGAGGAGGGTGGGGGAGGAGGG - Intergenic
1091304844 11:134530475-134530497 CGGAGGAGGGTGGGGGAGGAGGG - Intergenic
1091304865 11:134530522-134530544 CGGAGGAGGGTGGGGGAGGAGGG - Intergenic
1091571533 12:1691137-1691159 GAGGGGAGGGGGGAGGAGGGGGG - Exonic
1091588961 12:1831741-1831763 GAGGGGAGGGTGGGGGTGGAGGG - Intronic
1091613811 12:2033938-2033960 CAGAGGAGCATGGAAGAGGATGG + Intronic
1091665924 12:2418542-2418564 GAGGAGAGAGAGGAGGAGGAGGG + Intronic
1091699575 12:2650930-2650952 CAGGGCAGAGGGGAGTAGGAGGG + Intronic
1091774735 12:3177026-3177048 CGGGGGAGTGGGGAGGTGGTGGG + Intronic
1091787402 12:3251354-3251376 TGGGGGTGTGGGGAGGAGGAGGG + Intronic
1091818164 12:3455034-3455056 AAGGGGACTGTGGAGGACAAGGG - Intronic
1091821106 12:3475736-3475758 CCGTGGGGTGTGGAGGGGGAGGG + Intronic
1091869971 12:3881290-3881312 CAGGAGAGGGTGAGGGAGGAAGG + Intergenic
1091934169 12:4422342-4422364 CAGGGCTGGGTGGAGAAGGATGG + Intergenic
1091937624 12:4445966-4445988 CTGGGGAGTGTGGAGGGTGATGG - Intergenic
1092021015 12:5202148-5202170 CGAGGGAGTGTGGAGGGGGGCGG + Intergenic
1092071036 12:5631613-5631635 CAGGGGAGTCTGGAAGTGGGAGG + Intronic
1092092138 12:5812147-5812169 CAGGGGAGTGGAGGGGAGGCAGG + Intronic
1092122928 12:6057127-6057149 CAGGGGAGTGTTGACCGGGAGGG - Intronic
1092239474 12:6828352-6828374 AAGGGGAGGGAGGGGGAGGAAGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092746129 12:11674273-11674295 AATGGGCGTGTGGAGGAAGAGGG + Intronic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1093474922 12:19544208-19544230 CCGGGCAATGTGGAGGACGATGG + Intronic
1093806905 12:23445608-23445630 GCTGAGAGTGTGGAGGAGGATGG + Intergenic
1094298989 12:28939763-28939785 CAGAAGAGTGTGGAGGACAAGGG - Intergenic
1094327980 12:29260611-29260633 CAGGGGAGTGAAGAGTAGGAAGG + Intronic
1094555678 12:31497774-31497796 ATGGGGAGGGTGGAGGGGGAGGG + Intronic
1095051035 12:37554501-37554523 CAGGGGAGTATGGGGGAGTTGGG + Intergenic
1095475063 12:42578514-42578536 CTTGGGAGTGTGGAAAAGGAAGG + Intronic
1095550676 12:43435247-43435269 TAGAGGAGTGTGGAGGAGAATGG + Intronic
1095589835 12:43891046-43891068 CTAGTGGGTGTGGAGGAGGATGG - Intronic
1096077263 12:48813657-48813679 CAGGGGAGTGTAGGTGGGGAGGG + Intergenic
1096113599 12:49042442-49042464 CAAGGGAATGGGGAGGAGCAGGG + Intronic
1096115068 12:49050764-49050786 TGGGTGAGAGTGGAGGAGGAAGG + Exonic
1096229861 12:49890813-49890835 CTGAGGAGTGTGGAGGGGGTTGG - Intronic
1096319437 12:50598785-50598807 GAGGGGAGAGGGGAGGGGGAGGG - Intronic
1096420275 12:51451060-51451082 CAGGGGAATGGGGAGGCTGAGGG + Intronic
1096458807 12:51810329-51810351 CAAAGAAGTGTGGAGCAGGATGG - Exonic
1096464688 12:51841783-51841805 CAGAGGAGTGGGGAGGAGAAAGG + Intergenic
1096469776 12:51868928-51868950 CCGGGGTGTGTGTAGGAGGGAGG - Intergenic
1096484123 12:51965996-51966018 GAGGGGAGTGTGGAGATAGAGGG + Intronic
1096648974 12:53052774-53052796 GAGGAGAATGAGGAGGAGGAAGG + Intronic
1096807888 12:54151416-54151438 CTAGGGAGTTTGGAGGGGGAAGG + Intergenic
1096979706 12:55721402-55721424 CAGGGTGGTGTGGAGGCGGGAGG - Exonic
1097124034 12:56759005-56759027 AAGGGGATTGTGGAGAATGAGGG + Intronic
1097968113 12:65603219-65603241 AAGGGTAGGGTGGAGCAGGAAGG - Intergenic
1098331096 12:69354580-69354602 CAGAGGAGGGTGGAGGATAAGGG - Intergenic
1098394420 12:70003088-70003110 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1098986459 12:77017718-77017740 CAGAGGAGTGGGGAGAAGAAGGG + Intergenic
1099685230 12:85877632-85877654 GAGGGTGGAGTGGAGGAGGAAGG - Intronic
1099940827 12:89186350-89186372 TAGGGAAGTGTGGCAGAGGAAGG - Intergenic
1100217754 12:92470056-92470078 CAAGGGAGTCCGGAAGAGGAGGG - Intergenic
1100308610 12:93374235-93374257 CAGGGTAGCTTGGAGGAGGCAGG - Intergenic
1100482786 12:94995340-94995362 CAGGGGAATGTGCAGGCAGATGG + Intronic
1101291125 12:103370728-103370750 GAGGGTGGAGTGGAGGAGGAGGG + Intronic
1101643853 12:106609576-106609598 TAGGGGATTGTGGAGCAGGTGGG - Intronic
1101676085 12:106917846-106917868 CTGGGCAGTGCGGAGGAGGAGGG + Intergenic
1101695181 12:107118938-107118960 GAGGGAAGTGTGGAGGCAGATGG - Intergenic
1102167835 12:110820676-110820698 CTGGGGAGAGGGGAGGAGGAGGG - Intergenic
1102245580 12:111353684-111353706 TAGGGCAGTGGGGAGGAAGAGGG + Intergenic
1102416229 12:112765201-112765223 CATGGGAGTGGTGGGGAGGAAGG + Intronic
1102430992 12:112882677-112882699 CTGGGGAGTGAGGAGGAGCAGGG - Intronic
1102482478 12:113233276-113233298 CAGGCGAGTGGGGAGGAGAGTGG - Intronic
1102686311 12:114727502-114727524 CAAGGTAGTTTGGAGGGGGAAGG - Intergenic
1102786118 12:115606349-115606371 AAGGGGAGAGAGGAGGGGGATGG + Intergenic
1102820159 12:115901793-115901815 CTGGGGATTTTGGAGGAGGACGG + Intergenic
1103039715 12:117685132-117685154 CAGGGGATGGTGGAGGAGGCTGG - Intronic
1103302329 12:119937629-119937651 TAGGAAAGTGTTGAGGAGGAGGG + Intergenic
1103819955 12:123689653-123689675 GAGGGTAGTGAGTAGGAGGAGGG - Intronic
1103939793 12:124495500-124495522 CAGGTGAGTGTGGCAGTGGATGG - Intronic
1103972120 12:124678892-124678914 CAGGGGAGGGAGGAAGAGGAGGG - Intergenic
1104578337 12:129989153-129989175 CAGGGGAGAATGGAGGGAGAGGG + Intergenic
1105040925 12:132960608-132960630 CAAGGCAGTTTGGAGAAGGAGGG - Intergenic
1105500476 13:20967337-20967359 GAGGGGAGTGTAGAGAGGGAAGG - Intergenic
1105575803 13:21650556-21650578 GAGGGGGCTGGGGAGGAGGAGGG - Intergenic
1105927776 13:25023164-25023186 AAGGGGAGTGTGGCTGAGAAGGG - Intergenic
1106047334 13:26155449-26155471 CAGTGAAGTGGGGTGGAGGATGG + Intronic
1106124609 13:26890137-26890159 CTGGGGTGGGGGGAGGAGGAGGG - Intergenic
1106231728 13:27825941-27825963 CAGGAGAGAAAGGAGGAGGAAGG + Intergenic
1106550939 13:30769996-30770018 GGAGGGAGCGTGGAGGAGGAAGG - Intergenic
1107137877 13:36964351-36964373 CATGGTAGTATGGAGAAGGATGG + Intronic
1107355465 13:39561165-39561187 ATGGGGAGTGGGGAGGAGGCAGG - Intronic
1107412292 13:40169020-40169042 CACAGCAGTGTGGAGGAGGGTGG + Intergenic
1107550313 13:41468401-41468423 CAGGAGAGTGAGGAGCAGGAAGG - Intronic
1107660338 13:42632502-42632524 CCGGGGAGTGTAGAGCAAGACGG + Intergenic
1107834920 13:44405302-44405324 GAGGGGAGAGTGGGGAAGGAAGG - Intergenic
1108578212 13:51807220-51807242 CTGCGGAGTGGGGAGGAGGGTGG - Intergenic
1109614602 13:64814495-64814517 GAGCAGAGTGTGGAGTAGGAAGG - Intergenic
1109812723 13:67536649-67536671 CAGGGGTTTGTGCGGGAGGAAGG + Intergenic
1110357326 13:74582324-74582346 CAGAGCAGTGTGGAAAAGGATGG + Intergenic
1110368823 13:74718377-74718399 CAGGGAGGTGTGGAGGGAGAGGG + Intergenic
1110390995 13:74973839-74973861 CAGGGAAGGGAGGAAGAGGAAGG + Intergenic
1110415799 13:75250923-75250945 CTGGGAACTGTGGTGGAGGATGG - Intergenic
1110469692 13:75844934-75844956 CTGGGGAGTGTGGGGGAAGTGGG + Intronic
1110553010 13:76828280-76828302 GAGGGGAGAGGGGAGGGGGAGGG + Intergenic
1110689615 13:78416944-78416966 CTATGGAGTGTGGAAGAGGAAGG + Intergenic
1110704862 13:78593993-78594015 CAGGGGAGTGAGGAGAAAGGAGG + Intergenic
1110731506 13:78883539-78883561 TAGGGGAGAGTTGATGAGGATGG + Intergenic
1110844586 13:80179821-80179843 CAGGGGAGAATGGTGGAGGAAGG - Intergenic
1110947437 13:81440439-81440461 AAGGGTAGTGGGGAGGAGGGGGG + Intergenic
1112011746 13:95299361-95299383 GAGGGGCACGTGGAGGAGGAAGG - Intronic
1112109004 13:96273976-96273998 GAAGGGAGGGGGGAGGAGGAGGG - Intronic
1112336593 13:98522000-98522022 AAGGAGAGAGTGGAGGAGGAGGG - Intronic
1112586394 13:100722614-100722636 CGGGGGAGAATGGAGGAGGGGGG + Intergenic
1113325399 13:109276778-109276800 CAGGGGAGAATGGTGGAAGAAGG - Intergenic
1113390267 13:109889776-109889798 CAGGGTAGAGGGTAGGAGGAGGG + Intergenic
1113556390 13:111239121-111239143 CACGGGGGTGTGGGGGAGCAGGG - Intronic
1113660470 13:112103852-112103874 CGGGGGCGCGGGGAGGAGGAGGG + Intergenic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1113933465 13:113980916-113980938 GAGAGGAGTGAGCAGGAGGATGG + Intronic
1113995142 14:16058176-16058198 CAGAGGAGTGTTGGGGACGAGGG - Intergenic
1114263963 14:21060312-21060334 CAGGGCAATGTGGAGGGGGCTGG - Intronic
1114318050 14:21525226-21525248 GAGGGGGTGGTGGAGGAGGAGGG + Exonic
1114363530 14:22002574-22002596 AAAGGGAGTGGGGAGAAGGAAGG + Intergenic
1114482268 14:23043160-23043182 CTGGGGAGTGGGTGGGAGGATGG + Exonic
1114525876 14:23366488-23366510 CAGCGGAGTCCGGAGGAGGAAGG - Intergenic
1114535109 14:23417692-23417714 CAGGGGAGGGTGGCAGAGGGTGG + Intronic
1114627160 14:24137112-24137134 GAGGTGGGGGTGGAGGAGGATGG - Intronic
1114666098 14:24377910-24377932 AAGGAGTGTGTGGAGGAGGGAGG + Exonic
1114901924 14:27072279-27072301 GAGGGGAGAGGGCAGGAGGAGGG + Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115347726 14:32361166-32361188 GAGGGGAATGCGGAGGATGAGGG + Intronic
1116498923 14:45596805-45596827 CAGGGGAGGGGGGAGGGGGGAGG - Intergenic
1116809223 14:49523468-49523490 CTGGGCAGTGGGGAGGAGTAGGG - Intergenic
1117084570 14:52186109-52186131 GAGGGGAAAGTGGAGAAGGAGGG - Intergenic
1117206946 14:53452823-53452845 CAGGGGTGTGTGTAGCAGTAAGG + Intergenic
1117566739 14:57001366-57001388 CCGGGGATTGTGGGGGTGGAGGG - Intergenic
1117606031 14:57430293-57430315 AAGGGGAGGGTGGAGCAAGATGG + Intergenic
1117879110 14:60291547-60291569 CAGGGGTGTGTGTAAGAGAATGG - Intronic
1118349818 14:64965746-64965768 CTGGGGAGCGGGGAGAAGGAAGG + Intronic
1118381674 14:65222623-65222645 CAGGGGCCTCTGGGGGAGGATGG + Intergenic
1118730516 14:68662891-68662913 CAGAGCAGTGGGGAGGAGGATGG - Intronic
1118749168 14:68794141-68794163 GTGGGGAGGATGGAGGAGGAGGG - Intronic
1118776266 14:68976268-68976290 CAGGGGAGTGAGTGTGAGGAGGG - Intronic
1118869947 14:69733054-69733076 CTGGGGTGTGTGGAGAGGGAAGG + Intronic
1118876275 14:69787472-69787494 TAGGGCTGTGGGGAGGAGGAGGG - Intronic
1119108153 14:71943838-71943860 CAGCTGTGGGTGGAGGAGGAAGG + Intronic
1119145576 14:72310745-72310767 CAGGGGAGGCTGGTGGTGGAAGG - Intronic
1119195832 14:72716002-72716024 CAGAGGGGTGTGGAGGGGGAGGG - Intronic
1119261604 14:73241070-73241092 CAGGGGTGTGTGGGGCAGGCAGG + Intronic
1119266794 14:73267488-73267510 CAGAGGAGTGTCAAGGAAGAGGG + Intronic
1119435027 14:74592941-74592963 CAGGGGGGTGTGGAAAAGAAAGG - Intronic
1119532742 14:75374296-75374318 AGTGGGAGTGGGGAGGAGGAAGG + Intergenic
1119564526 14:75617072-75617094 CAGTGGATGGTGGAAGAGGATGG + Intronic
1119771450 14:77222595-77222617 TAGGGGAGTTGGGAGGAGTAAGG - Intronic
1119818334 14:77591320-77591342 GTGGGGAGGGTGGATGAGGAAGG + Intronic
1120057296 14:79939442-79939464 CAGGGCAGGGTGGAGAAGGGTGG - Intergenic
1120167970 14:81220675-81220697 GAGCGGAGAGAGGAGGAGGAGGG + Exonic
1120346224 14:83294013-83294035 AAGGGGAGGGGAGAGGAGGAAGG - Intergenic
1121016045 14:90549645-90549667 CAGTGGAGTGTGGAGGTTGGGGG + Intronic
1121018811 14:90566479-90566501 CAAGGGCTTGTGAAGGAGGAGGG - Intronic
1121316483 14:92964104-92964126 CGGGGGAATGAGGATGAGGAGGG - Intronic
1121611342 14:95282939-95282961 CAGAGGACTGGGGAGGGGGAGGG + Intronic
1121622982 14:95363065-95363087 CAGGGAAGGTTGGATGAGGACGG - Intergenic
1121777260 14:96598892-96598914 CAGGGGAAAGTGGAGCAGCAGGG - Intergenic
1121828150 14:97027560-97027582 CAGGGGAGTGTGTGGGATGGGGG + Intergenic
1122036098 14:98950407-98950429 AAGGGGAGGGGAGAGGAGGAAGG + Intergenic
1122258839 14:100500397-100500419 CTGTGGAGGGTGGAGAAGGAGGG + Intronic
1122270194 14:100565529-100565551 CTGGGGGGTGTGGGAGAGGAGGG + Intronic
1122280396 14:100618790-100618812 CAGGGGAGGGTGGTGGGGGTTGG + Intergenic
1122323099 14:100867194-100867216 CTGGGGACTGTGCAGGAGCAGGG - Intergenic
1122359635 14:101151689-101151711 GAGGGAGGTGGGGAGGAGGAGGG - Intergenic
1122415105 14:101545624-101545646 AAGAGGAGGGTGGAGGAAGAGGG + Intergenic
1122755256 14:103973562-103973584 CCGGGGAGGGTGGATGAGGGAGG + Intronic
1122879453 14:104683495-104683517 GAGGGGAGAGTGAAGGAGAAGGG + Intergenic
1122982750 14:105198988-105199010 CAGGCCAGTGAGGTGGAGGAGGG - Intergenic
1122985530 14:105209910-105209932 GAGGGGGGTCTGGAGGAGGCAGG + Exonic
1123794969 15:23762212-23762234 AGGGGGAGTGTGTAGGAGGGAGG + Intergenic
1124600029 15:31126453-31126475 AAGAGGAGTGGGGAGGAGAAGGG - Intronic
1124866126 15:33493123-33493145 GAGGGGAGAGGGGAGAAGGAAGG - Intronic
1125178695 15:36856707-36856729 GAGGGGAGAGGGGAGGGGGAGGG - Intergenic
1125202390 15:37111398-37111420 GAGGGGGGAGTGGAGGAAGAAGG - Intergenic
1125254195 15:37744687-37744709 CTGAGCAGTGCGGAGGAGGATGG - Intergenic
1125281355 15:38045223-38045245 CAGAGCAGGGTGGAGAAGGATGG - Intergenic
1125483353 15:40095437-40095459 CAAGAGGGTGTGGAGGAGAAGGG + Intronic
1125514317 15:40309228-40309250 CAGGGCAGGGTGGAGGGTGAGGG + Intergenic
1125601941 15:40920163-40920185 CAGGGTAGTCTGGAGCAGGGAGG - Intergenic
1126210451 15:46095233-46095255 AAGGGAAGTGTTGAAGAGGAAGG + Intergenic
1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG + Exonic
1127123342 15:55789715-55789737 AACGGGAGTGGGGAGGGGGAGGG - Intergenic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1127833298 15:62769659-62769681 CAGGAGAGGGTGGAGGATGATGG - Intronic
1127982446 15:64045203-64045225 CAGGGGTGTGTGGATGTGGCTGG - Intronic
1128058466 15:64718309-64718331 GTGGGGAGTGTGGGTGAGGAAGG + Intergenic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128145669 15:65331235-65331257 CAGGGGAGTGTGAAGGACTGGGG + Intronic
1128384183 15:67135326-67135348 CAGGGGACTGTGAAGGGGGCAGG - Intronic
1128541551 15:68538236-68538258 CTGGTGTGTGTGGAGGAAGAGGG + Intergenic
1128545109 15:68561374-68561396 CAGGGGAGAGTCGGGGAGGGAGG - Intergenic
1128562164 15:68676031-68676053 CAGGGGTGTGGGCAGGTGGAGGG + Intronic
1128658360 15:69479072-69479094 GAGGTCAGTGGGGAGGAGGAGGG + Intergenic
1128727762 15:70000464-70000486 GAGGGGAGGATGGAAGAGGAGGG - Intergenic
1128740978 15:70083532-70083554 GAGGGGAGGGAGGAGGGGGAAGG - Intronic
1128783360 15:70377421-70377443 GAGGGGAGGTTGGAGGAGGAAGG - Intergenic
1129165434 15:73774591-73774613 CAGGGGTGAGAGGAGGTGGACGG - Intergenic
1129331847 15:74831907-74831929 CAGGGGCCTGGGCAGGAGGAAGG + Intergenic
1129383122 15:75180409-75180431 CAGTGGAGAGTGGAAGAGGAGGG + Intergenic
1129524747 15:76206614-76206636 AAGGTGAGCCTGGAGGAGGAGGG - Intronic
1129589576 15:76903736-76903758 CAAGGGAGTGTGGAGAAAGAAGG + Intronic
1129680752 15:77657231-77657253 CAGGGGAGGGAGGAGGAGCCAGG - Intronic
1130084146 15:80763245-80763267 CAGGGGAGGGTGGTGGGGAAGGG - Intergenic
1130109650 15:80953982-80954004 CTGGGGATTGGGGATGAGGAAGG - Intronic
1130360654 15:83181833-83181855 AGGAGGATTGTGGAGGAGGAGGG - Intronic
1130545802 15:84857157-84857179 GAGGGGAGTGTGGAGCAGGTGGG + Exonic
1130630073 15:85558940-85558962 AAAGGGAGGGAGGAGGAGGAGGG - Intronic
1130959923 15:88652611-88652633 GAGGGGACAGGGGAGGAGGAAGG - Intronic
1131007652 15:88991474-88991496 CAGGGGTGTGGGGGGGAGAATGG - Intergenic
1131132922 15:89911786-89911808 CAGGGGATAGTGGATGGGGATGG - Intronic
1131150858 15:90046473-90046495 TAGAGGAGGGTGGAGGAGGGCGG + Intronic
1131229039 15:90647060-90647082 AGGAGGATTGTGGAGGAGGAGGG - Intergenic
1131229081 15:90647208-90647230 AGGAGGATTGTGGAGGAGGAGGG - Intergenic
1131229106 15:90647289-90647311 AGGAGGATTGTGGAGGAGGAGGG - Intergenic
1131229115 15:90647318-90647340 AGGAGGATTGTGGAGGAGGAGGG - Intergenic
1131229132 15:90647373-90647395 AGGAGGATTGTGGAGGAGGAGGG - Intergenic
1131229154 15:90647434-90647456 AGGAGGGGTGTGGAGGAGGAGGG - Intergenic
1131229169 15:90647477-90647499 AGGAGGGGTGTGGAGGAGGAGGG - Intergenic
1131229181 15:90647512-90647534 GAGGGGGGTGAGGCGGAGGAGGG - Intergenic
1131229241 15:90647676-90647698 AGGAGGGGTGTGGAGGAGGAGGG - Intergenic
1131382479 15:91975319-91975341 CAAGGGGGTGGGGTGGAGGATGG - Intronic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1131751027 15:95508510-95508532 GAGAGGAGAGGGGAGGAGGAGGG - Intergenic
1131785409 15:95906591-95906613 AAGGGGAGGGTGAGGGAGGAGGG + Intergenic
1132028069 15:98419644-98419666 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
1132405474 15:101539668-101539690 CATGGAAGTGTTGAGAAGGACGG + Intergenic
1132567710 16:630928-630950 CAGGGCAGAGGGGAGGAGGTTGG - Exonic
1132599555 16:767705-767727 TGGGGGGGCGTGGAGGAGGAGGG + Intronic
1132599624 16:767866-767888 GAGGGGCGCGTGGAGGAGGAGGG + Intronic
1132599674 16:767987-768009 GGGGGGCGCGTGGAGGAGGAGGG + Intronic
1132610630 16:814208-814230 CAGGAGAGTGGGAAGGAGGCCGG + Intergenic
1132654193 16:1035065-1035087 CTGGGGTGTGTGGAGGTGGCTGG + Intergenic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132847441 16:2007007-2007029 CTGGGGAGTGTAGAGCAGCAAGG - Intronic
1132989829 16:2786941-2786963 GAGGGGAGTGAGGAGGAGGGGGG - Intronic
1132989868 16:2787065-2787087 GAGGGGAGTGAGGAGGAGCAGGG - Intronic
1132989972 16:2787387-2787409 GAGGGGAGTGAGGAGGAAGGGGG - Intronic
1133059698 16:3166453-3166475 CGGGGGATTGTGGAGCAGGTGGG - Intergenic
1133103747 16:3494134-3494156 CAGGGGAGGGAGGAGGTTGAGGG + Intronic
1133305235 16:4804245-4804267 CAGGGCAGGGTGGAGAAGGTGGG + Exonic
1133392625 16:5422328-5422350 GAGGAGAACGTGGAGGAGGAGGG + Intergenic
1133520183 16:6549264-6549286 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133520202 16:6549315-6549337 GAGGGGAGGAGGGAGGAGGAGGG + Intronic
1133520231 16:6549388-6549410 CGAGGGAGGGAGGAGGAGGAGGG + Intronic
1133520278 16:6549518-6549540 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133720353 16:8488941-8488963 TTGGGGTGGGTGGAGGAGGAAGG + Intergenic
1134066606 16:11232481-11232503 AGGGGGAGGGGGGAGGAGGAGGG + Intergenic
1134248082 16:12554905-12554927 CAGGGGAGAGGGGCTGAGGAGGG + Intronic
1134442239 16:14305802-14305824 GAGGGGGGTGTGTAGGAGGGTGG - Intergenic
1134449215 16:14353725-14353747 CAGGGGAAGGTGGGGGAGGCAGG + Intergenic
1134849876 16:17470918-17470940 CAGGGGTGTGGGGAGGGGGGCGG - Intergenic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1135326088 16:21526632-21526654 CAGGAGAGGGTGGGGGCGGAGGG + Intergenic
1135472523 16:22744059-22744081 GAGGAGAGTGTGCAAGAGGAGGG - Intergenic
1135538811 16:23314601-23314623 GAGGTGAGTGTGGAGGAGGAGGG + Intronic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1135992883 16:27228538-27228560 GAGGGGAGGGTGGAAGAGGGTGG - Intronic
1135992901 16:27228594-27228616 GAGGGGAGGGTGGAAGAGGGTGG - Intronic
1135992921 16:27228650-27228672 GAGGGGAGGGTGGAAGAGGGTGG - Intronic
1135992939 16:27228706-27228728 GAGGGGAGGGTGGAAGAGGGTGG - Intronic
1135992994 16:27228874-27228896 TAGGGGAGGGTGGAAGAGGGCGG - Intronic
1135993013 16:27228930-27228952 CAGGGGAGGGTGGAAGAGGGTGG - Intronic
1136188618 16:28602270-28602292 TAGGGGAGTGTGGAGGACAGGGG - Intergenic
1136191088 16:28615264-28615286 TAGGGGAGTGTGGAGGACAGGGG - Intronic
1136248037 16:28986256-28986278 GAGTGGAGTTTGGAGGGGGAGGG - Intronic
1136299606 16:29324998-29325020 GAGGGGAGAGGGGAGGAGGGAGG - Intergenic
1136334516 16:29602663-29602685 CACGGTATTGTGGAGGTGGAAGG + Intergenic
1136397998 16:30003459-30003481 CAGGGGAGTGAGGAGATGGAAGG + Intronic
1136688095 16:32007824-32007846 CCGGGGAGTGTGGAGAAGCCAGG - Intergenic
1136788698 16:32951379-32951401 CCGGGGAGTGTGGAGAAGCCAGG - Intergenic
1136881114 16:33902555-33902577 CCGGGGAGTGTGGAGAAGCCAGG + Intergenic
1137374567 16:47941623-47941645 AGGGGGAGTGAGGAGGAGGGTGG + Intergenic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137577244 16:49608307-49608329 GAGGGGAGGGGGAAGGAGGAGGG + Intronic
1137887832 16:52125968-52125990 CAGCAGAGTCTGGAGGAAGAAGG + Intergenic
1137902105 16:52279883-52279905 CAGTGTAGTGGGGAGGAGCAGGG + Intergenic
1138553279 16:57758606-57758628 GGCGGGAGTGTGGAGGAGGGTGG - Exonic
1139301116 16:65946187-65946209 CAGGTGAGGGATGAGGAGGAAGG - Intergenic
1139355530 16:66365221-66365243 CAGGAGAGGGCAGAGGAGGAGGG - Intergenic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1140068313 16:71627766-71627788 TAGGGGAGGGTGGGGGGGGAAGG + Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140804677 16:78522104-78522126 CAAGGGAATATGGAGGAGAAGGG + Intronic
1141244868 16:82296487-82296509 CAGGGGAAAGTGTGGGAGGAGGG - Intergenic
1141365394 16:83437962-83437984 CATGGGAGTGGCCAGGAGGATGG - Intronic
1141543252 16:84743387-84743409 CAAGTGAGTGTGCAGGAGGCTGG - Intronic
1141608862 16:85170212-85170234 CAGGGGCGCGCGGAGGAGGAGGG + Intergenic
1141897294 16:86966230-86966252 CAGTGGAAGCTGGAGGAGGAAGG - Intergenic
1141904081 16:87011470-87011492 GGGTGGAGTGTGGAGGAGGGAGG + Intergenic
1141980891 16:87549718-87549740 AAGGGGAGTGAGGAGCAGGAAGG - Intergenic
1141981332 16:87552121-87552143 CACAGGAGAGTGGAGGAGGCAGG + Intergenic
1142029258 16:87830437-87830459 CAGTGGAGTGTGGAGAAAAAGGG + Exonic
1142032313 16:87844658-87844680 CATGGGAATGTGGAGATGGAGGG + Intronic
1142035226 16:87858499-87858521 CACGGTATTGTGGAGGTGGAAGG + Intronic
1142044011 16:87913699-87913721 CAGTGTGGGGTGGAGGAGGAGGG - Intronic
1142163977 16:88575466-88575488 CAAGTGAGTGTGGAGCAGCAGGG - Intronic
1142264292 16:89056706-89056728 CATGGCCGTGTGGAGGAGCAGGG - Intergenic
1142353137 16:89588871-89588893 CAGGGGGGTGAGGGGGAAGACGG - Intronic
1203090895 16_KI270728v1_random:1212868-1212890 CCGGGGAGTGTGGAGAAGCCAGG - Intergenic
1142471896 17:169341-169363 CAGGGGCCAGGGGAGGAGGAAGG + Intronic
1142478625 17:204592-204614 CAGGTGAGTGAGGAGATGGATGG - Intergenic
1142506333 17:365599-365621 CTGGGGACTGTGGAGAAGGGAGG - Intronic
1142514285 17:416888-416910 CAGGAGAGAGTGGAGCAGGAAGG + Intronic
1142539545 17:647523-647545 CAGCGGATGGGGGAGGAGGAAGG - Intronic
1142572146 17:881969-881991 CAGGGGACTGTGCAGGGAGATGG + Intronic
1142581988 17:948880-948902 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142581996 17:948899-948921 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582004 17:948918-948940 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582012 17:948937-948959 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142705821 17:1693573-1693595 AAAGGGAGTGAGTAGGAGGAGGG + Intergenic
1142943089 17:3399513-3399535 CATGAGAGAGTGGAGGAGGATGG - Intergenic
1142986483 17:3698138-3698160 CAGGGGGCTGAGGAGGAGGCTGG - Intergenic
1143095266 17:4475476-4475498 GAGGGGAGTGAGGGTGAGGAAGG + Intronic
1143115890 17:4581771-4581793 CACGTAAGTGAGGAGGAGGAGGG + Intergenic
1143153888 17:4823518-4823540 GAGAGGAGAGTGGAGGAGGGTGG - Intergenic
1143510621 17:7393581-7393603 CAGGTGAGTGGGAAGGAGGGAGG - Exonic
1143561802 17:7700908-7700930 CAGGGGTCTTTGGAGGAGGAAGG + Intronic
1143947442 17:10605527-10605549 CAGGAGGGTGGGGAGGAGTAAGG + Intergenic
1143985833 17:10913145-10913167 GACGGAAGTGTGGAGGTGGAGGG + Intergenic
1144167979 17:12631252-12631274 CATGGGAGAGTGGAGGAGTGGGG + Intergenic
1144467111 17:15505682-15505704 CAGGGAGGTGTGGAGGGAGAGGG + Intronic
1144952247 17:19000597-19000619 AAGGTGAGTGAGGAGGCGGAAGG + Intronic
1144955648 17:19017648-19017670 CAGGGGAGAGTGGGGCAGGGGGG - Intronic
1145753111 17:27369229-27369251 GAAGGGAGTGGGGAGGAGGCAGG - Intergenic
1146034130 17:29390926-29390948 GTGAGGAGTGAGGAGGAGGAGGG - Exonic
1146055065 17:29576831-29576853 CAGGGGAGTGGGAAGGAGGGTGG + Intronic
1146178175 17:30679778-30679800 CAGAGGAGTGGGGAGGACGGAGG + Intergenic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146648363 17:34590438-34590460 CAGAGCATTGTGGAGGAAGAGGG + Intronic
1147149083 17:38503507-38503529 CCGGGGAGTGTGGAGAAGCCAGG - Intronic
1147186094 17:38713765-38713787 CTGGGGCGAGTGGAGGAGGATGG - Intronic
1147308374 17:39579070-39579092 CAGATGGGTGAGGAGGAGGAAGG - Intergenic
1147320340 17:39642221-39642243 CAGAGGAGGGTTAAGGAGGAGGG - Intronic
1147441935 17:40452804-40452826 CAGGGGAGAGGGGAGGAGGTAGG + Intronic
1147498826 17:40942615-40942637 AAGAGGAGGGGGGAGGAGGAAGG - Intergenic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1147847552 17:43415457-43415479 CAGTGGAGAGTGTAGGAGGCAGG + Intergenic
1147947293 17:44087254-44087276 AAGGGGAGTGGGAAGGAGGCCGG - Intronic
1147962367 17:44175856-44175878 TAGGGGAAAGTGGAGGAGGATGG + Intronic
1147966342 17:44196237-44196259 CGGGGGAGTGTGGGTGGGGAAGG - Intronic
1148021474 17:44556753-44556775 TAAGGGTGTGTGGAGGGGGAGGG + Intergenic
1148343788 17:46890122-46890144 AAGAGGAGCGAGGAGGAGGAGGG - Intergenic
1148495395 17:48050625-48050647 CTGGTAAGTGTGGAGGAGGCGGG + Exonic
1148619335 17:49022601-49022623 CAGGAGAGGGAGGGGGAGGAGGG - Intronic
1148741319 17:49894734-49894756 TAGGTCAGTGGGGAGGAGGAAGG + Intergenic
1148747968 17:49928971-49928993 GAGGACAGTGTGGAGGGGGAAGG - Intergenic
1148758265 17:49985966-49985988 AAGGGGAGAATGGAGGGGGAAGG - Intergenic
1148863755 17:50618138-50618160 TAGGGGAGGGTGGAGGAGCCAGG + Intronic
1149431414 17:56597442-56597464 GTGGGGAGTGGGGAAGAGGAGGG + Intergenic
1149512700 17:57256459-57256481 GATGGGGGTGGGGAGGAGGAGGG + Intronic
1149560467 17:57604703-57604725 CAGGGGATTCTGGGGAAGGAAGG + Intronic
1149614696 17:57988127-57988149 GGGGGGAGTGGGGAGGAGGGGGG - Exonic
1149982645 17:61323596-61323618 CTCGGGAGTGTGGAGGGGGTTGG + Intronic
1149992460 17:61390585-61390607 GAGTGGAGTGGGGAGGAGGCGGG - Intronic
1150092648 17:62342221-62342243 GTGGGGAGTGTGGTGGGGGAGGG + Intergenic
1150733590 17:67716628-67716650 CGTGGGTGTGTGGGGGAGGAAGG - Intergenic
1151224738 17:72640061-72640083 CTGGGGTGTGTGGAAGATGAAGG + Intergenic
1151376591 17:73693208-73693230 CAGGAGAGAGGAGAGGAGGAGGG - Intergenic
1151389313 17:73775073-73775095 TGGGGAAGTGAGGAGGAGGAAGG + Intergenic
1151430716 17:74060655-74060677 CATGTGATTGTGGGGGAGGAAGG - Intergenic
1151436757 17:74102498-74102520 GAGGAGTGTGTGGAGGAGGAAGG - Intergenic
1151518459 17:74612441-74612463 CAGGGGACTGGGGAGGAGAAAGG + Exonic
1151554542 17:74840053-74840075 CAGGTGTGTGTGGGGGAGGAGGG - Intergenic
1151808280 17:76420328-76420350 CAGGGGGCTATGGAGGAGCAGGG + Intronic
1151850040 17:76684778-76684800 CAGTGGGGTGTGGAGGGGGTGGG + Intronic
1152031204 17:77844581-77844603 CAGGGGCTGGAGGAGGAGGAAGG + Intergenic
1152032354 17:77851779-77851801 CAGGACAGTGGGCAGGAGGATGG - Intergenic
1152400838 17:80065238-80065260 CTTGGGAATGAGGAGGAGGAGGG - Intronic
1152477667 17:80528638-80528660 CTCGGGAGTGTGGAGGTGGAGGG + Intergenic
1152482256 17:80562370-80562392 CAGGGGAGTGAGGGGAAGCAGGG - Intronic
1152573581 17:81130780-81130802 CAGGGGAGGCTGGAGGCCGAGGG + Intronic
1152577992 17:81151322-81151344 CTGGGGGATGTGGGGGAGGAGGG - Intronic
1152640763 17:81448289-81448311 CAGGGGAGGGGGCAGGAGGCTGG + Intronic
1152697002 17:81802619-81802641 CAGGGGAGTGAGGACCAGGTGGG + Intergenic
1152707737 17:81853755-81853777 CTGGGGAGTGAGGGGCAGGAGGG - Intronic
1152720221 17:81919965-81919987 GAAGGGAGTGTGGAAGAGGAGGG - Exonic
1152912195 17:83011185-83011207 CCGGGGCGAGAGGAGGAGGAAGG + Intronic
1152936704 17:83142422-83142444 GAGGAGAATGTGGATGAGGAAGG + Intergenic
1152956500 18:45874-45896 TGGGGGAGTGTGGGGGAGTATGG + Intergenic
1153184765 18:2473717-2473739 AAAGGGAGAGGGGAGGAGGAAGG + Intergenic
1153290152 18:3493034-3493056 CAGGAGCATGTTGAGGAGGAGGG + Intergenic
1153512260 18:5868871-5868893 CAGGGGTGGGTGGAGGAGGCAGG - Intergenic
1153795261 18:8616141-8616163 CAGGGGAAGGTCGAGCAGGATGG - Intronic
1153806298 18:8711043-8711065 CTGGGGACTGTCGAGGAGTAGGG - Intronic
1154000404 18:10477728-10477750 CAGGGGAGAAAGGAAGAGGATGG + Intronic
1154200155 18:12293984-12294006 CTGGGGTGGGTGGAGGATGAAGG + Intergenic
1154460280 18:14576634-14576656 CTGGGGACTGTGGTGGGGGAGGG + Intergenic
1155183283 18:23366647-23366669 CTAGGCAGTGTGGAGGAAGACGG + Intronic
1155229306 18:23757447-23757469 GAGGGGACTGGGGAGGAGGAGGG - Intronic
1155342814 18:24830174-24830196 CAGGTTGGGGTGGAGGAGGAGGG - Intergenic
1155362531 18:25016679-25016701 CAGGGGAAGGTGGTGGAGAAGGG + Intergenic
1155572424 18:27210521-27210543 CAGGGGAGATTGGAGCAGGCAGG - Intergenic
1155996149 18:32333235-32333257 AAGGGGAGTGGAGAGGGGGAGGG + Intronic
1156470960 18:37376986-37377008 CAGGGGAGGGTGGAGGGGAGAGG + Intronic
1156497527 18:37535964-37535986 CAGGGGCGTGGGGAGGGAGATGG - Intronic
1157112347 18:44833015-44833037 CTGGGGACAGTGGAGGTGGATGG + Intronic
1157126458 18:44960815-44960837 GGGTGGAGGGTGGAGGAGGAAGG - Intronic
1157187077 18:45549692-45549714 CAAGGGAGTCTGCAAGAGGAAGG + Intronic
1157327911 18:46682116-46682138 CTGGGGAGGGTGCAGGGGGAGGG + Intronic
1157472925 18:48003494-48003516 CAGAGGGGTGTGGAAGAGTAGGG + Intergenic
1157551227 18:48583053-48583075 GAGGGGAGGGAGGAGGATGATGG + Intronic
1157957765 18:52117789-52117811 CAGGGGAGTGTGCAGCAAGCAGG + Intergenic
1158015689 18:52780763-52780785 CAGGGGAGAAGGGAGGAGGAAGG + Intronic
1158156439 18:54430721-54430743 GAGGTGAGGGTGGAGGAGAAGGG + Intergenic
1158516900 18:58138334-58138356 GAGGGGAGGGAAGAGGAGGAGGG - Intronic
1158516907 18:58138352-58138374 GAGGGGAGGGAAGAGGAGGAGGG - Intronic
1158543081 18:58374467-58374489 CAGTGGGGTGGGGAGGAGGCCGG - Intronic
1158976925 18:62717196-62717218 CTGTGGAGGGTGCAGGAGGAAGG + Exonic
1159040466 18:63319595-63319617 CAGGGGAGAGGGGACGATGAAGG + Exonic
1159468839 18:68822978-68823000 CAGGGGAGTGTGGGGGCGGGAGG - Intronic
1159875993 18:73811820-73811842 ACAGGGAGTGTGGAGGATGAGGG + Intergenic
1160029490 18:75246333-75246355 CAGGGCAGTGGGGATGACGATGG + Intronic
1160208672 18:76858725-76858747 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208699 18:76858813-76858835 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208769 18:76859033-76859055 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160248221 18:77178047-77178069 GAGGGGAGGGGGAAGGAGGAGGG - Intergenic
1160254216 18:77233835-77233857 GAGGAGGGTGAGGAGGAGGAGGG - Intergenic
1160254221 18:77233850-77233872 GAGGAGGGTGAGGAGGAGGAGGG - Intergenic
1160353133 18:78201975-78201997 TGAGGGAGTGGGGAGGAGGAGGG - Intergenic
1160448626 18:78946975-78946997 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1160505092 18:79422572-79422594 CAGGGGAGTGAGGGAGAGGGAGG + Intronic
1160623526 18:80187609-80187631 CAGGGGAGCCAGGAGGTGGATGG - Intronic
1160659530 19:291579-291601 GAGGGGAGGGGGGAGGGGGAGGG + Intergenic
1160705125 19:525947-525969 CAGAGGGGAGGGGAGGAGGAGGG + Intergenic
1160975346 19:1790101-1790123 GAGGGAAGTGGGGAGGAGAAGGG - Intronic
1161058288 19:2201341-2201363 GAGGGGAGCGGGGAGGACGACGG - Intronic
1161346517 19:3771145-3771167 GAGGGGAGTGAGGAGTTGGAGGG - Intronic
1161377215 19:3946160-3946182 CAGGCGAGTGTGAAGATGGAAGG - Intergenic
1161523363 19:4738382-4738404 GAGGGGAGTGGAGAGGGGGATGG + Intergenic
1161614699 19:5263545-5263567 GAGGGGTGTGTGGAGGTGCAGGG + Intronic
1161756427 19:6137453-6137475 CAGCAGAGTGAGGAGGGGGAGGG + Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162080463 19:8214885-8214907 AAGGGCAGTGGGGAGGAGGTGGG + Intronic
1162085077 19:8243804-8243826 CGTGGGCGTGTGGAGGAGGCAGG - Intronic
1162094519 19:8302624-8302646 CAGAGGAGTAAGGAGGGGGAAGG + Intronic
1162098454 19:8324831-8324853 CTGGGGAGTGGGGAGGAAGAGGG + Intronic
1162126599 19:8502691-8502713 CGGGGGAGGGCAGAGGAGGAAGG + Exonic
1162151873 19:8651869-8651891 AAGGGTAGTGAGGAGGAAGAGGG - Intergenic
1162180891 19:8867927-8867949 CAGGTGAATGGGCAGGAGGATGG + Intronic
1162237736 19:9321784-9321806 GAGGGGGGTGGGGAGGAGGGTGG - Intergenic
1162850817 19:13429965-13429987 GTGGGGAGTGTGGAGTAGGGTGG + Intronic
1162967431 19:14162538-14162560 CAGGGGTGGGTGGGGGTGGAGGG + Intronic
1163234484 19:16022824-16022846 CTGGGGAGTATGGGGCAGGAGGG - Intergenic
1163295206 19:16407285-16407307 CTGGGGAGTGGGGAGAAGAAAGG - Intronic
1163476145 19:17527176-17527198 CAGGGGAGTGGGGAGGACGCAGG + Intronic
1163479157 19:17544463-17544485 CAGTGGAGGGAGGAGGTGGATGG + Intronic
1163611552 19:18304451-18304473 GAGGGGAATGGGGAGGAAGATGG + Intergenic
1163630776 19:18417081-18417103 CGGGGGAGGGCGGAGGCGGAGGG - Intergenic
1163648874 19:18505679-18505701 CAGGGGAGGGGAGAAGAGGACGG + Intronic
1163678984 19:18669782-18669804 TTGGGGTGGGTGGAGGAGGAGGG + Exonic
1163767614 19:19172159-19172181 TTGGGGAGTGTGGAGGTGGCTGG + Intronic
1164061391 19:21678310-21678332 CAGGGGAGTGAGGAGGGGCTGGG + Intergenic
1164064780 19:21706470-21706492 CAGGGGAGTGAGGATGAGCTGGG + Intergenic
1164150702 19:22548000-22548022 CAGGTGGGTGGGGATGAGGAGGG - Intergenic
1164671503 19:30074678-30074700 CAGGAGAGACTGGAGGAGGAAGG - Intergenic
1164712559 19:30367880-30367902 CATGGGAAGGTGCAGGAGGAAGG - Intronic
1164853239 19:31501629-31501651 CAGATGAGTGTGGAGCAGGCTGG + Intergenic
1165067469 19:33237406-33237428 CAGGGGCAGGTGGAGGACGAGGG - Intergenic
1165098238 19:33422064-33422086 CAGGGGAGTAAGGGGGAGGTGGG - Intronic
1165113610 19:33515762-33515784 GAGGGGAGTGTGGGAGAGGTGGG - Intronic
1165257725 19:34589725-34589747 CAGGGCAGTGTGGATGATGGAGG + Intergenic
1165490694 19:36121226-36121248 CGGAGGAGGGCGGAGGAGGAAGG + Intronic
1165895710 19:39139689-39139711 TTGGGGAGTGGGCAGGAGGATGG - Intronic
1165940260 19:39411426-39411448 CAGGGGAGTGTTCAGGCAGAGGG - Intergenic
1165947314 19:39451988-39452010 CAGGAGAGTAGGGAGGAGGCTGG + Intronic
1165987982 19:39787306-39787328 TGGGGGAGTGTGGTGGAGGAAGG - Intergenic
1166230849 19:41425268-41425290 CAGGGGAGCGTCCAGGATGAAGG + Intronic
1166294736 19:41883334-41883356 GGGGGAAGTGGGGAGGAGGAGGG + Intronic
1166552482 19:43675597-43675619 CAGGTGAGTCACGAGGAGGAAGG - Intergenic
1166679689 19:44759028-44759050 CTGGGGGGTCTGAAGGAGGAGGG - Intronic
1166735569 19:45082210-45082232 AAGGCCAGTGTGGAGGAGGTGGG - Intronic
1166864429 19:45827413-45827435 CAAGGGAGTGTGGAAGACGTGGG + Intronic
1166988650 19:46677746-46677768 GATGGGAGTGGGGAGGAGAAGGG - Intronic
1166992456 19:46700820-46700842 CACGCCAGTGAGGAGGAGGAAGG - Exonic
1167044299 19:47040859-47040881 CAGGGGAGTGGGCAGGGAGACGG - Intronic
1167071346 19:47223768-47223790 CTAGGGAGTGTTGAGGAGGCTGG - Intronic
1167074412 19:47240003-47240025 CAGGGGAGCAGGGAGGTGGATGG - Intergenic
1167105435 19:47427647-47427669 GAGGGGAGAGGGGAGTAGGAGGG - Intergenic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167245884 19:48373057-48373079 AAGGAGAGTGTGGGGGAGGCAGG + Intronic
1167410351 19:49340427-49340449 CAGGGGAATGTGAAGGCGGAGGG - Exonic
1167420064 19:49397548-49397570 CAGGTGAGGGTGGAGGCAGATGG + Intronic
1167461363 19:49626142-49626164 CAGGGGCTTGGGGAGGTGGAGGG + Exonic
1167480434 19:49727405-49727427 CAGGGGAGGGTGTGGGAAGAAGG - Intergenic
1167579247 19:50332247-50332269 GGGGGGAGTGTGGAGGAGGATGG - Intronic
1167610567 19:50506044-50506066 CAGGGGTGTGGGGAGGGGGCGGG + Exonic
1167628400 19:50607525-50607547 CAGGGGACTGAGAAAGAGGATGG - Intergenic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1167674501 19:50875969-50875991 CTGAGGAGTGTGGAGTAGCAGGG - Intronic
1167686513 19:50960052-50960074 GAGAGGAGGGGGGAGGAGGAGGG + Intronic
1168189347 19:54726557-54726579 CAGGGGACTGAAGAGGAAGATGG + Intronic
924980013 2:210890-210912 AAGGGGAAGGTGGAGCAGGAGGG - Intergenic
925007590 2:456239-456261 GGAGGGAGTGTGGAGTAGGAGGG + Intergenic
925057489 2:866472-866494 CAGGGGACTGTGGAGGATGCAGG - Intergenic
925339722 2:3127769-3127791 CAGTGGAGGGTGGAGGACGGAGG + Intergenic
925377539 2:3398961-3398983 CAGGGGAGGTGGGAGGGGGAGGG - Intronic
925447998 2:3944170-3944192 CAGGGACGAGGGGAGGAGGAAGG - Intergenic
925454413 2:4003014-4003036 CGGAGTGGTGTGGAGGAGGATGG - Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
926062519 2:9813301-9813323 GGGGGGAGCGTGGGGGAGGAGGG + Intergenic
926105444 2:10146721-10146743 AAGGGTAGGGAGGAGGAGGAGGG + Intronic
926292774 2:11543899-11543921 CCGGGGAGTGGGGAGGAGTTGGG + Intronic
926360171 2:12079485-12079507 CAGGGGAGAGTGGAGCTAGATGG - Intergenic
926584566 2:14672059-14672081 CAAGAGAGAGTGGAGGAGAAGGG + Intergenic
926591669 2:14746168-14746190 GTGGCGTGTGTGGAGGAGGAGGG - Intergenic
926683551 2:15681094-15681116 GAGGGGAGGGGGGAGGGGGAGGG + Intergenic
926760560 2:16275248-16275270 CAGGGGAATTTTGTGGAGGACGG - Intergenic
927003527 2:18824424-18824446 CAGGCGAGTGGGGAGGGGGGAGG + Intergenic
927053695 2:19351808-19351830 CAGGGGCGGGAGGAGGAGGTGGG + Exonic
927215659 2:20666821-20666843 CGGGGGAGTGGGGAGGAAGCTGG + Exonic
927272699 2:21230151-21230173 CAGGGGAGTGTGATGGTGAAAGG - Intergenic
927641388 2:24847848-24847870 CTGAGGAGTCTGGAGGAGGCAGG + Intronic
927705637 2:25294879-25294901 AATGGGAGGGAGGAGGAGGAGGG - Intronic
927764929 2:25798170-25798192 GAGGGTGGTGTGGGGGAGGAGGG + Intronic
927900118 2:26812948-26812970 CAGGGGAGAGTGGAGGAGTGAGG - Intergenic
927916302 2:26938839-26938861 CAGGGGAGTCAGGTGGGGGAGGG - Intronic
928101427 2:28439781-28439803 CAGAGGAGTGTGGAGGGTGGTGG - Intergenic
928103916 2:28455350-28455372 AAGGGGGGTATGGAGTAGGAAGG - Intergenic
928129468 2:28639200-28639222 AAGGAGAGTGTGGAGGTAGATGG + Intronic
928269298 2:29841993-29842015 AAGAGGAGTGAAGAGGAGGATGG - Intronic
928285578 2:29987406-29987428 CTGGGGAGAGGAGAGGAGGAAGG - Intergenic
928363571 2:30684947-30684969 CTGGGGAGTGGGGAGGGGGAAGG + Intergenic
928912142 2:36432704-36432726 CCTGGGAGTGTAGAGGATGAAGG + Intronic
929144245 2:38692827-38692849 CCAGGGAGTGAGGAGGAGAAAGG + Intronic
929175262 2:38969339-38969361 CAGAGGGCTGTGGGGGAGGAAGG - Intronic
929242237 2:39665554-39665576 AAGGGGAGAGAGGAGGATGAGGG + Intronic
929403722 2:41615477-41615499 CAGGCAGGTATGGAGGAGGATGG - Intergenic
929434098 2:41914125-41914147 TAGAGGTGAGTGGAGGAGGATGG - Intergenic
929444486 2:41991914-41991936 AAGGGGAGGGGAGAGGAGGAGGG + Intergenic
929526372 2:42706984-42707006 GAGGGAAGCGGGGAGGAGGAGGG - Intronic
929783770 2:44974540-44974562 GAGAAGGGTGTGGAGGAGGAAGG + Intergenic
930057837 2:47265526-47265548 GGGGGCAGTGTGGAGGAGGAGGG - Intergenic
930109738 2:47668261-47668283 AAGGTGGGTGTGGGGGAGGAGGG + Intergenic
930718785 2:54618788-54618810 AAGGGGAGTGTAGGGGTGGAAGG + Intronic
931348801 2:61470759-61470781 GAGGGGAGAGAGGCGGAGGAGGG + Exonic
931427694 2:62185930-62185952 CAGGATAGGGTGGAGGGGGAGGG - Intergenic
931566651 2:63622019-63622041 GAGGGGAGTGGGGAGGGGGGAGG - Intronic
931809307 2:65839031-65839053 GTGGGGAGAGTGGAGCAGGAAGG + Intergenic
931847378 2:66218563-66218585 TAGGGGGGTGAGGTGGAGGAAGG + Intergenic
932219446 2:69988830-69988852 CAGAAGAGTCTGGAGTAGGATGG + Intergenic
932628159 2:73315380-73315402 CCTGGGAGAGTGCAGGAGGATGG - Intergenic
932631092 2:73344122-73344144 CTGGGGAGTGAGGATGAGGTGGG + Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
932847158 2:75147564-75147586 CTGGGGCCTGTGGAGCAGGAGGG - Intronic
933350652 2:81148193-81148215 CAGGAGAGACTGGAGGAGGCAGG + Intergenic
933768879 2:85730297-85730319 CAGAGGGGAGTGGAGGTGGAAGG + Intergenic
934765619 2:96878553-96878575 GTGGGGAGTGTGCAGGTGGAGGG - Intronic
934853359 2:97714840-97714862 CAGGGCAGTGGGGCTGAGGATGG - Intronic
934948251 2:98557845-98557867 CAGGCGGGGGTGGAGGGGGATGG - Intronic
934966693 2:98730614-98730636 CCGGGGGGTGCGGAGGGGGAGGG - Intronic
934976350 2:98805555-98805577 CTCTGGAGGGTGGAGGAGGAGGG - Intronic
935122565 2:100195835-100195857 TAGGGGAGTTGGAAGGAGGAGGG + Intergenic
935217910 2:100988960-100988982 CAGGGGGGCCTGGAGGAGCAGGG - Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935308412 2:101759666-101759688 GAGGGGAATGGGGAGGGGGAGGG - Intronic
935333374 2:101993942-101993964 GAGGTGAGTGTGCAGGAGGTGGG - Intronic
935645172 2:105329059-105329081 CAGGGGTGTGTTGGGGAGTAGGG - Intronic
935727135 2:106033398-106033420 CAGGGGATTGGGGAAGAAGAGGG + Intergenic
936020050 2:108988041-108988063 CTGGGGACTGGGGAAGAGGACGG + Intronic
936067004 2:109339925-109339947 TGGGGGAGTGAGGAGGAGGCAGG + Intronic
936281558 2:111144884-111144906 CAGGGGTGTGAGGAGAAAGAAGG - Intronic
937049745 2:118878806-118878828 CAGGGAAGGGTGGAGCATGAGGG - Intergenic
937064228 2:119005229-119005251 CGGGGGAGTGAGCAGGTGGAGGG + Intergenic
937112717 2:119378784-119378806 CAAGAGAGTGAGGAGGAGGAGGG - Intergenic
937345212 2:121121156-121121178 CACGGGACTGTGGAAGGGGAGGG + Intergenic
937354952 2:121192470-121192492 GAGGGGAGTGGGGGAGAGGAAGG - Intergenic
937358676 2:121214065-121214087 CAGGGGAGGTCAGAGGAGGAGGG - Intergenic
937573354 2:123390973-123390995 AAGGAGAATGGGGAGGAGGAAGG - Intergenic
937854527 2:126662865-126662887 CAGGGCAGTGGGGAGGAAGCTGG - Intronic
938115727 2:128601984-128602006 CAAGGGAGTGTGGAGGGGACAGG + Intergenic
938308145 2:130268333-130268355 CAGGGAAGTGAAAAGGAGGAGGG - Intergenic
938321827 2:130371224-130371246 CTGGGGAGTCCGGAGGAAGAGGG - Exonic
938378122 2:130822027-130822049 CCGGGGAGTGTGCATGAGGAGGG + Intergenic
938447186 2:131388503-131388525 CAGGGAAGTGAAAAGGAGGAGGG + Intergenic
938536335 2:132252579-132252601 CAGAGGAGTGTTGGGGAGGAGGG + Intronic
938614530 2:132983698-132983720 CATGGGAGTCGGGAGGAGGGGGG + Intronic
939607658 2:144272519-144272541 GAGGGGAGTGTGGAGTGTGAGGG - Intronic
939898867 2:147826846-147826868 CAGGGATGTGTGGAGGGAGAGGG + Intergenic
939995362 2:148914841-148914863 CAGTGGAGTGGAGAGGAGAATGG + Intronic
940616872 2:156059782-156059804 GAAGGCAGTGGGGAGGAGGAAGG + Intergenic
940640610 2:156341914-156341936 CAGGCGAGTGGGGCGAAGGAGGG + Intronic
940812323 2:158259114-158259136 AAGGGGAGTGTGGGGCAGGGAGG - Intronic
941038184 2:160590498-160590520 GAGGGGAGGGGGGAGGGGGAGGG - Intergenic
941961483 2:171257852-171257874 AAGGGTAGTTTGGAGGAGTAGGG - Intergenic
942253694 2:174070480-174070502 CAGGGGACAGTGGAGCAGCATGG - Intergenic
942311599 2:174661792-174661814 CAGAGGAGTGAAGAGGAGCAAGG + Intronic
942425224 2:175853115-175853137 CAGCAGAGGGTGGAGGAGAAGGG - Intergenic
942450586 2:176106067-176106089 CAGAGGGGTGAGGAGGACGAAGG + Intronic
942810697 2:179996649-179996671 GAGTGGGGTGTGGAGGATGAAGG + Intronic
943343333 2:186707767-186707789 CAGGTGATTGGGGTGGAGGATGG - Intronic
943692083 2:190880174-190880196 CATGGGAGGGTGGAGGTGGAGGG - Intergenic
943795468 2:191987245-191987267 GAGGGAAATGAGGAGGAGGAAGG + Intronic
944376045 2:199043222-199043244 AGTGGGAGTGTGGAGGAGGGAGG - Intergenic
944414568 2:199469143-199469165 GAAGGGAGGGTGAAGGAGGAGGG + Intronic
944610257 2:201396798-201396820 CTGGGAAGTATGGAGTAGGATGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944818169 2:203401093-203401115 GAGGGGAGAGTAGAGGAGGGGGG - Intronic
945026111 2:205621358-205621380 TATGGGAATGTGTAGGAGGAAGG - Intergenic
945027917 2:205637063-205637085 AAGGGGGGTGGGGGGGAGGAGGG - Intergenic
945332341 2:208554316-208554338 CAGGGGTGTGTGGAGTAGGCGGG + Intronic
945941683 2:215957425-215957447 GAGGAGAGTGTGGGGGAGGGAGG - Intronic
946027430 2:216680177-216680199 CAGGGGTGAGTGGAGGTGGGGGG + Intronic
946063699 2:216968093-216968115 CATGGGAGGGTGGGGGAAGAGGG + Intergenic
946189813 2:218002280-218002302 CAGGGGAGGGCTGTGGAGGAAGG + Intronic
946253938 2:218429961-218429983 CGGGGGAGGGTCCAGGAGGAGGG + Intronic
946302577 2:218832801-218832823 ATGGGGAGGGTGGAGGAGAATGG + Intergenic
946308281 2:218868440-218868462 GAGGGCAGGGTTGAGGAGGAGGG + Intronic
946311838 2:218886461-218886483 TAGGGGAGGGTGGAGGAGAGAGG - Intronic
946380684 2:219346693-219346715 AAGGGGTGACTGGAGGAGGAAGG - Intergenic
946408301 2:219504308-219504330 GAAGGGAGAGGGGAGGAGGAAGG - Intronic
946642292 2:221797160-221797182 CGTGGGATTGTGGAGGTGGAGGG + Intergenic
946878829 2:224157622-224157644 CAGGGGAGTGAGGAAGAAGGTGG + Intergenic
947526042 2:230877300-230877322 CAGGGGCCTCTGGAGGAGGGAGG + Intronic
947526181 2:230878102-230878124 CAGGGGGTTCTGGGGGAGGAGGG - Exonic
947612336 2:231531821-231531843 GGGGGCAGTGGGGAGGAGGAGGG - Intergenic
947874561 2:233459656-233459678 GACGGGTGTGTGGAGCAGGAAGG + Intronic
947954272 2:234174219-234174241 GAGGGGAGTGTGAAGTAGGAAGG + Intergenic
948091926 2:235302165-235302187 AAGGGGAGGAGGGAGGAGGAGGG - Intergenic
948242330 2:236447881-236447903 CAGGGGAGGGTGGGGGAGGGTGG + Intronic
948262984 2:236617959-236617981 GTGGCGAGTGTGGAGGAGGCTGG + Intergenic
948371049 2:237489167-237489189 CAGGTGAGGCTGTAGGAGGATGG - Intronic
948377531 2:237531289-237531311 CAGGGGACAGTGGAGGACTAGGG + Intronic
948618406 2:239216676-239216698 CAGGGCAGAGTGAAGGCGGAGGG - Intronic
948687672 2:239679220-239679242 AATGGGAGTGAGGAGGAGGCCGG - Intergenic
948691283 2:239706691-239706713 GAGGGCACTCTGGAGGAGGAAGG + Intergenic
948718483 2:239881397-239881419 CAGGGCAGTGGGCAGGAGGGAGG - Intergenic
949003047 2:241628321-241628343 CATGTGAGTGTGGGGGTGGAGGG - Intronic
949060702 2:241955386-241955408 CATGGGGGTGTGGAGGAGAGAGG + Intergenic
1168821011 20:773931-773953 CAGGAGAATGTGGAGGGGGGCGG - Intergenic
1168828838 20:833478-833500 CGCGGGAGGGAGGAGGAGGAAGG + Intergenic
1169118288 20:3081310-3081332 CAGGAGGGAGTGCAGGAGGAGGG - Intergenic
1169198338 20:3695085-3695107 CAGGAGAGTGGGGAGCAGGAGGG - Intronic
1169369809 20:5020104-5020126 AAGGGGAGTGTGGAGGGGAGGGG - Intergenic
1169405142 20:5316185-5316207 CAGGGGAGGGTGCAGGTAGAGGG - Intergenic
1169765619 20:9144764-9144786 GAGGGGAATGAGGGGGAGGAGGG + Intronic
1170221938 20:13950615-13950637 CATGGGAGTGTTAAGGAGGATGG + Intronic
1170242134 20:14178614-14178636 CAGAGTAGTATGGATGAGGAAGG + Intronic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1171191012 20:23159518-23159540 CCCGGGGGTGTGGAGCAGGATGG + Intergenic
1171370697 20:24660519-24660541 CTGACGAGTGGGGAGGAGGAGGG - Intronic
1171424831 20:25042860-25042882 GAGGGGTGTCTGGAGGATGAGGG - Intronic
1171444976 20:25196454-25196476 CAGGAGAGCGTGGAAGAGGAAGG + Intronic
1171486393 20:25489463-25489485 CGGGGGAGTAAGGAGAAGGAGGG - Intronic
1171545566 20:25997954-25997976 CAGGGGAGTATGGGGGAGTTGGG + Intergenic
1171767109 20:29296517-29296539 CAGAGGGGTGTTGGGGAGGAGGG + Intergenic
1171865220 20:30484349-30484371 CGGAGGAGTGTTGGGGAGGAGGG + Intergenic
1171908838 20:30922238-30922260 CAGAGGGGTGTTGGGGAGGAGGG - Intergenic
1172039751 20:32035475-32035497 CAGGGGAGCTTGAAGGAGCATGG + Intergenic
1172039878 20:32036309-32036331 CAGGGAAGTGGGGAGGAGGCTGG + Intergenic
1172318545 20:33976862-33976884 CAGGGGAGGGGAGAAGAGGAAGG + Intergenic
1172488499 20:35315251-35315273 GAGGAGAGTGAGGGGGAGGAGGG + Intronic
1172595444 20:36148169-36148191 CAGGGGTGTGTGTGGGCGGAGGG + Intronic
1173571413 20:44079137-44079159 CAGGGGAGTGGGGAGTAGGAGGG + Intergenic
1173656623 20:44704196-44704218 CAGGGGATGGTGGAGGAGCCTGG + Intergenic
1173896475 20:46554874-46554896 CAGGGCAGGGAGGAGGAGCATGG - Intergenic
1174961023 20:55156959-55156981 GAGGAGAGTGAGGAGGAGAAGGG - Intergenic
1175237592 20:57525245-57525267 AAGGGGAGTAGGGAGGGGGAGGG + Intronic
1175320731 20:58086205-58086227 CTGGGGAGTGTGGACGAGTGGGG - Intergenic
1175529169 20:59662407-59662429 GAGAGGAATGTGGAGCAGGATGG + Intronic
1175574278 20:60048995-60049017 CTGGGTAGTGTGGTGGAGGTGGG + Intergenic
1175586573 20:60145840-60145862 CATTTGGGTGTGGAGGAGGATGG - Intergenic
1175625222 20:60484010-60484032 CAGGAGAGTGGGGAGGGGGAGGG - Intergenic
1175830419 20:61962289-61962311 CTGGGGAGTGTGGTGCAGGGTGG + Intronic
1175901741 20:62362600-62362622 AGGGTGACTGTGGAGGAGGAAGG - Intronic
1176000923 20:62830788-62830810 CAGGGGACTGTGGTGGGGGGTGG - Intronic
1176057120 20:63154780-63154802 AAGAGGAGAGGGGAGGAGGAGGG - Intergenic
1176084092 20:63288092-63288114 CAGGGGAGTGTGGGACGGGACGG - Exonic
1176342444 21:5710738-5710760 CAGGGGAGGGGCGAGGAGAAGGG - Intergenic
1176474698 21:7142890-7142912 CAGGGGAGGGGCGAGGAGAAGGG - Intergenic
1176502383 21:7613718-7613740 CAGGGGAGGGGCGAGGAGAAGGG + Intergenic
1176536765 21:8108807-8108829 CAGGGGAGGGGCGAGGAGAAGGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178007812 21:28242633-28242655 CAGGGCAGGGTAGAGGAAGATGG - Intergenic
1178103148 21:29291635-29291657 CAGAGAAGTGTGGAGGAGGCTGG + Intronic
1178454244 21:32732554-32732576 GAGGGGAGCCTGGAGGAGGCTGG - Intergenic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178498177 21:33104342-33104364 CAGGGAAGTGGGGAGCAGGAAGG + Intergenic
1178778583 21:35576615-35576637 AAGGGGAGTGTGAAGGAGCAAGG - Intronic
1178822860 21:35991342-35991364 CAGGAGAGTGAGGAGGGAGATGG + Intronic
1179031125 21:37720490-37720512 CAGGGGACCTTGAAGGAGGAGGG + Intronic
1179438156 21:41376071-41376093 CAGGGGAGTGTGGGAGAAGCAGG - Intronic
1179451584 21:41472136-41472158 TGGGGGAGTGTGGGGGAGAAGGG - Intronic
1179583795 21:42362026-42362048 CAGTGGGGTGTGCAGTAGGACGG - Intergenic
1179583804 21:42362066-42362088 CAGTGGGGTGTGCAGTAGGACGG - Intergenic
1179722043 21:43321599-43321621 CAGGGGAGGGTCGGGAAGGAGGG - Intergenic
1180060186 21:45381128-45381150 CGGGGGAGAGTGGAGTGGGAGGG - Intergenic
1180311950 22:11249233-11249255 CAGAGGAGTGTTGGGGACGAGGG + Intergenic
1180728893 22:17966419-17966441 CAGAGGAGTGAGGAGGTGGAGGG - Intronic
1180762879 22:18222696-18222718 CAGGGCTGTGTGCAGGAAGAAGG + Intergenic
1180772767 22:18401851-18401873 CAGGGCTGTGTGCAGGAAGAAGG - Intergenic
1180804146 22:18651467-18651489 CAGGGCTGTGTGCAGGAAGAAGG - Intergenic
1180806628 22:18718010-18718032 CAGGGCTGTGTGCAGGAAGAAGG + Intergenic
1180955163 22:19738221-19738243 AAGGGGAGACTGGAGGAGGAGGG - Intergenic
1181217574 22:21343792-21343814 CAGGGCTGTGTGCAGGAAGAAGG + Intergenic
1181533929 22:23532171-23532193 GAGAGGAGAGGGGAGGAGGAGGG + Intergenic
1181971198 22:26691365-26691387 CTGGGTAGGTTGGAGGAGGATGG + Intergenic
1181996625 22:26887966-26887988 CAGGTGAGTGCGGAGTAGGGAGG + Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182254819 22:29030780-29030802 GGTGGGAGTGGGGAGGAGGAGGG + Intronic
1182351676 22:29703285-29703307 CTGGCGAGTGAGGAGGGGGAAGG - Intergenic
1182415172 22:30216791-30216813 AAGGGAAGTGTGAAGGAGGAGGG + Intergenic
1182419142 22:30240344-30240366 CAGCGAAGGGTGGAGGAGGGTGG - Intergenic
1182560090 22:31152869-31152891 CTGGGTAGTGTGGAGAGGGAGGG - Intergenic
1182683812 22:32105004-32105026 CAGGGCAGTGAGGAGTAGGGTGG + Intronic
1182930139 22:34165882-34165904 AAGCTCAGTGTGGAGGAGGATGG + Intergenic
1182986466 22:34722606-34722628 CAGGAAACTGTGGAGGATGAAGG - Intergenic
1183107136 22:35622715-35622737 CTGGGGAGGGTGGAGGGGGGAGG - Intronic
1183351144 22:37335313-37335335 GCGGGGAGCGGGGAGGAGGACGG - Intergenic
1183375013 22:37458252-37458274 CAGGGGGCTGGGGAGGAAGATGG + Intergenic
1183385411 22:37511390-37511412 GAAGGGGGTGAGGAGGAGGAGGG + Intronic
1183469909 22:37999655-37999677 CAGTGGGGTGCGGAGGATGAGGG + Intronic
1183487583 22:38097701-38097723 CAGGAGAGAGGGGAGGAGGATGG + Intronic
1183510581 22:38232455-38232477 GAGGAGAGTGTGGAGAAGGCGGG + Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183686686 22:39365075-39365097 CAGGGGAGGATGGAGGGTGATGG - Intronic
1183726501 22:39592866-39592888 CAGTGCAGTGTGGGGTAGGAGGG - Intronic
1183792462 22:40083878-40083900 CAGGGAAGGGTTGGGGAGGAGGG + Intronic
1184147012 22:42617695-42617717 GAGGGGAGTGGGGAAGAAGAGGG - Intergenic
1184243321 22:43222880-43222902 CAGGGAAGTGGCCAGGAGGAAGG + Intronic
1184326259 22:43789310-43789332 AAGGAGAAGGTGGAGGAGGAAGG + Intronic
1184378394 22:44129563-44129585 CAGGGCAGCTTGGAGAAGGAAGG - Intronic
1184492015 22:44815235-44815257 CAGGAATGTGTGGGGGAGGAGGG + Intronic
1184581789 22:45422901-45422923 GAGGGGAGTGTGTGGGAGGAGGG - Intronic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184669867 22:46006979-46007001 CAGGGGAGAGCGGAGAAGGCTGG - Intergenic
1184677598 22:46052287-46052309 CAGGGGTGTGTGGAGTGGGAGGG - Intronic
1185286036 22:50000292-50000314 GGGGGGCGGGTGGAGGAGGATGG - Intronic
1185295200 22:50049665-50049687 CAGGCAGGGGTGGAGGAGGAGGG + Intronic
1203234602 22_KI270731v1_random:142839-142861 CAGGGCTGTGTGCAGGAAGAAGG - Intergenic
1203241712 22_KI270733v1_random:25218-25240 CAGGGGAGGGGCGAGGAGAAGGG - Intergenic
949149164 3:743884-743906 CAGGGGAGGGTCTAGAAGGATGG + Intergenic
949174562 3:1044209-1044231 CAGGTGTGGGTGGAGGTGGAAGG - Intergenic
949719110 3:6967882-6967904 CTGGGGTGTGGAGAGGAGGAGGG + Intronic
949807671 3:7973659-7973681 CAGGGGAGAGGGGAGGAGAGAGG + Intergenic
949990360 3:9573859-9573881 AAGGGGATTGTGGAGGATGAGGG + Intergenic
950018564 3:9770369-9770391 CACGGGAGTCTGGTGGGGGATGG + Intronic
950117671 3:10461956-10461978 CAGGAGAGTGGGAAGAAGGAAGG - Intronic
950215367 3:11154721-11154743 CTGGGGAGGGTGGCGGAGGGCGG + Intronic
950234273 3:11305003-11305025 CTGGTGAGTATGGAGGAGGGGGG - Intronic
950262512 3:11553170-11553192 CAGGGGTGTGTGGAAAAGGGCGG - Intronic
950328142 3:12132533-12132555 CACATGGGTGTGGAGGAGGAGGG - Intronic
950465799 3:13153086-13153108 GAGGGGAGAGGGGAGAAGGAGGG - Intergenic
950621526 3:14209500-14209522 CAGGGGAGTGTAATGGAGGAGGG - Intergenic
950771410 3:15314498-15314520 CAGGGCAGAGTGGGGGAGCAAGG + Intronic
951104360 3:18725736-18725758 GAGGGGGATGTGGAGGCGGAGGG + Intergenic
951505938 3:23445000-23445022 CATGGGAGTGGGGAGGTAGAGGG - Intronic
952877839 3:37961999-37962021 GGGGGGTGGGTGGAGGAGGAAGG - Intronic
952935607 3:38396250-38396272 CAGGGCAGTGCAGAGGAAGAAGG + Intronic
952945755 3:38477142-38477164 CAGGGGTGAGTGCAGGAGGTTGG + Intronic
952958449 3:38575246-38575268 CAGGGACGGCTGGAGGAGGAGGG - Intronic
952967414 3:38629905-38629927 CAAGTGGGTGGGGAGGAGGACGG + Intronic
953226713 3:41028127-41028149 CATGGAAGAGTGGAGGGGGAAGG + Intergenic
953821978 3:46214759-46214781 CAGGGCAGTGTGGATGATGTAGG + Intronic
953886703 3:46718080-46718102 CAGCGGAGTGAGGAGAGGGAGGG - Exonic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954409572 3:50364586-50364608 GCGGGGAGTGTGGGGCAGGAGGG + Intronic
954412975 3:50379202-50379224 GAGGGGAGTGAGGCGGAGGCAGG + Intronic
954424755 3:50437531-50437553 CAGGGGAATGTTGAGGGGGAGGG - Intronic
954440478 3:50519113-50519135 CAGGTGACTGTGGATGGGGATGG - Intergenic
954752477 3:52821464-52821486 AAGTGCAGTGTGGAGCAGGAAGG + Intronic
955059551 3:55483680-55483702 CAGAGGAGTGAGGTGGAGGAGGG + Intronic
955131325 3:56171926-56171948 AAGGTGGGTGTGGAGGTGGATGG + Intronic
955142081 3:56279464-56279486 CAAGTGAGGATGGAGGAGGAAGG + Intronic
955386800 3:58487090-58487112 GAGAGGAGAGGGGAGGAGGAAGG + Intergenic
955537751 3:59942330-59942352 CAGGAGTGTGGGGAGGAGGAAGG - Intronic
955813630 3:62819011-62819033 CAGGGGATGGTGGTGGAGGTGGG + Intronic
956135930 3:66098977-66098999 AAGGGGAGGGGAGAGGAGGAAGG - Intergenic
956204222 3:66739152-66739174 CAGAGGAGTGTGCAGTGGGAGGG + Intergenic
956211520 3:66806630-66806652 GAGTGGAGTGTGGAGGATGATGG - Intergenic
956265514 3:67392157-67392179 CAGGGGTCAGTGAAGGAGGAAGG - Intronic
957467073 3:80608069-80608091 AAGGGGAGTGGGAGGGAGGAGGG + Intergenic
959142932 3:102507541-102507563 GAGGGGAGTTAGGAGAAGGAAGG + Intergenic
959499832 3:107093344-107093366 CAGGAGGGTGTGGTGCAGGAGGG - Intergenic
959548805 3:107630384-107630406 CAAAGGAGTGGGGAGGAGGAGGG - Intronic
959991363 3:112635897-112635919 TAAGGGAGTGGGGAGAAGGAGGG + Intronic
960013672 3:112861064-112861086 CAAGAGAGAGTGGAGGGGGAGGG - Intergenic
960945855 3:122966116-122966138 ATGGGAAGTGGGGAGGAGGAGGG - Intronic
961146005 3:124593853-124593875 CAGGGGAATGTGGCGGGAGAGGG - Intronic
961518789 3:127455287-127455309 CAGGCGAAGGTGGAGGAGGCGGG + Intergenic
961862344 3:129927014-129927036 CGGGGGAGTGGGGAAAAGGAGGG - Intergenic
962028358 3:131572586-131572608 GAAGGGAGAGTGGAGAAGGATGG + Intronic
962209040 3:133461044-133461066 AAGGCGAGTGTTCAGGAGGAGGG - Intronic
962395872 3:135015010-135015032 CAGGTGTGTGTGGAGGAGAGTGG + Intronic
962932087 3:140048070-140048092 GAGGGGAGAAAGGAGGAGGAAGG + Intronic
963059013 3:141209790-141209812 TAAGTAAGTGTGGAGGAGGACGG - Intergenic
963320382 3:143803951-143803973 TAAGTAAGTGTGGAGGAGGACGG - Intronic
963376016 3:144466022-144466044 CAGGGAAGGGTGGAGAAAGAGGG - Intergenic
963650724 3:147976700-147976722 GAGGTTAGTGTGGAGGAGGATGG + Intergenic
964119196 3:153164036-153164058 AAGGGGAGTCTGGGGGAGAATGG + Exonic
964306166 3:155342573-155342595 GAGGAGGGTGAGGAGGAGGAGGG + Intergenic
964380696 3:156096441-156096463 CAGGTGATTGTGCAGCAGGAAGG + Intronic
964452183 3:156823052-156823074 CAGGGAGGTGTGGAGGGAGAGGG - Intergenic
964555802 3:157936649-157936671 GAGGGAAGAGTGGAAGAGGAAGG - Intergenic
964618037 3:158690859-158690881 GAGCGGAGTGGGGATGAGGAGGG + Intronic
964698787 3:159540109-159540131 AAGGGAAGTGGGGAAGAGGAAGG - Intronic
965375222 3:167914857-167914879 CATGGGTGTATGGAGGAAGAAGG - Intergenic
965673516 3:171171709-171171731 CAGGTGAGTGTGGATGAGCAGGG + Intronic
965953869 3:174344512-174344534 CAGGGGAGGCTGGAGAGGGATGG - Intergenic
966279996 3:178215012-178215034 AAGAGGAGTGGGGAGGGGGAAGG - Intergenic
966466240 3:180233770-180233792 TAGGGCAGTGTGGAAGAGAAAGG - Intergenic
966588215 3:181650995-181651017 GAGGGGAGAGGGAAGGAGGAAGG + Intergenic
966766105 3:183464029-183464051 AGGGGAAATGTGGAGGAGGAAGG - Intergenic
967429570 3:189366174-189366196 CAGGGGTGGGGGTAGGAGGAAGG - Intergenic
967754848 3:193157225-193157247 GGGGGGAGTGGGGAGGAGGGGGG - Intergenic
967847925 3:194058558-194058580 GAGGGGAGTGGGGAGGGGGACGG + Intergenic
967963292 3:194941971-194941993 CAGGGGCGGGTGGAGAAGGGTGG - Intergenic
968005906 3:195242633-195242655 CATGGGAGGCTGGAGGAGGTGGG + Intronic
968006357 3:195245812-195245834 CAGGAGAGAGTGGAGGCGGGTGG - Intronic
968581376 4:1396941-1396963 CAGGGCAGTCGGGAGGAGGTGGG + Intergenic
968606088 4:1536402-1536424 CCCGGGAGTGTGCAGGAGGCTGG - Intergenic
968701688 4:2060619-2060641 GGGGGGAGGGGGGAGGAGGAAGG - Intronic
968962392 4:3752252-3752274 CAGTGGAGTGTGCATGAGGAAGG - Intergenic
969547690 4:7842529-7842551 GGAGGGAGTGGGGAGGAGGAAGG + Intronic
970386649 4:15563252-15563274 CAGGGGCGTGTGCAGGACCATGG + Intronic
970444500 4:16112659-16112681 GAGGGGAGGGTGGAGGAGAGGGG + Intergenic
970872940 4:20836940-20836962 CATTAGAGTGTGGTGGAGGAAGG - Intronic
970928870 4:21485400-21485422 GATGGGAGTGGGGAGTAGGAGGG - Intronic
971500352 4:27312014-27312036 GAGGGGAGTGTGGATGACGATGG + Intergenic
972127619 4:35789218-35789240 CAGGGGAGAGAGGAGGGGAAGGG + Intergenic
972170711 4:36342326-36342348 TACAGGAGTGTGTAGGAGGAAGG + Intronic
972242558 4:37208942-37208964 CATGGTAGTGTGGAGGTGGAGGG - Intergenic
973217157 4:47682124-47682146 CAGAAGGGTATGGAGGAGGAGGG + Intronic
973707234 4:53592742-53592764 TGGGGGAGGGTGGAGGAAGAAGG + Intronic
973754714 4:54063975-54063997 AAGGGGTGTGTGGAGGAGGAAGG + Intronic
973774948 4:54233728-54233750 CAGGGGAGTGTGGAGGAGGACGG + Intronic
973811236 4:54572217-54572239 CATGGGTGTATGGGGGAGGAGGG + Intergenic
973918400 4:55659885-55659907 CAGGGGACTCTAGAGGAGAATGG - Intergenic
974470879 4:62316272-62316294 CAGGGAATTGTGGGGGAGGTGGG - Intergenic
975045530 4:69798925-69798947 CAGAGGAGGGTGGAGCAAGATGG + Intergenic
975139341 4:70903385-70903407 GAGGGGAACGTGGAGGGGGAAGG + Intronic
975473352 4:74794557-74794579 GCGGGGTGTGTGCAGGAGGAGGG - Exonic
975998303 4:80341278-80341300 CCAGGCAGTGTGGATGAGGAAGG + Intronic
976132299 4:81897551-81897573 AAGGGGGGAGAGGAGGAGGAAGG - Intronic
976296506 4:83478027-83478049 CAGGGGTCTGTGGAGGAGTGTGG + Intronic
976475528 4:85478097-85478119 CATGTGGGTGTGGAGGAGGTTGG + Intronic
976479715 4:85526293-85526315 CAGGAGGCTGTGTAGGAGGATGG + Intronic
976493377 4:85698038-85698060 GAGGGGAGTGTGGGAGAGGAAGG + Intronic
976753728 4:88477237-88477259 GAGGGGAGGGGAGAGGAGGAAGG + Intronic
976802347 4:89006798-89006820 CAGGGGATGGTGCAGGAGGAAGG + Intronic
977210821 4:94215624-94215646 AAGGGGGGTGGGGGGGAGGAGGG + Intronic
977435728 4:96991678-96991700 CTTGGGAATGTGCAGGAGGAGGG + Intergenic
977459496 4:97307705-97307727 CAGGGGAGAGGAGAGGAAGAAGG + Intronic
977804809 4:101284635-101284657 CATGGGGGTGGGGAGTAGGAAGG - Intronic
978030481 4:103936334-103936356 CAGGAGAGGGTGGAGCAAGATGG + Intergenic
978417375 4:108490773-108490795 CTGGGGAGGGTGGAGGTGGGTGG + Intergenic
978421289 4:108535876-108535898 CAAGAGAGGGTGGAGAAGGAAGG - Intergenic
979109931 4:116740143-116740165 CTAGGGAGTTTGGAGCAGGAGGG + Intergenic
980092327 4:128455611-128455633 GAGGGAAGTGTGGAGGGGGAAGG + Intergenic
980670415 4:135997216-135997238 GAGGGGAGAGGGTAGGAGGAGGG + Intergenic
980784351 4:137532741-137532763 AGGGGGAGTGGGGAGGAAGAAGG - Intergenic
981261957 4:142731124-142731146 CAGGGGAATGGGGTGGGGGAAGG - Intronic
981288525 4:143047161-143047183 CAGGGAAGGGTGGAGGTGGCTGG + Intergenic
981509572 4:145541109-145541131 CAGGTTAGTGGTGAGGAGGAAGG - Intronic
981654674 4:147099892-147099914 CAAGGGAATGTGGTGGGGGATGG + Intergenic
981961456 4:150544581-150544603 CAAGGAAGTGTGGAGTAGCATGG - Intronic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
982493424 4:156058868-156058890 CAGGGTATTGTGGAACAGGATGG - Intergenic
982521380 4:156420642-156420664 GAGGGGAGTGAGGTGCAGGAGGG + Intergenic
982750012 4:159149595-159149617 AAAGGGAGTGAGGAGGATGAGGG - Intronic
984188417 4:176575260-176575282 TAAGAGAGTGTGGGGGAGGATGG - Intergenic
984637885 4:182133019-182133041 CAGGCGAGTCAGGAGGAGGAGGG + Intergenic
984697147 4:182790599-182790621 CAGGTGAGTTTGCAAGAGGACGG - Intronic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984957543 4:185060401-185060423 AAAGGGAGTGGTGAGGAGGAGGG - Intergenic
985073447 4:186191033-186191055 CAGGGGCGGGTGGGAGAGGAAGG - Intergenic
985102661 4:186473964-186473986 AAGGTGTGTGTGGGGGAGGAGGG + Intronic
985212210 4:187607234-187607256 CAGGGGAGTGGGGAGGGAGTGGG - Intergenic
985271267 4:188197005-188197027 CAGGTGGGTGGGGAGGGGGAAGG - Intergenic
985271426 4:188197605-188197627 CAGGTGGGTGGGGAGGGGGAAGG - Intergenic
985440630 4:189980738-189980760 TGGGGGAGTGTGGGGGAGGTTGG + Intergenic
985440647 4:189980778-189980800 TGGGGGAGTGTGGGGGAGGTTGG + Intergenic
985440669 4:189980828-189980850 TGGGGGAGTGTGGGGGAGGTTGG + Intergenic
985440710 4:189980931-189980953 TGGGGGAGTGTGGGGGAGGTTGG + Intergenic
985440737 4:189980991-189981013 TGGGGGAGTGTGGGGGAGGTTGG + Intergenic
985558459 5:569617-569639 CAGCGGGGTCTGGAGGAGGGAGG - Intergenic
985658126 5:1142484-1142506 GAGGGGAGTGGGGAGGGGAAAGG - Intergenic
985836970 5:2278734-2278756 GAGGTGGGTGTGGAGGAGGAAGG - Intergenic
986443073 5:7798195-7798217 GAGGGTAGTGAGGAGCAGGAGGG + Intronic
986670457 5:10138980-10139002 CAGGAGAGTGTGGAGCAAGGAGG - Intergenic
986790251 5:11152718-11152740 CAGTGGAGTGAGGAGGAGTAAGG - Intronic
986806379 5:11312167-11312189 ATGGGGAGTGTGGGGGATGACGG - Intronic
986991494 5:13558204-13558226 CTGGGAAGGGTGGAGGAGGTGGG - Intergenic
987052213 5:14157063-14157085 AATGGGTGTGTAGAGGAGGATGG + Intronic
987252922 5:16118854-16118876 CAGGGCAGTGAAGAGGTGGAAGG + Intronic
987859373 5:23464733-23464755 GAGGGGAGGGGGGAGGGGGAAGG + Intergenic
988529101 5:32011651-32011673 CAGGAGAGTGGGAAGGAGGAAGG - Intronic
988537963 5:32085976-32085998 CCAGAGAGTGAGGAGGAGGAAGG - Intronic
989128812 5:38083679-38083701 CAGGGGAATGTCTTGGAGGAAGG - Intergenic
990147892 5:52783516-52783538 CAGGGGAGGGTGGACCAGGGTGG - Intergenic
991198541 5:63962257-63962279 AAGGGAAGTGAGGAGGAAGAGGG - Intronic
991240098 5:64448551-64448573 CAAAGGAATGGGGAGGAGGAAGG - Intergenic
992168438 5:74077775-74077797 AAGGGAAGTGGGGAGGAGAAGGG - Intergenic
992762764 5:79965674-79965696 CAGGGGAGAGTGGAGGTGAGGGG - Intergenic
992990767 5:82280651-82280673 GAGGGGAATGTGGAGTTGGAGGG + Intronic
993026601 5:82654066-82654088 CACAGGAGTGTGGAGGAAGATGG - Intergenic
993530875 5:89023884-89023906 GAGGGGAGTGGGGAGTAGAATGG + Intergenic
993541320 5:89156234-89156256 GAGGGGTGTGTTGAGGAGGGAGG + Intergenic
994427532 5:99610630-99610652 CAAGTGAGTCTGAAGGAGGAGGG + Intergenic
994869685 5:105331629-105331651 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
996003920 5:118398345-118398367 CGGGGGAGGGGGGAGGAGGGAGG - Intergenic
996329746 5:122315313-122315335 AAGGGGAGTGTGCTGGAGAATGG - Intronic
996416853 5:123220099-123220121 GAGGTGAGTGTGGAGGAAGAAGG - Intergenic
996434924 5:123423383-123423405 CAGGGGAGGTTGGAGGACAACGG + Intronic
996449765 5:123607583-123607605 CAGGGCAGGGAAGAGGAGGATGG + Intronic
997267535 5:132503950-132503972 CTGGGGAGACTGGAGTAGGAGGG + Intergenic
997756353 5:136403162-136403184 GAGGGGAGGCTGGAGGTGGATGG + Intergenic
997904386 5:137800843-137800865 GAGGGTAGTGGGTAGGAGGAGGG - Intergenic
998028014 5:138837501-138837523 GAGGGGAGGGAGGAGGGGGAGGG - Intronic
998140425 5:139696925-139696947 CAGGGGAGGGTGCATGATGAGGG + Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998388074 5:141769643-141769665 CAGGGGAGTGAGGGGGAGAGGGG - Intergenic
998604040 5:143615506-143615528 AGGGGGAGGGAGGAGGAGGAAGG - Intergenic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
999316699 5:150588671-150588693 CAGGGGAGAGAAGAGGAGGCTGG + Intergenic
999799655 5:155021002-155021024 TAGTGGAGTGTGGTGGAGAATGG + Intergenic
999926078 5:156379660-156379682 AAGGGGAGAGGGGAGAAGGAAGG + Intronic
999990464 5:157045427-157045449 AAGAGGAGTGGGGAGGAGGGAGG + Intronic
1000906878 5:166974929-166974951 CTGGGGAGGGGGGTGGAGGAGGG + Intergenic
1001132891 5:169079491-169079513 GGGGGGAGGGAGGAGGAGGAAGG + Intronic
1001303121 5:170552465-170552487 GAGGGGAGTGTGGAGGAGTGAGG + Intronic
1001403670 5:171461204-171461226 GAGGGCAGTGGGGAGGGGGAGGG + Intergenic
1001403679 5:171461222-171461244 GAGGGCAGTGGGGAGGGGGAGGG + Intergenic
1001404955 5:171469732-171469754 CAAGGGAGGGGGGAGGAGGAGGG - Intergenic
1001629692 5:173165478-173165500 AAGGGCAGTGTGGAGGCTGAAGG + Intergenic
1001753277 5:174147600-174147622 CAGGGGTGTGTGGAGAACCATGG + Intronic
1001758987 5:174192256-174192278 CAGGTGAGGGTTGTGGAGGAGGG - Intronic
1001998753 5:176183380-176183402 CTGGTGTGTGTGGAGGAGGTGGG + Intergenic
1002058311 5:176610914-176610936 CAGGGAAATGTGGAGGGGGTGGG - Intergenic
1002385323 5:178861379-178861401 CATGGGTGAGTGGAGGAGGCAGG - Intronic
1002558496 5:180063024-180063046 CCTGGGGGTGGGGAGGAGGAAGG + Intronic
1002650323 5:180687003-180687025 CTGGCGTGTGTGGAGGAGGTGGG + Intergenic
1002895772 6:1379295-1379317 CAGGGTATTCTGGAGCAGGAGGG + Intergenic
1003494092 6:6648867-6648889 CAGGAGGGTGTGGTGGGGGAGGG - Intronic
1003628426 6:7764855-7764877 TAGGGGAGTGAGGTCGAGGAGGG + Intronic
1003674244 6:8188453-8188475 CAGAGGAGTGGGAAGGAGAATGG + Intergenic
1003692884 6:8372249-8372271 CAGGGGAGGGGAGAGAAGGAGGG - Intergenic
1003956636 6:11171060-11171082 CAGGGAGGTGTGGAGGGAGAGGG + Intergenic
1004216797 6:13711287-13711309 CGGCGGAGGGTGGAGGAGCAGGG + Exonic
1004288578 6:14345955-14345977 GAGGAGAGAGGGGAGGAGGAAGG + Intergenic
1004757943 6:18633605-18633627 GAGGGGAGGGAGTAGGAGGAGGG + Intergenic
1005039531 6:21588499-21588521 CAGGGGATGGGGTAGGAGGACGG + Intergenic
1005437690 6:25832530-25832552 GAGAGGAGTGTGGAGGAGACAGG - Intergenic
1005887679 6:30109178-30109200 GTGGGGAGAGGGGAGGAGGATGG - Intronic
1005912971 6:30326915-30326937 CGGGGGCGAGGGGAGGAGGAAGG + Exonic
1006113349 6:31762060-31762082 AAGGGGAGTGGGGAAGAGAAGGG - Intronic
1006188166 6:32192038-32192060 AAGGGGAGTCTGGAGGAGGTGGG + Intronic
1006278816 6:33029724-33029746 CAGGGCTGTGAGGAGGGGGATGG - Intergenic
1006297082 6:33174468-33174490 CAGGGAAGCGAAGAGGAGGAGGG + Intronic
1006384677 6:33723773-33723795 GAGGGGAGCCTGGTGGAGGAGGG + Intronic
1006403224 6:33829780-33829802 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006403237 6:33829835-33829857 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006403250 6:33829890-33829912 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006403263 6:33829945-33829967 CAGGGATGTGAGGAAGAGGAGGG - Intergenic
1006403275 6:33830000-33830022 CAGGGAGGTGAGGAAGAGGAGGG - Intergenic
1006556689 6:34872945-34872967 CAGAGGAGTGTGGGGGAAGGGGG + Exonic
1006671034 6:35729823-35729845 CAGCAGGGTGTGTAGGAGGAAGG - Intergenic
1006945050 6:37779313-37779335 AAGGGTAGGGTGGAGGGGGAGGG + Intergenic
1007125309 6:39421386-39421408 GAGAAGAGTGCGGAGGAGGAGGG - Intronic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1007236293 6:40393122-40393144 CAGAGGAGAGGGGAGGAGGGAGG + Intronic
1007287109 6:40755567-40755589 CAGGTGAAGGGGGAGGAGGAGGG - Intergenic
1007290655 6:40783638-40783660 CAGGGCAGGGTGGAGGAGGATGG + Intergenic
1007291049 6:40787045-40787067 AAGGAGAATGTGGAGGTGGAGGG - Intergenic
1007342133 6:41198046-41198068 TAGTGGAGTGTGGGGCAGGAGGG + Intronic
1007470427 6:42086645-42086667 CAGGAGAGGGTGGTGGAAGAGGG - Intronic
1007694949 6:43726067-43726089 CTGGGGAGTTGGGAGGAGGGCGG - Intergenic
1007712749 6:43835035-43835057 CAGGGGACAATGGAGGAGGTAGG + Intergenic
1007712982 6:43836360-43836382 CTGGAGAGTGGGGAGGAGGAAGG + Intergenic
1008541681 6:52551490-52551512 CAGGGGAGGGTGAATGAGGGAGG + Intronic
1008955002 6:57205901-57205923 CAGCAGAGTGGAGAGGAGGAAGG + Intronic
1009901634 6:69813956-69813978 CAGAGCAGAGTGGAGAAGGATGG + Intergenic
1011497225 6:87948973-87948995 CAGGGAGGTGTGGAAGGGGAGGG - Intergenic
1011792463 6:90913425-90913447 CAGGGGGATGGTGAGGAGGAGGG - Intergenic
1012262092 6:97099558-97099580 GAGAGGACTGTGGAGGAGGAAGG - Intronic
1013616625 6:111849540-111849562 CAGAGGAGTGGCTAGGAGGATGG + Intronic
1013926037 6:115473689-115473711 CAGGGGTGGGAGGAGGAGGAAGG + Intergenic
1014287114 6:119512953-119512975 TCAGGGAGTGAGGAGGAGGAGGG - Intergenic
1014621674 6:123674866-123674888 TAGGGGAGTGTGGAAGGGAAAGG - Intergenic
1014657611 6:124127801-124127823 CAGGAGAGTGAGGAGGTCGATGG + Intronic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1014990481 6:128068932-128068954 GAGGGGAGTGGGGAGGAGAGGGG + Intronic
1015580816 6:134722752-134722774 CGGGAGAATGTGGAGGAGGGAGG + Intergenic
1015771659 6:136774158-136774180 GAAGGAAGTGTGGAGGAGGTTGG - Intronic
1015788831 6:136945822-136945844 GATGTGAGTGTGGAGGAGTAGGG + Intergenic
1015793766 6:136990024-136990046 CAGGGGAGCGGGGCGGAGGGCGG - Intergenic
1015892559 6:137983244-137983266 CATCGGAGTGGGGAGGAGGGAGG - Intergenic
1016095438 6:140031530-140031552 CAGGGGATTGTGGAGTAAAAGGG + Intergenic
1016120507 6:140337437-140337459 CAGGTGATTCTGGAGGAGGAAGG - Intergenic
1016201781 6:141419039-141419061 CTGGGGAGGGTGGGGGAGCAGGG - Intergenic
1017103487 6:150867081-150867103 AAGGGGAGTGGGGAGGAAAATGG - Intronic
1017127609 6:151080416-151080438 CAGGAGAGGGCAGAGGAGGAGGG + Intronic
1017440207 6:154457857-154457879 CAGGGAGGTTTGGAAGAGGACGG - Intronic
1017870130 6:158479994-158480016 CAGGTGAGGGAGGAGGAAGAGGG - Intronic
1017885250 6:158594039-158594061 CAGGGGTGTGAGGAGGAGGGAGG - Intronic
1018036496 6:159886997-159887019 CAGGGCAGGGTGGGGAAGGAGGG - Intergenic
1018076237 6:160216081-160216103 CAGGCGAAAGTGGAGCAGGAGGG + Intronic
1018362744 6:163087883-163087905 CAGAGGAGTGTTGGTGAGGATGG + Intronic
1018374069 6:163194866-163194888 GAGGGGAGAGTGAAGGAGGTGGG - Intronic
1018618528 6:165709436-165709458 CATGGGAGTGGGGAGTGGGAGGG - Intronic
1018661089 6:166087848-166087870 CAGGGGTGTGTGTAGGGGGTGGG + Intergenic
1018705402 6:166460473-166460495 GAGAGAAGTGTGGAGGGGGAGGG + Intronic
1018960953 6:168448303-168448325 CAGGAGGCTGGGGAGGAGGATGG + Intronic
1019132877 6:169890367-169890389 CCAGGGTGTGTGGTGGAGGAGGG + Intergenic
1019167517 6:170108503-170108525 AAGGGAAGTGTGGAGGTGGCCGG - Intergenic
1019230994 6:170562923-170562945 AAAGGGAGTATGAAGGAGGAAGG - Intronic
1019318918 7:406038-406060 CAGGGTGGTCTGGAGGAGGGAGG - Intergenic
1019360454 7:601933-601955 CAGGGGGATGGGGAGGGGGAAGG + Intronic
1019419063 7:942323-942345 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419076 7:942378-942400 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419081 7:942396-942418 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419086 7:942414-942436 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419091 7:942432-942454 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419096 7:942450-942472 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419112 7:942509-942531 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419127 7:942575-942597 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419132 7:942593-942615 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419137 7:942611-942633 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419153 7:942670-942692 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419167 7:942720-942742 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419172 7:942738-942760 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419188 7:942797-942819 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419202 7:942847-942869 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419218 7:942906-942928 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419241 7:943006-943028 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419266 7:943097-943119 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419285 7:943181-943203 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419298 7:943233-943255 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419308 7:943267-943289 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419317 7:943303-943325 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419322 7:943321-943343 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419338 7:943380-943402 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419375 7:943523-943545 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419393 7:943588-943610 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419398 7:943606-943628 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419403 7:943624-943646 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419440 7:943767-943789 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019419454 7:943817-943839 GAAGGGAGAGAGGAGGAGGAAGG + Intronic
1019447824 7:1080556-1080578 CAGAGGAGTCTGGAACAGGACGG + Intronic
1019479826 7:1261340-1261362 CAGGGGAGGATGGCAGAGGACGG + Intergenic
1019487104 7:1294390-1294412 CAGGGGTGTGACCAGGAGGAGGG - Intergenic
1019508355 7:1404804-1404826 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508370 7:1404838-1404860 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508385 7:1404872-1404894 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508400 7:1404906-1404928 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019718627 7:2554926-2554948 CAGGGGGGTGCGGAGGGGAAGGG + Intronic
1019776136 7:2913066-2913088 GAGGGAAGTGAGGAGGGGGAGGG + Intronic
1020080746 7:5284510-5284532 CAGCGCAGAGTGGAGGAGCAGGG + Intronic
1020787116 7:12587348-12587370 GTGGGGAGTGAGGATGAGGATGG + Intronic
1021858550 7:24882246-24882268 CAGGTGAGGGTGGGGGAGGGAGG - Intronic
1022026037 7:26448771-26448793 TAGGGGTGTGGGGAGGAGGAAGG + Intergenic
1022532436 7:31075477-31075499 CAGGAGAGAGTGGCAGAGGATGG - Intronic
1023357119 7:39378351-39378373 CAGGGGAGCATGGATAAGGAAGG - Intronic
1023362787 7:39432925-39432947 GAGGGGGGTGTGGTGGAAGAAGG - Intronic
1023365455 7:39458935-39458957 CAGGAGAGTGGAGAGGAGGGAGG - Intronic
1023503141 7:40872019-40872041 GAGGGGAGTGTGGGGGGAGAAGG + Intergenic
1023736696 7:43241913-43241935 GTGGGGGGTGTGGAGGAAGAAGG + Intronic
1023825937 7:44008831-44008853 CAGGGGTGGGGGGAGGGGGATGG + Exonic
1023848132 7:44134728-44134750 GGTGGGAGTGTGGAGGAGGCTGG + Intergenic
1023850334 7:44146445-44146467 GAGAGGTGTGCGGAGGAGGAGGG - Exonic
1023990180 7:45124096-45124118 CAGGGGGGTGGTGGGGAGGAGGG + Intergenic
1023994360 7:45150067-45150089 CAGTGGGGTGTGGAGAAAGATGG + Intergenic
1024009940 7:45258950-45258972 AAGGGTGGTGTGGAGGTGGAGGG + Intergenic
1024019547 7:45353358-45353380 CAGGGGAGGGAAGAGGAGGAAGG + Intergenic
1024229528 7:47353749-47353771 CTGAGGAGGGTGGAGGAGGAGGG - Intronic
1024246364 7:47473080-47473102 CAGGGCACGGTGGAGGACGATGG - Intronic
1024326744 7:48114847-48114869 CAGGGTAGTGTGGCCCAGGAAGG + Intergenic
1025198743 7:56949553-56949575 AAGGGGAGGGAGGAGGAGGGGGG - Intergenic
1025818604 7:64942979-64943001 CAGGGGAATGAGGAGGAGCGGGG + Intergenic
1026433614 7:70373150-70373172 CAGGGGGGAGTGGGGGAAGAAGG + Intronic
1026469166 7:70680103-70680125 CATGAGAGTGGGGAGGAGGGTGG + Intronic
1026596599 7:71738453-71738475 CAGGGAGGTGTGGAGGGAGAAGG - Intergenic
1026806137 7:73430474-73430496 AAGGGGAGGGAGGGGGAGGAGGG - Intergenic
1026831526 7:73613149-73613171 CACGGGAGTGGGGAGGAGAAGGG - Intronic
1026894914 7:74004344-74004366 CTGGGGAGTGAGGTGGAGGGAGG - Intergenic
1027374596 7:77537392-77537414 TAGGGCGGTGGGGAGGAGGAGGG + Exonic
1027725632 7:81802159-81802181 CAGGCCAGAGTAGAGGAGGAAGG - Intergenic
1027868708 7:83678944-83678966 GAGGGGAGTGTAGAGGTGGTAGG + Intergenic
1028058707 7:86282241-86282263 CAGGGGCGGGTGGGGGAGGGGGG + Intergenic
1029090882 7:98047308-98047330 CATGAGAGTGAGAAGGAGGAGGG + Intergenic
1029306908 7:99626273-99626295 CAGAGGAGTAAGGAGGAGGCAGG + Intronic
1029412850 7:100426865-100426887 CAGGGAAGGGAGGAGGGGGAGGG - Intronic
1029412873 7:100426927-100426949 AAGGGGAGGGAGGAGGGGGAGGG - Intronic
1029422104 7:100477195-100477217 GAGGGGGGGGAGGAGGAGGAAGG + Intronic
1029483222 7:100825053-100825075 CAGTGGAGAGTGGAGGAGGGAGG + Intronic
1029595955 7:101537795-101537817 GAGGCTAGGGTGGAGGAGGAGGG - Intronic
1029611051 7:101626752-101626774 CTGGGGAATGAGGAAGAGGAGGG - Intronic
1029705633 7:102274329-102274351 CATGGGAGGAGGGAGGAGGAGGG + Intronic
1029890974 7:103930413-103930435 CAGGGGGTTGTGGCGGGGGACGG + Intronic
1030005301 7:105112637-105112659 CAGGTGGTGGTGGAGGAGGAGGG - Exonic
1030011464 7:105172355-105172377 CAGGGGAGTAGGAAGGAAGAAGG + Intronic
1030172393 7:106616486-106616508 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1030677403 7:112398547-112398569 CAGAGCAGGGTGGAGGAGGGTGG - Intergenic
1031313293 7:120226925-120226947 TAGGGGAGCCTAGAGGAGGAAGG - Intergenic
1031493334 7:122416728-122416750 GAGGGGGTTGTGGGGGAGGAAGG + Intronic
1031621208 7:123936281-123936303 AAGGGGATTGTGGAGGACAACGG + Intronic
1031695207 7:124843505-124843527 AAGGAGGGAGTGGAGGAGGAGGG + Intronic
1031923508 7:127618174-127618196 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032086019 7:128884388-128884410 CATGGGCCTGGGGAGGAGGATGG - Intronic
1032182458 7:129692074-129692096 CAGGGGAATGTGGAGGGAGAGGG - Intronic
1032327820 7:130948405-130948427 CAGGGGAGCTGGGGGGAGGAGGG + Intergenic
1032702497 7:134394914-134394936 CAAAGGATTGAGGAGGAGGAAGG + Intergenic
1032868395 7:135953100-135953122 AAGGGGAGTTTGGAGGAGTTTGG - Intronic
1033130784 7:138743917-138743939 CAGGGGACTCTGGAGGAGAGGGG - Intronic
1033235274 7:139633307-139633329 CATGAGAGTGGGGAGGAAGAGGG + Intronic
1033347203 7:140534698-140534720 CTGCAGAGTGTGGAGGTGGAGGG + Intronic
1033454645 7:141491862-141491884 CAGGGGAGAGATGAGGAGGCAGG - Intergenic
1033839704 7:145359475-145359497 AAGGGGATTGTGGATGATGAGGG + Intergenic
1034056650 7:148042356-148042378 CAGGGCATGGTGGAGGGGGAAGG + Intronic
1034073903 7:148213738-148213760 CAGGGGAGGGAGGAGGAGTCAGG - Intronic
1034084459 7:148311130-148311152 CAAGTAAGTGTGGAGGAGGGTGG + Intronic
1034241307 7:149613235-149613257 CAGGCAGGTGTGGAGTAGGAAGG - Intergenic
1034426443 7:151016643-151016665 CAGGGGCATGTGGAGGGGGGTGG - Intronic
1034450701 7:151135684-151135706 CAGGGGAGTGGCCAGGGGGAGGG + Intronic
1034924207 7:155107941-155107963 GTGGGGAGTGTGGTGCAGGAGGG + Intergenic
1035049715 7:155991801-155991823 CAGGGGGGTGTTGAGTAGCATGG + Intergenic
1035239565 7:157520926-157520948 AAGGAGACTGGGGAGGAGGAGGG + Intergenic
1035239687 7:157521492-157521514 CAGGGCAGTGAGTGGGAGGAGGG + Intergenic
1035241891 7:157537705-157537727 CTGGGGATGGTGGAGGATGAGGG - Intergenic
1035261386 7:157663640-157663662 CAGGGAAGGGTGGAGAGGGAGGG - Intronic
1035454198 7:158998094-158998116 GAGGGGAGCGTGGATGAAGATGG - Intergenic
1035454232 7:158998196-158998218 GAGGGGAGCGTGGATGAAGATGG - Intergenic
1035454407 7:158998708-158998730 GAGGGGAGCGTGGATGAAGATGG - Intergenic
1035458607 7:159025319-159025341 CAAGGGAGAGATGAGGAGGAGGG - Intergenic
1035476146 7:159145183-159145205 CAGGGAAGAGGGGAGGAGAACGG - Intergenic
1035517795 8:251268-251290 CAGGGAATAGTGGTGGAGGAGGG + Intergenic
1035559517 8:594097-594119 CAGGCCTGTGTGGAGGAAGAAGG - Intergenic
1035619276 8:1025252-1025274 CGGGGGAGTGTGAAAGAGGGCGG - Intergenic
1035693764 8:1577836-1577858 CAGGGGCAGGTTGAGGAGGAAGG - Intronic
1036561974 8:9905847-9905869 GAGGGGAGGGTGGAGGAGGGAGG + Intergenic
1036692395 8:10952021-10952043 TAGGGGAGTGGGAAGGAGAAGGG + Intronic
1036823105 8:11955498-11955520 CAGCGCAGTGTGGAGGAGGGAGG + Intergenic
1037439090 8:18895964-18895986 CAGGGAAGTGTGGAGGGGAAGGG - Intronic
1037584731 8:20268684-20268706 GAGGCGAGAGTGGAGGAGGAAGG + Intronic
1037716813 8:21407907-21407929 CAGCAGAGTGGGGAGGAGGAAGG - Intergenic
1037754691 8:21703275-21703297 CAGGGGAGCCTAGGGGAGGAGGG + Intronic
1038247351 8:25871164-25871186 CAGGGAAGTAGGGAGGGGGAGGG - Intronic
1038335011 8:26639002-26639024 GAGAGGGGTGAGGAGGAGGACGG - Intronic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038494194 8:27990157-27990179 CTGAGGGGTGGGGAGGAGGAAGG - Intronic
1039378273 8:37059463-37059485 CAGGGGATTGATGGGGAGGAGGG + Intergenic
1039391497 8:37184458-37184480 AAGGGGAGGGTGGTGGAAGAGGG + Intergenic
1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG + Intergenic
1039424596 8:37475713-37475735 CAGGACTGTGTGCAGGAGGATGG + Intergenic
1039567784 8:38563854-38563876 AAGGGGAATGGGGAGGAGGAGGG - Intergenic
1039658784 8:39439527-39439549 GAGGGGAGGGGGGAGGGGGAGGG - Intergenic
1040071919 8:43195606-43195628 AAGGAGGGTGTGGAGGAGGATGG + Intronic
1040914977 8:52559473-52559495 AAGGAGAGTGAGGAGGAGAAAGG - Intronic
1040951378 8:52941161-52941183 AAGAGGAGGGTAGAGGAGGAGGG + Intergenic
1041110700 8:54479876-54479898 CAGTGTAGTGGGGAGGTGGAAGG + Intergenic
1041165756 8:55090793-55090815 CAGTGGAGAGTGGCTGAGGATGG - Intergenic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1041723463 8:60997165-60997187 CAGGTGTGTGTGGCGGGGGATGG + Intergenic
1041839093 8:62248715-62248737 GAGGGGAGTATGTAGGAGGTGGG - Intronic
1042038862 8:64570529-64570551 CAATGGAATTTGGAGGAGGAGGG + Intergenic
1043110079 8:76169594-76169616 CAGGGAGGTGTGGAGGGAGAGGG + Intergenic
1043923385 8:86009618-86009640 CAGGGTAGAGGGTAGGAGGAGGG - Intronic
1044169696 8:89034194-89034216 GAGGGGAGGAAGGAGGAGGAGGG + Intergenic
1044279254 8:90337414-90337436 AAGGGGGGTGTAGAGGGGGATGG - Intergenic
1044441606 8:92230775-92230797 CAGGGGGGTGTGGAGGGAGAGGG + Intergenic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045349979 8:101329758-101329780 CAGGGGAGTGGGAAGGAGGGAGG - Intergenic
1045501183 8:102745554-102745576 CTGGGGAGTGAGGGGGCGGAGGG - Intergenic
1045560499 8:103257429-103257451 CAGGTAAGCATGGAGGAGGAGGG - Intergenic
1045583153 8:103500557-103500579 CGGGGGAGGGTGGTGGAGTAAGG - Intergenic
1045674194 8:104589444-104589466 GCGGGGTGTGTGGAGGAGCACGG + Intergenic
1045825015 8:106386781-106386803 AAGGGAAGTGTGGAGAAGCAGGG + Intronic
1046936147 8:119887427-119887449 GAGGGGAGGGGGGAGGGGGAGGG - Intronic
1047252496 8:123191520-123191542 GTGGGGAGTGCAGAGGAGGAAGG - Intronic
1047283290 8:123464461-123464483 CAGCGGCATGAGGAGGAGGAAGG + Intronic
1047317563 8:123748255-123748277 GAGGGGAGGGGAGAGGAGGAGGG + Intergenic
1047317571 8:123748273-123748295 GAGGGGAGGGGAGAGGAGGAGGG + Intergenic
1047317579 8:123748291-123748313 GAGGGGAGGGGAGAGGAGGAGGG + Intergenic
1047415817 8:124663661-124663683 CAGAGGAGGTGGGAGGAGGATGG - Intronic
1047577178 8:126169416-126169438 ATGAGGAGTGAGGAGGAGGAAGG - Intergenic
1047612466 8:126534531-126534553 AAGGGGATTGTGGAGGTTGAAGG - Intergenic
1047749216 8:127867253-127867275 CCTGGGAGGGTGGAGGAGGAGGG + Intergenic
1047773434 8:128049307-128049329 CAAGGGAGAGTGAATGAGGAAGG + Intergenic
1048256138 8:132906568-132906590 CAGGGAAGGGGAGAGGAGGAGGG + Intronic
1048260096 8:132937981-132938003 CCGGGTGGAGTGGAGGAGGAGGG + Intronic
1048454535 8:134565960-134565982 CAGGTGAGTCTGCAGGATGATGG + Intronic
1048507140 8:135031806-135031828 AAGGGGAGTGGGTGGGAGGAAGG - Intergenic
1049046253 8:140154380-140154402 GAGGCCAGTGTGGAGGCGGAGGG - Intronic
1049083131 8:140457910-140457932 ATGGGGAGGGAGGAGGAGGAGGG + Intronic
1049235520 8:141510479-141510501 GGAGGGGGTGTGGAGGAGGAGGG - Intergenic
1049243495 8:141550281-141550303 CAGGTGAGCAGGGAGGAGGATGG + Intergenic
1049335788 8:142083974-142083996 AAGGGGAGTGGGGAGCAGGGTGG + Intergenic
1049442273 8:142614842-142614864 GAGGCGAGTGGAGAGGAGGAAGG - Intergenic
1049536572 8:143185415-143185437 GAGGGGAGTGGGCAGGATGACGG - Intergenic
1049544120 8:143221605-143221627 CAGGAGACTGGGTAGGAGGAGGG + Intergenic
1049564666 8:143331882-143331904 CAGGGCGGGGTGGAGGAGGCGGG + Intronic
1049657442 8:143805018-143805040 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1049805594 8:144537372-144537394 CAGGGAAGTTTGCAGGTGGAGGG - Intronic
1050233041 9:3548809-3548831 CTAGGGAGTATGCAGGAGGATGG + Intergenic
1050305634 9:4302822-4302844 GTAGGGAGTGTGGAGGAGGCAGG + Intronic
1050315595 9:4397781-4397803 GAGGGGAGGGGAGAGGAGGAAGG + Intergenic
1051261958 9:15273456-15273478 GGGAGGAATGTGGAGGAGGAGGG - Intronic
1051774814 9:20622065-20622087 CGGGGGGGGGTGGGGGAGGAGGG + Intronic
1052017542 9:23486657-23486679 CAGGGGATTCTGGAGAAGAAAGG + Intergenic
1052335027 9:27310685-27310707 CAGGGGAGGTTAGAGGAGGTTGG - Intergenic
1052353901 9:27484750-27484772 CAGGGCAGGGTAGAGGAGGCCGG - Intronic
1052470643 9:28890565-28890587 CAGAGGAGTTTGGAGGACAATGG + Intergenic
1052951966 9:34220049-34220071 GAGGGGAGAGGGGAGGGGGAGGG - Intronic
1053330903 9:37206312-37206334 GAGAGAAGTGGGGAGGAGGAGGG - Intronic
1053533362 9:38903567-38903589 TGGGAGAGTGTGGAGGAGGAGGG - Intergenic
1053576136 9:39358377-39358399 CAGGGGTGTGTGGTGGGTGAGGG - Exonic
1053840653 9:42186314-42186336 CAGGGGTGTGTGGTGGGTGAGGG - Exonic
1054097709 9:60917068-60917090 CAGGGGTGTGTGGTGGGTGAGGG - Intergenic
1054119111 9:61192698-61192720 CAGGGGTGTGTGGTGGGTGAGGG - Exonic
1054205588 9:62127996-62128018 TGGGAGAGTGTGGAGGAGGAGGG - Intergenic
1054588642 9:66989864-66989886 CAGGGGTGTGTGGTGGGTGAGGG + Intergenic
1054632773 9:67460374-67460396 TGGGAGAGTGTGGAGGAGGAGGG + Intergenic
1054849013 9:69827516-69827538 AAGGAGAAGGTGGAGGAGGAAGG - Intronic
1054901158 9:70370779-70370801 GAGGGGAAAGGGGAGGAGGAGGG + Intergenic
1055244125 9:74219903-74219925 GAGGTGAGTTTGGAGGAAGATGG + Intergenic
1055364479 9:75528004-75528026 CAGGGGAGTGTGCAAGGGGCAGG + Intergenic
1055509764 9:76984601-76984623 CTGGGCAGTCTGGATGAGGAGGG - Intergenic
1056103964 9:83328653-83328675 TAGGGGAGTGTGGATGATGAAGG + Intronic
1056552409 9:87663159-87663181 CAGTGGAGGGTGCAGGAGTAGGG - Intronic
1056584735 9:87920555-87920577 CAGGGGTGTGTGGTGGGTGAGGG - Intergenic
1056724936 9:89106502-89106524 CAGGGCAGCCTGGAGGAGCAGGG + Intronic
1056881274 9:90396047-90396069 CACAGGAGAGTGGAGGAGCAGGG - Intergenic
1057073575 9:92121605-92121627 GAGGGGAGTTGGGATGAGGAAGG - Intergenic
1057173687 9:92978713-92978735 GAGGGGAGGGGGGTGGAGGAAGG - Intronic
1057218754 9:93244388-93244410 CAGGAGAGTATGAAGGTGGAGGG - Intronic
1057295191 9:93830536-93830558 CAAGGGGGTGCAGAGGAGGAAGG - Intergenic
1057386495 9:94609824-94609846 CAGGGGTATGTGGAGGTGGGAGG - Intronic
1057404721 9:94758518-94758540 CAGGGAAGTGAGGAGGAGTTAGG + Intronic
1057690743 9:97282146-97282168 CAGGGGTGTGTGTAGGGGGGTGG - Intergenic
1057768099 9:97941306-97941328 GAGGGGAGTGTTAAGGAGGTGGG + Intronic
1057847507 9:98536899-98536921 CTGGGGACTGAGGAGCAGGATGG - Intronic
1057884744 9:98821798-98821820 CAGAGGAGTGGGGAGGGGGAAGG - Intronic
1057914016 9:99041696-99041718 AAGGGGATAGTGGAGGAGGCGGG + Intronic
1058637324 9:107049285-107049307 CAGTGGACAGTGCAGGAGGAGGG - Intergenic
1058715955 9:107722187-107722209 AAGGGGAGTGAAGAGGAGGGGGG - Intergenic
1058750328 9:108033003-108033025 CAGGTGAGTTTTGATGAGGATGG - Intergenic
1058873353 9:109221229-109221251 GAGGGGAGGGAGGGGGAGGAAGG + Intronic
1059027129 9:110646754-110646776 GAGGGGAGGGTGGAGGGGGGAGG + Intergenic
1059425481 9:114218315-114218337 CAGAGGAGTGTGGCAGGGGAGGG - Intronic
1059666497 9:116451064-116451086 CAGGGGAGTGGGGAGCTGGCAGG + Intronic
1059735683 9:117097221-117097243 CAGAGGAGTGTGGAGGGAAAAGG + Intronic
1059772806 9:117443723-117443745 CAGGGATGAGTGGAGGAGGCAGG + Intergenic
1059938944 9:119338924-119338946 CAGGGGGGTGGGGAGAAAGAAGG + Intronic
1060055916 9:120412898-120412920 CAGGGGAGAGTGGAGGAAGATGG - Intronic
1060123998 9:121024234-121024256 GAGGGGAGGGGGGAGGGGGAGGG + Intronic
1060190453 9:121589057-121589079 CTGGGGAGTGAGTAGGAGGCAGG - Intronic
1060521152 9:124294850-124294872 CAGGGGAGTGTGGAGGCTGAAGG + Intronic
1060554437 9:124500973-124500995 AAAGGCAGGGTGGAGGAGGAAGG - Intronic
1060558339 9:124521807-124521829 TAAGGGAGTGGGAAGGAGGAAGG + Exonic
1060952578 9:127613044-127613066 CAGGAGGGTGGGGAGGAGGAGGG - Intronic
1060979750 9:127785491-127785513 CGGGGGCGGGCGGAGGAGGAGGG + Intergenic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1060993612 9:127862750-127862772 GGGAGGAGTGTGGAGGAGGAGGG - Intergenic
1061082950 9:128383169-128383191 GAGGGGTGTGGGGAGGAGGGAGG - Intronic
1061222461 9:129260134-129260156 CAGGGGTGTGAGGCGGAGGGTGG - Intergenic
1061271365 9:129545389-129545411 CAGGGGACTGGGGAGGATGGGGG - Intergenic
1061273805 9:129558294-129558316 CAGTGGAGGCTGGAGCAGGATGG - Intergenic
1061283506 9:129610181-129610203 CAGGGGAGGGGGGAGGAGGGGGG + Intronic
1061322419 9:129839587-129839609 GAGGGGACTGTGGAGGGGGTGGG + Intronic
1061368501 9:130185091-130185113 GATGCGAGTGTGGACGAGGATGG - Intronic
1061394664 9:130337426-130337448 CAGGTGTGTGTGGCAGAGGAGGG + Intronic
1061492957 9:130956370-130956392 CAGGGGTGAGGCGAGGAGGAAGG + Intergenic
1061665147 9:132156315-132156337 CCATGGAGTGTGGAGGAGGTGGG + Intergenic
1061868430 9:133507293-133507315 CAGGAGTGTGGGGAGGAGGGAGG - Intergenic
1061890117 9:133614855-133614877 GATGGGGGTGAGGAGGAGGAGGG + Intergenic
1061909298 9:133714344-133714366 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1061930484 9:133830276-133830298 CACAGGAGTGAGGAGAAGGAAGG - Intronic
1061954636 9:133955405-133955427 CAGGGGGGTGGGGAGGAGTGTGG - Intronic
1061975548 9:134066663-134066685 CAGGGTAGGGCGGGGGAGGACGG + Intronic
1062143455 9:134973266-134973288 CAGGGGACTGTGGTGGTGTAAGG + Intergenic
1062147409 9:134997287-134997309 CAGGGCAGTGTGGAGGCTGAGGG + Intergenic
1062159024 9:135069572-135069594 GAGAGGTGTGAGGAGGAGGACGG + Intergenic
1062225272 9:135446681-135446703 CAGGGGTGGGGGGAGGGGGAGGG + Intergenic
1062225343 9:135446868-135446890 CAGGGGTGGGGGGAGGGGGAGGG + Intergenic
1062225380 9:135446962-135446984 CAGGGGTGGGGGGAGGGGGAGGG + Intergenic
1062225451 9:135447149-135447171 CAGGGGTGGGGGGAGGGGGAGGG + Intergenic
1062262956 9:135671921-135671943 CACGGGAGTCTGAAGGAGGCTGG + Intergenic
1062277762 9:135738820-135738842 CAGGGGAGTGAGAAGGAAGGAGG - Intronic
1062312817 9:135948520-135948542 CAGGGCAGGGTGGCGGGGGATGG - Intronic
1062469617 9:136696842-136696864 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469627 9:136696860-136696882 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469659 9:136696922-136696944 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469682 9:136696967-136696989 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469692 9:136696985-136697007 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469715 9:136697032-136697054 AGGGGGAGGGGGGAGGAGGAGGG - Intergenic
1062469726 9:136697051-136697073 AGGGGGAGGGGGGAGGAGGAGGG - Intergenic
1062488210 9:136791512-136791534 CAGGGAAGAGTGGCGGAGGCTGG + Intronic
1062546254 9:137064948-137064970 CAGGGGGGCCCGGAGGAGGACGG + Exonic
1062670197 9:137704289-137704311 TAGGGGAATGTGTGGGAGGAAGG + Intronic
1062741707 9:138178926-138178948 TGGGGGAGTGTGGGGGAGTATGG - Intergenic
1203458035 Un_GL000220v1:8293-8315 CAGGGGAGGGGCGAGGAGAAGGG - Intergenic
1185459862 X:328929-328951 AGGGGGAGAGAGGAGGAGGAGGG - Intergenic
1185581304 X:1213112-1213134 GAGGGGAGAGGGGAGGGGGAGGG - Intergenic
1185603604 X:1354987-1355009 GAGGGGAGAGAGGAGGAGGGAGG + Intronic
1185603722 X:1355325-1355347 GAAAGGAGAGTGGAGGAGGAGGG + Intronic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688287 X:1948332-1948354 GAGGGGAGAGGGGAGGAGGAGGG + Intergenic
1185688295 X:1948350-1948372 GAGGGGAGAGGGGAGGAGGAGGG + Intergenic
1185688302 X:1948368-1948390 GAGGGGAGAGGGGAGGAAGAGGG + Intergenic
1185688310 X:1948386-1948408 GAGGGGAGAGGGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688588 X:2133908-2133930 GAGGGGAGAGGGGAGGAGGAGGG + Intergenic
1186446044 X:9629873-9629895 TATGGGAGTGAGGAGCAGGACGG + Intronic
1186487118 X:9942021-9942043 CAGGGAACTGTGGATAAGGAAGG - Intronic
1186506589 X:10098306-10098328 CTGGGGAGGGGGGAGGGGGAAGG - Intronic
1186818814 X:13265311-13265333 CACAAGAATGTGGAGGAGGAGGG - Intergenic
1187155141 X:16714680-16714702 CAGGGGAGGCTGAAGCAGGAAGG + Intergenic
1187182537 X:16956602-16956624 CAGGACAGACTGGAGGAGGAGGG - Intronic
1187404743 X:18993173-18993195 CAGGGGAGCGGGGAGAAGAAGGG - Intronic
1187841170 X:23490065-23490087 AAGGGGAGGGGGGAGGGGGAGGG + Intergenic
1188024926 X:25198162-25198184 CAGGGTAGTGTGGAGGAGTAGGG + Intergenic
1188422152 X:30003283-30003305 AAGGGGTTTGTGGAGGAGAAAGG - Intergenic
1189160354 X:38804017-38804039 CAGGGCAGAGCAGAGGAGGAGGG - Exonic
1189293432 X:39901984-39902006 CAGGGGTGTGTGGGAGGGGAAGG + Intergenic
1189376702 X:40472293-40472315 TTGGGGTGTGGGGAGGAGGAGGG - Intergenic
1189507576 X:41627547-41627569 TAGGGGAGGGTGGAGGGGCAAGG - Intronic
1190029016 X:46953909-46953931 CAGGAGAGGGAGGAGGAGAAAGG - Intronic
1190172379 X:48121857-48121879 CAGGTGTGTGTGGTGGAGGGAGG + Intergenic
1190180132 X:48184922-48184944 CAGGTGTGTGTGGTGGAGGGAGG - Intergenic
1190183985 X:48219149-48219171 CAGGTGTGTGTGGTGGAGGGAGG + Intronic
1190189916 X:48268602-48268624 CAGGTGTGTGTGGTGGAGGAAGG + Intronic
1190193144 X:48294141-48294163 CAGGTGTGTGTGGTGGAGGGAGG - Intergenic
1190204839 X:48394537-48394559 CAGGTGTGTGTGGTGGAGGGAGG + Intergenic
1190205115 X:48396464-48396486 CGGGGGAGGGGGGAGGGGGAGGG - Intergenic
1190205697 X:48400866-48400888 CAGGTGTGTGTGGTGGAGGGAGG - Intergenic
1190520274 X:51272155-51272177 CAGATGTGTGTGGAGCAGGAGGG + Intergenic
1190598200 X:52066825-52066847 CAAGGGGGTGTGGAGGTGGCAGG + Intronic
1190610624 X:52187248-52187270 CAAGGGGGTGTGGAGGTGGCAGG - Intronic
1190665878 X:52695589-52695611 CAGGTGTGTGTGGTGGAGGGAGG - Intronic
1190673540 X:52762821-52762843 CAGGTGTGTGTGGTGGAGGGAGG + Intronic
1190708268 X:53048478-53048500 CAGGGGCGGGCGGAGGAGGAGGG - Intergenic
1190708648 X:53049891-53049913 TGGAGGAGAGTGGAGGAGGAGGG - Intronic
1190741073 X:53289159-53289181 CATGTGTGTGTGGAGGGGGAAGG - Intronic
1190881344 X:54494969-54494991 AAGGGACGTGGGGAGGAGGAGGG + Intronic
1190904244 X:54710450-54710472 AAGGGGATCGTGGAGGATGAGGG - Intergenic
1190983745 X:55482092-55482114 GAGGGAAGTGTGTAGGAGTAAGG + Intergenic
1191255203 X:58276689-58276711 CAGGGGAAGGTTGAGGAGGCCGG - Intergenic
1191984337 X:66962192-66962214 CTGGGCAGTGGGGTGGAGGAGGG + Intergenic
1192218390 X:69179817-69179839 CAGGGGAGAGAGGAGAAGGGGGG - Intergenic
1192302666 X:69921958-69921980 CAGAGGTATGTGGAGGAGGAGGG - Intronic
1192398147 X:70805695-70805717 CAGGAGATTATGGAGGAGGCTGG - Intronic
1192563120 X:72140450-72140472 CAGGGAAGTGTAGAGGACGAGGG + Exonic
1192594865 X:72395692-72395714 AAAGGCAGTCTGGAGGAGGAAGG + Intronic
1193199702 X:78673919-78673941 CAGGGGAGTGGGGATGACCAGGG + Intergenic
1194142999 X:90228418-90228440 CAAGGGAGCGTGAAGGAGGAGGG - Intergenic
1194507025 X:94745753-94745775 CAGGGGTGTGGGGGAGAGGAGGG - Intergenic
1195502491 X:105618275-105618297 CAGGGTGGAGTGTAGGAGGAGGG + Intronic
1195700809 X:107704273-107704295 CAGGGGAGGGTGCTGGTGGAAGG + Intergenic
1195958133 X:110356066-110356088 GAGGTTAGTGGGGAGGAGGAGGG + Intronic
1195980294 X:110570163-110570185 CTGGGGTGGGGGGAGGAGGAAGG - Intergenic
1196237503 X:113299899-113299921 GAGGGGAGAGGGGAGGGGGAGGG - Intergenic
1196281627 X:113829401-113829423 AAGAGGAGTCTGGAGGAAGAAGG - Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1198410577 X:136363022-136363044 CAGGGGAGGGTGGATGATGAGGG + Intronic
1199228709 X:145409827-145409849 CTGGGGTGTGTGGAGGATGATGG - Intergenic
1199326737 X:146507442-146507464 AAGGGGAGAGGGTAGGAGGATGG + Intergenic
1199341476 X:146682641-146682663 CTGGGAAGTGTAGTGGAGGATGG - Intergenic
1199715737 X:150506298-150506320 AAGGGGAGGGTAGAGGAGGAGGG - Intronic
1199720107 X:150537251-150537273 CATGGGGGCGTGGAGGAGGAAGG - Intergenic
1199819107 X:151427136-151427158 CAGGTGATTTTGGAGGACGAAGG + Intergenic
1200149107 X:153942797-153942819 CAGGGGAGTGGGGGAGTGGAAGG + Intronic
1200230940 X:154443690-154443712 AGGGGGAGTGTGGTGGAGGGCGG + Intergenic
1200253103 X:154564271-154564293 AAGGGGAGGATGGAGGGGGACGG - Intronic
1200264664 X:154640144-154640166 AAGGGGAGGATGGAGGGGGACGG + Intergenic
1200488752 Y:3797737-3797759 CAAGGGAGCGTGAAGGAGGAGGG - Intergenic
1200656859 Y:5912691-5912713 GAGGGGAGAGGGGAGGGGGAGGG + Intergenic
1200831850 Y:7693181-7693203 CAGGGCAGTGGGGATGAGGATGG - Intergenic
1201728591 Y:17182277-17182299 AAAGGGAGGGTAGAGGAGGAGGG - Intergenic
1202119275 Y:21507799-21507821 CAGGGAAGTGTGGGTGATGATGG + Intergenic
1202121727 Y:21531339-21531361 CAGGGAAGTGTGGGTGATGATGG + Intronic
1202157278 Y:21898043-21898065 CAGGGAAGTGTGGGTGATGATGG - Intronic
1202159725 Y:21921584-21921606 CAGGGAAGTGTGGGTGATGATGG - Intergenic